Small molecule nucleic acid drug FAM99Bcore and application thereof in targeted therapy of liver cancer

Abstract

The invention discloses application of a core sequence FAM99Bcore and GalNAc-FAM99Bcore, which are used for combining FAM99B with DDX21 and promoting cutting and degradation of the DDX21, in treatment of liver cancer. The GalNAc-FAM99Bcore can be used for effectively inhibiting the in-vivo progress and metastasis of the nude mouse liver orthotopic xenograft tumor, and has a very high clinical transformation value and a very high market prospect.

Description

Technical Field

[0001] The present invention relates to the field of medicine, and in particular to a small molecule nucleic acid drug FAM99Bcore and its application in targeted treatment of liver cancer. Background Art

[0002] N-acetylgalactosamine (GalNAc)-coupled small interfering RNA (siRNA) can be used to specifically target target genes in liver cells to achieve the purpose of silencing target genes. However, silencing target genes in liver cancer cells involves the problem of silencing efficiency. Due to the high heterogeneity of liver cancer cells, liver cancer cells may not be able to silence target genes due to abnormal function of the silencing complex, thereby affecting the silencing efficiency of liver cancer cell target genes and reducing the treatment effect of liver cancer.

[0003] The expression of lncRNA FAM99B in liver cancer cells is significantly lower than that in normal liver tissue, but its mechanism of action and core functional domain are still unclear. Summary of the invention

[0004] To solve the above problems, the present invention has found through research that FAM99B interacts with DDX21 in liver tissue and promotes the cleavage and degradation of DDX21. The reduction of FAM99B expression in liver cancer tissue leads to abnormal accumulation of DDX21, which in turn promotes the occurrence of liver cancer. At the same time, the present invention has identified the core sequence FAM99B that binds to DDX21 and promotes the cleavage and degradation of DDX21. core And verified its therapeutic effect on liver cancer in vivo.

[0005] Specifically, the first aspect of the present invention provides an isolated nucleic acid comprising the nucleotide sequence shown in SEQ ID NO: 2 or a variant sequence obtained by inserting, deleting or replacing one or more bases based on SEQ ID NO: 2.

[0006] In certain embodiments, the variant sequence has at least 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 2, and has the function of directly binding to DDX21 and promoting the cleavage and degradation of DDX21.

[0007] In certain embodiments, the nucleic acid does not comprise the nucleotide sequence shown in SEQ ID NO:1.

[0008] In certain embodiments, the nucleic acid is DNA or RNA.

[0009] In certain embodiments, the nucleic acid comprises a modification.

[0010] In certain embodiments, the modification comprises a 2'-OMe modification, a 2'-F modification, a 2'-MOE or a phosphorothioate PS backbone modification.

[0011] The second aspect of the present invention provides a drug delivery system, comprising the nucleic acid described in the first aspect of the present invention and a delivery vector.

[0012] In certain embodiments, the delivery vehicle is selected from the group consisting of liposomes, lipid nanoparticles (LNPs), lipoplexes, lipid polyplexes (LPPs), and N-acetylgalactosamine (GalNAc).

[0013] In certain embodiments, it is characterized in that the nucleic acid is conjugated to GalNAc.

[0014] The third aspect of the present invention provides a pharmaceutical composition comprising the nucleic acid described in the first aspect of the present invention or the delivery system described in the second aspect of the present invention.

[0015] In certain embodiments, it further comprises a second therapeutic agent; preferably, the second therapeutic agent is selected from small molecule therapeutic drugs, therapeutic antibodies, CAR-T, TCR-T, chemotherapy drugs and radiotherapy drugs.

[0016] The fourth aspect of the present invention provides use of the nucleic acid described in the first aspect of the present invention, the delivery system described in the second aspect of the present invention, or the composition described in the third aspect of the present invention in the preparation of a drug for treating liver cancer.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The present invention confirms through research that the expression of FAM99B in liver cancer cells is significantly reduced, resulting in abnormal accumulation of DDX21 in liver cancer cells and increased protein synthesis levels in liver cancer cells, thus promoting the occurrence and development of liver cancer. Further, the present invention identifies the core sequence FAM99B that binds to DDX21 and promotes the cleavage and degradation of DDX21. core When FAM99B expression was restored in liver cancer cells or FAM99B core It can significantly inhibit the growth, proliferation and migration of liver cancer cells.

[0019] Compared with GalNAc-siRNA, which relies on the complete gene silencing system of liver cancer cells to function, FAM99Bcore directly binds to the abnormally expressed DDX21 in liver cancer cells, promoting the cleavage and degradation of DDX21, thereby inhibiting the progression and metastasis of liver cancer. GalNAc-FAM99Bcore can circumvent the inability of GalNAc-siRNA to fully exert its therapeutic effect due to abnormal gene silencing system caused by liver cancer heterogeneity.

[0020] ASGPR is a receptor specifically expressed on the surface of liver cell membranes. Other tissues, organs and cell types do not express ASGPR. There are about 500,000 ASGPR receptors on the surface of each liver cell membrane. After the ASGPR receptor recognizes GalNAc, the liver cell will internalize GalNAc. Therefore, the delivery method of coupling FAM99Bcore with GalNAc can specifically target liver cells and avoid off-target effects.

[0021] GalNAc-FAM99Bcore can achieve good drug distribution effects through subcutaneous injection and efficiently target the liver. Compared with intravenous injection, it requires a smaller dose and significantly reduces the side effects of administration.

[0022] The in vivo study results of the present invention show that GalNAc-FAM99Bcore can effectively inhibit the in vivo progression and metastasis of orthotopic xenograft tumors in nude mice liver, and has high clinical transformation value and market prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0024] Figure 1 The results showed that FAM99B is a lncRNA specifically expressed in liver tissue.

[0025] Figure 2 The results showed that FAM99B expression in liver cancer tissues was correlated with prognosis.

[0026] Figure 3 In vitro experimental studies show the correlation between FAM99B and liver cancer cell proliferation, migration and invasion.

[0027] Figure 4 In vivo experiments showed the correlation between FAM99B and liver cancer growth and metastasis.

[0028] Figure 5 It was shown that FAM99B inhibited the proliferation, migration and invasion of liver cancer cells by regulating DDX21 degradation.

[0029] Figure 6 It was shown that FAM99B was identified to be able to bind to the core sequence FAM99Bcore of DDX21.

[0030] Figure 7 Show the therapeutic effect of GalNAc-FAM99Bcore in vivo. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solution and advantages of the embodiment of the present invention clearer, the technical solution of the embodiment of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all of the embodiments. Based on the described embodiment of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] Unless otherwise defined, technical or scientific terms used herein shall have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs.

[0033] Example 1 Experimental method

[0034] 1.1 RNA sequencing dataset download and analysis

[0035] In this study, the following data were used to analyze the expression and prognosis of FAM99B in different tissues and organs / clinical patients:

[0036] 1) Analyze the expression level of FAM99B in different tissues and organs in the Genotype-Tissue Expression (GTEx) database (https: / / www.gtexportal.org / home / ).

[0037] 2) Analyze the expression and prognosis of FAM99B in 369 HCC cases from the TCGA-LIHC cohort (https: / / portal.gdc.cancer.gov / ).

[0038] 3) To analyze the expression and prognosis of FAM99B in 105 HCC cases from the GepLiver cohort (http: / / www.gepliver.org / ).

[0039] 4) Analyze the expression of FAM99B in the GSE77314 cohort and the GSE144269 cohort in the Gene Expression Omnibus (GEO) database (https: / / www.ncbi.nlm.nih.gov / gds).

[0040] 5) Analyze the prognosis of FAM99B in the ICGC database (https: / / dcc.icgc.org / ).

[0041] 1.2 Cell culture

[0042] HepG2, SK-Hep1, HepG2-C3A and HEK-293T were obtained from the American Type Culture Collection (ATCC). Huh7, MHCC-97L, MHCC-97H, HCCLM3 and SNU-449 cells were purchased from the Shanghai Cell Bank Type Culture Collection Committee (CBTCCC). The cells were cultured in high-glucose DMEM medium supplemented with 10% fetal bovine serum (FBS) and 1% double antibiotics (penicillin and streptomycin) at 37°C and 5% CO 2 Incubator. Take the culture of adherent cells in a 6 cm dish as an example: discard the original cell culture medium, wash once with 1× PBS, add 1 ml of trypsin to digest the cells, gently shake the dish during digestion so that the trypsin can evenly cover the adherent cells, and observe the dispersion of the cells under a microscope. After 2-5 minutes of digestion, when there is a gap between the cells, add 3 ml of DMEM culture medium, blow and mix, and transfer the cell suspension to a new cell culture dish. Place the dish at 37°C, 5% CO 2 Culture the cells in a cell culture incubator and subculture them every 2-3 days.

[0043] 1.3 Real-time fluorescence quantitative PCR (qPCR)

[0044] Cellular RNA was extracted using TRIzol reagent (Invitrogen, CA, USA) and reverse transcribed into cRNA using Evo M-MLV RT MasterMix (Accurate Biology, Hunan, China).

[0045] The qPCR reaction used SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology, Hunan, China), and three replicate wells were set up for each group of samples.

[0046] Prepare the reaction system (8 μL) in a 384-well plate:

[0047] cDNA 3μL

[0048] Primers mix (F+R) 1μL

[0049] 2×SYBR Green Premix (containing ROX) 4μL

[0050] After the sample addition, seal the 384-well plate, centrifuge it briefly, and place it in the QuantStudio 5 Real-Time PCR System instrument for qPCR reaction. Set the reaction program:

[0051] Pre-denaturation at 95°C for 15 s; denaturation at 95°C for 5 s, annealing and extension at 60°C for 30 s, and 40 reaction cycles.

[0052] After the reaction is completed, the CT value is derived, and ACTB is used as the internal reference. The calculation method is ΔCT = CT value of the experimental group (target gene) - CT value of the control group (internal reference gene), and 2^-ΔCT is the relative expression level of the gene.

[0053] Table 1 qPCR primer sequences

[0054]

[0055] 1.5 Construction of plasmid for overexpression of FAM99B

[0056] Specific amplification primers were designed according to the full-length sequence of FAM99B, and 15-20 nt sequences overlapping with the two ends of the overexpression vector after restriction enzyme linearization were added to the 5' end of the primer. The full-length fragment of FAM99B was amplified by PCR using PrimeSTAR HS Premix high-fidelity enzyme (Takara, Japan); the pCDH-CMV (Addgene#72265) vector was digested with EcoR I-HF (New England Biolabs, MA, USA) and BamH I-HF (New England Biolabs, MA, USA); the full-length fragment of FAM99B was connected to the pWPXL vector by seamless cloning using ClonExpressUltra One Step Cloning Kit (Vazyme, Nanjing, China); the transformed plasmid was sent for sequencing and identified as correct, indicating that the FAM99B overexpression plasmid was successfully constructed, and the empty vector without the FAM99B fragment inserted was the Vector negative control.

[0057] FAM99B full length sequence (SEQ ID NO: 1):

[0058] AGGGCTGCAGGCACTCCTGGGAGCAGGAGGAGGGTGGCCTGTCCTGGGCAGACCAGCCTCTCTGGGCTGTGTGGCCCCAGCTCCCTGAGCCCAGAGGGAGGTGAGGGTGAGAAGGCCTGGACCAGGCAGGACGCAGCCCCCAGGGCCCCTGCTGGGAAGAGGTCAGAACCTCCCAAGGACCCAGAAGGCCAGAACACACTAGAGGGTCCCGGCATCCTGATGAGTCCACTGTCCCCGCGATGGTTTTCAGGGATGGAGAAGGCTCCCTGTCCTCCGCTGGAACCCTGCAGCCGGGCTGACGAGACCCCAGCGAGACCTGCAGAACATT.

[0059] Construction of pWPXL-EGFP-Luciferase plasmid for mouse in vivo imaging experiments

[0060] The luciferase gene (Luciferase) was cloned into the pWPXL vector (Addgene#12257). The pWPXL vector itself contained EGFP. Luciferase was inserted after EGFP for fusion expression to obtain the pWPXL-EGFP-Luciferase plasmid.

[0061] 1.6 Lentivirus packaging and infection, construction of stable expression cell lines

[0062] Lentivirus packaging: After trypsin digestion of HEK-293T cells in good growth state, take an appropriate amount of cells and inoculate them into 6-well plates. After culturing overnight, the density reaches 80% and lentivirus packaging can be carried out; 2 μg of target lentivirus vector plasmid, 1.4 μg packaging plasmid psPAX2 (Addgene#12260), 0.7 μg envelope plasmid pMD2.G (Addgene#12259) and 400 μL serum-free DMEM culture medium are mixed, and 10 μL liposome transfection reagent and 400 μL serum-free DMEM culture medium are mixed in another EP tube, and the mixture is incubated at room temperature. Let stand for 5 minutes; mix the two systems, gently blow and mix, and let stand for 15 minutes; take out the 6-well plate HEK-293T cells from the incubator, discard the culture medium, add 1.2mL of serum-free culture medium to each well, and then slowly add the incubated transfection system along the well wall, mix well, and return to the incubator; after 6-8 hours of culture, replace the culture medium with 2mL of fresh complete culture medium; collect the culture medium 48 hours after transfection, aspirate the culture medium with a syringe, filter it through a 0.45μm filter membrane, and collect it in an EP tube to obtain the virus liquid, which can be used directly to infect cells or stored in a -80℃ refrigerator.

[0063] Lentivirus infection and stable strain construction: Lentivirus infection can be performed when the cell density in good condition reaches 70%. Taking a six-well plate as an example, replace the cells with fresh culture medium and add polybrene with a final concentration of 6μg / mL, and put them back into the incubator; after 10 minutes, take out the cells, add an appropriate amount of virus solution to the wells, and replace with fresh culture medium after infection overnight; after 36 to 48 hours, the infection efficiency of the fluorescent plasmid can be observed by fluorescence microscopy and subsequent flow sorting can be performed; the corresponding screening drug can be added to the antagonistic screening plasmid, and the RNA efficiency can be extracted after screening. After confirming the stable expression strain with good efficiency, the cell function experiment can be directly carried out, and the stable cell line can be frozen at the same time.

[0064] 1.7 In vitro cell function assay

[0065] 1) CCK8 cell proliferation assay

[0066] The cells in good condition were digested with trypsin, and the cells were blown evenly with serum-free medium and transferred to EP tubes. After gently blowing evenly, 10 μL of cell suspension was aspirated and mixed with 10 μL of trypan blue (Invitrogen, CA, USA). After blowing evenly, 10 μL was added to the Countess cell counting chamber slide (Invitrogen, CA, USA) and placed in an automatic cell counter for counting. According to the cell counting results, the cells were diluted to 1×10 with complete medium. 4 / mL, blow evenly, and then use a spray gun to inoculate 100μL per well into a 96-well cell culture plate and place it in an incubator for culture. After the cells adhere to the wall, CCK-8 cell proliferation activity detection is performed on the 1st, 3rd, and 5th days respectively. The culture medium of the well to be tested is discarded, and 100μL of complete culture medium containing 10% CCK8 reagent (MCE, Shanghai, China) is added. After returning to the incubator and continuing to culture for 2h, the OD450nm is detected by a microplate reader.

[0067] 2) Cell clone formation experiment

[0068] After digestion, count the cells in good condition and adjust the concentration of the cell suspension with complete culture medium. Then take 100 μL per well (1000 / 2000 / 3000 cells) and add them to six-well plates. For each cell type, make three replicate wells, add 2 mL of complete culture medium to each well, mix well and place in an incubator for culture. After a few days, add an appropriate amount of culture medium to replenish consumption. Culture for 8 to 14 days, observe the clone formation under a microscope, discard the culture medium if the clone grows well, wash twice with PBS, absorb the remaining PBS liquid, add 0.1 mg / mL crystal violet solution prepared with methanol, let it stand at room temperature for staining for 15 minutes, absorb the crystal violet solution, wash thoroughly with tap water, dry at room temperature and scan the image. Count the number of clones based on the scanned image, and analyze the differences between the experimental group and the control group.

[0069] 3) Cell migration and invasion assay

[0070] Take liver cancer cells with good growth status, digest them with trypsin, and then pipette them into cell suspension with serum-free culture medium. Take 10 μl of cell suspension and pipette 10 μl of trypan blue to mix well. Count the cells with a cell counter and record the cell concentration. Adjust the cell concentration to 5×10 cells per 200 μl. 4 Huh7 cells, 8×10 per 200 μl 4 HepG2 cells.

[0071] Add 800 μl of complete culture medium to the bottom of the 24-well plate, place the Transwell chamber in the 24-well plate (for cell invasion experiments, 50 μl of Matrigel should be evenly spread on the bottom of each chamber in advance), pipette 200 μl of pre-adjusted cell suspension and add it to the Transwell upper chamber, put the 24-well plate back into the cell culture incubator, collect Huh7 cells after 16 hours, and collect HepG2 cells after 48 hours.

[0072] Add crystal violet to the 24-well plate, and then place the chamber in the 24-well plate for staining for 10 minutes. After staining, rinse with clean water and gently wipe the cells and Matrigel that have not passed through the upper chamber with a cotton swab. Observe cell migration / invasion under an inverted microscope at 4x and 10x magnification, and take photos for preservation.

[0073] 1.8 Nude mouse subcutaneous tumor formation experiment

[0074] Huh7 cells with good growth status were continuously subcultured and expanded. When the cells reached the required number of cells for the experiment and were in the logarithmic growth phase, they were digested with trypsin, suspended with complete medium, collected and placed in a 50ml centrifuge tube, centrifuged at 1000rpm for 5min, and the supernatant was discarded. 3ml PBS was added for washing, centrifuged at 1000rpm for 10min, and the supernatant was discarded. The cells were thoroughly blown and mixed with complete medium to make a cell suspension, and the cells were diluted 100 times and counted. Finally, the concentration of the cell suspension was adjusted to 1×10 6 Pieces / ml.

[0075] Six-week-old female BALB / c nude mice were divided into two groups: control group and FAM99B overexpression group. 1×10 6 Huh7 cells were inoculated into the subcutaneous part of mice. The diameter of the transplanted tumors in mice was measured with a vernier caliper from the second week, once a week for 5 consecutive weeks, and a growth curve was drawn based on the measurement records. After 5 weeks, the mice were euthanized, the subcutaneous tumors were collected, the tumor weights were weighed, and photos were taken. The tumors were fixed in 4% paraformaldehyde and subsequently used for paraffin embedding, sectioning and staining. At the same time, part of the tumor was frozen for subsequent experiments.

[0076] 1.9 Orthotopic liver transplantation in nude mice

[0077] Six-week-old female BALB / c nude mice were selected and divided into a control group and a FAM99B overexpression group. Huh7 cells in the logarithmic growth phase were obtained, digested and counted. According to the counting results, 2×10 6 Cells were resuspended to 24 μl with PBS. The in situ liver animal model was established: the nude mice were weighed, anesthetized with tribromoethanol, the skin was disinfected with 75% alcohol before surgery, the mouse chest incision was about 1.0 cm, the liver was gently pulled out of the chest cavity with tissue forceps, the cells were injected in situ, hemostasis was stopped by pressing, the wound was sutured, and the surgical operation process strictly followed the aseptic operation principle. After waking up from anesthesia, the mice were kept in an independent IVC cage.

[0078] The weight changes, tumor formation and metastasis of mice were observed regularly. Approximately 7 weeks later, the liver in situ tumors were collected for anatomical examination and fixed with 4% paraformaldehyde. They were then embedded in paraffin, sliced ​​and stained. Part of the tumor was frozen for subsequent experiments.

[0079] 1.10GalNAc-FAM99B core Treatment of nude mouse liver orthotopic transplanted tumor model

[0080] GalNAc-FAM99B for in vivo animal experiments core Biosynthesis in Hippopotamus huzhouensis.

[0081] GalNAc-FAM99B core The targeting sequence is (SEQ ID NO: 2): TGTGTGGCCCCAGCTCCCTGAGCCCAGAGGGAGGTGAGGGTGAGAAGGC CTGGACCAGGCAGGACGCAGCCCCCA.

[0082] The GalNAc-NC targeting sequence is (SEQ ID NO: 3): GCCCCTCGCGCATCCGGGTGCTACTGAGGAGCGGGAGCGGGAAATAGGT GCCGCAGGCCCAGCCGCACAGAGAT, which is synthesized by Hippopotamus biosynthesized.

[0083] GalNAc-NC and GalNAc-FAM99B core All are chemically modified with 2'-OMe. GalNAc is linked to the 3' end of the nucleic acid sequence.

[0084] The sequence modified with GalNAc-NC is / i2OMeG / / i2OMeC / / i2OMeC / / i2OMeC / / i2OMeC / / i2OMeU / / i2OMeC / / i2OMeG / / i2OMeC / / i2OMeG / / i2OMeC / / i2OMeA / / i2OMeU / / i2OMeC / / i2OMeC / / i2OMeG / / i2OMeG / / i2OMeG / / i2OMeU / / i2OMeG / / i2OMeC / / i2OMeU / / i2OMeA / / i2OMeC / / i2OMeU / / i2OMeG / / i2OMeG / / i2OMeA / / i2OMeG / / i2OMeG / / i2OMeA / / i2OMeG / / i2OMeC / / i2OMeG / / i2OMeG / / i2OMeG / / i2OMeA / / i2OMeG / / i2OMeC / / i2OMeG / / i2OMeG / / i2OMeG / / i2OMeA / / i2OMeA / / i2OMeA / / i2OMeU / / i2OMeA / / i2OMeG / / i2OMeG / / i2OMeU / / i2OMeG / / i2OMeC / / i2OMeC / / i2OMeG / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeG / / i2OMeC / / i2OMeC / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeC / / i2OMeC / / i2OMeG / / i2OMeC / / i2OMeA / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeA / / i2OMeG / / i2OMeA / / i2OMeU / .

[0085] GalNAc-FAM99B coreThe modified sequences are / i2OMeU / / i2OMeG / / i2OMeU / / i2OMeG / / i2OMeU / / i2OMeG / / i2OMeG / / i2OMe C / / i2OMeC / / i2OMeC / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeC / / i2OMeU / / i2OMeC / / i2OM eC / / i2OMeC / / i2OMeU / / i2OMeG / / i2OMeA / / i2OMeG / / i2OMeC / / i2OMeC / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeA / / i2OMeG / / i2OMeG / / i2OMeG / / i2OMeA / / i2OMeG / / i2O MeG / / i2OMeU / / i2OMeG / / i2OMeA / / i2OMeG / / i2OMeG / / i2OMeG / / i2OMeU / / i2OMe G / / i2OMeA / / i2OMeG / / i2OMeA / / i2OMeA / / i2OMeG / / i2OMeG / / i2OMeC / / i2OMeC / / i2OMeU / / i2OMeG / / i2OMeG / / i2OMeA / / i 2OMeC / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeG / / i2OMeC / / i2OMeA / / i2OMeG / / i2OMeG / / i2OMeA / / i2OMeC / / i2OMeG / / i2OMe C / / i2OMeA / / i2OMeG / / i2OMeC / / i2OMeC / / i2OMeC / / i2OMeC / / i2OMeC / / i2OMeA / .

[0086] Construction of a cell line stably expressing EGFP-Luciferase: Huh7 cells were infected with pWPXL-EGFP-Luciferase virus, and cells were collected 48 hours later for flow cytometry sorting to obtain GFP-positive cells, which were further expanded and cultured to obtain a liver cancer cell line stably expressing EGFP-Luciferase.

[0087] Twelve 6-week-old male BALB / c nude mice were injected with 5×10 6Huh7 cells stably expressing EGFP-Luciferase (volume 50 μL, Matrigel and empty culture medium mixed 1:1). The cell suspension was injected into the mouse liver by orthotopic liver transplantation in nude mice. Seven days after orthotopic transplantation, each mouse was intraperitoneally injected with 150 mg / kg D-Luciferin (Yeasen, Shanghai, China) and anesthetized by inhalation of isoflurane (RWD, Shenzhen, China), and then imaged and collected using the IVIS LuminaLT Series III in vivo imaging system. The nude mice were randomly divided into two groups (N = 6 / group) and subcutaneously injected with GalNAc-NC and GalNAc-FAM99B, respectively. core The treatment experiment was conducted with 5 mg / kg once a week for two consecutive weeks, and live imaging was performed every week. After the third week of imaging, the mice were euthanized, the mouse livers were dissected out of the body, and photographed and preserved, a small piece of tumor tissue was retained for RNA and protein extraction, and then the mouse livers and mouse lungs were fixed in 4% paraformaldehyde for subsequent H&E staining and immunohistochemical staining.

[0088] Example 2 Experimental results

[0089] 2.1FAM99B is a lncRNA specifically expressed in liver tissue

[0090] Tissue-specific lncRNAs always have specific functions in different tissues. In order to systematically study tissue-specific lncRNAs, the inventors used the gene expression profiles of multiple tissue types to calculate the tissue-specific score of each gene. When the gene's maximum tissue expression ratio score is 2 times or more of the second-ranked score, and its specificity score is greater than 1, the inventors believe that the gene is tissue-specifically expressed, and the tissue type with the highest expression ratio score is the tissue with specific expression. The inventors analyzed tissue-related RNA-seq data in the GTEx (Genotype-Tissue Expression Project) database and identified many tissue-specific lncRNAs expressed in different tissues ( Figure 1 A in the figure). Among them, 107 lncRNAs are specifically expressed in liver tissue. These liver tissue-specific lncRNAs were screened according to the following criteria: 1) According to the TCGA-LIHC (https: / / portal.gdc.cancer.gov / ) database, lncRNAs were downregulated by 2 times or more in liver cancer tissues compared with adjacent tissues; 2) According to the TCGA-LIHC database, lncRNAs were significantly associated with a better prognosis in liver cancer patients. After the above screening, 13 candidate lncRNAs were obtained ( Figure 1B in the figure). The 13 candidate genes were ranked according to the multiples of differential expression between cancer and adjacent normal tissues, and lcnRNAs that have been reported to explain their functions and detailed molecular mechanisms in the occurrence and development of liver cancer were excluded. The inventors took FAM99B as the object of further exploration. The results of the GTEx database further showed that FAM99B was specifically expressed in liver tissue ( Figure 1 C).

[0091] 2.2 Correlation between FAM99B expression in liver cancer tissue and prognosis

[0092] To investigate the expression and prognosis of FAM99B in HCC, 369 HCC cases in the TCGA-LIHC cohort and 105 HCC cases in the GepLiver cohort (http: / / www.gepliver.org / ) were analyzed. The results showed that FAM99B was lowly expressed in HCC and highly expressed in adjacent tumors ( Figure 2 The same results were obtained in two different HCC cohorts (GSE77314 and GSE144269) in the GEO (Gene Expression Omnibus) database ( Figure 2 In order to further study the clinical significance of FAM99B in the occurrence and development of liver cancer, the correlation between FAM99B expression and clinical characteristics of HCC patients was analyzed by Kaplan-Meier survival method, and it was found that high expression of FAM99B was associated with a better prognosis of HCC patients ( Figure 2 The above results suggest that FAM99B may play a role of tumor suppressor in liver cancer.

[0093] 2.3 In vitro studies on the correlation between FAM99B and liver cancer cell proliferation, migration and invasion

[0094] In order to study the biological function of FAM99B in HCC cells, we first established cell lines stably overexpressing FAM99B in liver cancer cell lines Huh7 and HepG2. The effect of overexpressing FAM99B on the proliferation of liver cancer cells was detected by Cell counting kit-8 (CCK-8) experiment and clone formation experiment. The results of CCK-8 experiment showed that the proliferation ability of HCC cells was significantly weakened after overexpression of FAM99B ( Figure 3 A in the figure shows that the clone formation ability of HCC cells was significantly inhibited after overexpression of FAM99B ( Figure 3 In addition, the inventors tested the effect of overexpression of FAM99B on cell migration and invasion ability through migration and invasion experiments. The results of migration and invasion experiments showed that the migration and invasion ability of HCC cells overexpressing FAM99B was significantly weakened compared with that of HCC cells in the control group ( Figure 3 The above results indicate that overexpression of FAM99B can inhibit the proliferation, migration and invasion of HCC cells.

[0095] 2.4 In vivo studies on the correlation between FAM99B and liver cancer growth and metastasis

[0096] In order to further study the biological function of FAM99B in HCC cells in vivo, nude mouse subcutaneous tumor formation and nude mouse liver orthotopic transplantation tumor experiments were performed. First, the inventors stably overexpressed FAM99B in 1×10 6 Huh7 cells and an equal amount of control Huh7 cells were injected into the flank of BALB / c nude mice, with 6 nude mice in each group. The weight changes were monitored from the second week and the diameter of the transplanted tumor was measured with a vernier caliper once a week for five consecutive weeks. On the 21st day, the mice were euthanized by carbon dioxide and the tumor was removed. The results of the nude mouse subcutaneous tumor formation experiment showed that the subcutaneous tumor volume of the mice injected with FAM99B overexpressing cells was smaller than that of the mice injected with control cells ( Figure 4 A and B in the figure), and lighter in weight ( Figure 4 C), indicating that the proliferation ability of tumors in the FAM99B overexpressing group was lower than that in the control group. To further verify the effect of FAM99B on HCC cell proliferation and metastasis in vivo, the inventors constructed an orthotopic xenograft tumor model of liver cancer. 2×10 6 The Huh7 cells stably expressing EGFP-Luciferase and overexpressing FAM99B were injected into the nude mice, and the same amount of Huh7 cells stably expressing EGFP-Luciferase was used as the control group. There were 6 nude mice in each group. The mice were euthanized after about 5 weeks and the liver orthotopic tumors were collected. The experimental results of the orthotopic xenograft tumor model of liver cancer showed that the nude mice in the group overexpressing FAM99B had fewer tumor foci in the liver and smaller tumors ( Figure 4 D), H&E staining of the liver of nude mice revealed that overexpression of FAM99B could significantly inhibit the proliferation and metastasis of HCC cells ( Figure 4 The above results indicate that FAM99B can significantly inhibit the proliferation and metastasis of HCC in vivo.

[0097] 2.5FAM99B inhibits liver cancer cell proliferation, migration and invasion by regulating DDX21 degradation

[0098] In order to explore the molecular mechanism of FAM99B's biological function, the proteins that may interact with FAM99B were screened by RNA pull-down of FAM99B combined with mass spectrometry (M / S). The mass spectrometry results showed that FAM99B and DDX21 bind to each other. Furthermore, the inventors verified the binding of DDX21 and FMA99B by Western Blot experiments ( Figure 5 Next, the inventors used RNA immunoprecipitation to perform reverse experimental verification. In the HCC cell lines Huh7 and HepG2, the endogenous antibody of DDX21 and the negative control IgG antibody were used to perform RIP experiments to obtain RNA bound to the protein. After the immunoprecipitation efficiency was detected by Western blot, the enrichment level of FAM99B was detected by qPCR. The results showed that compared with the IgG antibody in the control group, the DDX21 antibody in the experimental group was able to significantly enrich FAM99B ( Figure 5 B), indicating that DDX21 can bind to FAM99B. Overexpression of FAM99B in liver cancer cells can significantly inhibit the expression of DDX21 ( Figure 5 C in the figure). This indicates that FAM99B can promote the degradation of DDX21 by binding to DDX21. In order to explore whether FAM99B plays a tumor suppressor function in HCC through DDX21, the inventors overexpressed FAM99B and DDX21 in Huh7 and HepG2 cells to perform functional recovery experiments. The results of CCK-8, clone formation, migration and invasion experiments showed that the proliferation, migration and invasion ability of HCC cells were inhibited after overexpression of FAM99B, but after overexpression of DDX21 at the same time, the inhibition of FAM99B on the proliferation, clone formation, migration and invasion ability of HCC cells was restored ( Figure 5 The above results indicate that FAM99B functions to inhibit HCC cell biology through DDX21, and DDX21 is a functional target gene of FAM99B.

[0099] 2.6 Identification of the core sequence of FAM99B that can bind to DDX21 core

[0100] In order to further explore the potential therapeutic role of FAM99B in HCC, we wanted to determine the core sequence of FAM99B that functions in HCC. Based on the secondary structure predicted by RNAfold (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi), the inventors constructed three truncations of FAM99B (fragment #A: 1-239; 869-1066nt, fragment #B: 240-573nt, fragment #C: 574-868nt) to determine the fragment of FAM99B that binds to DDX21 ( Figure 6 The results of RNA pulldown experiments using probes of FAM99B fragment #A, fragment #B, and fragment #C showed that the fragment #A of FAM99B ( Figure 6 C in the figure). Then, according to the secondary structure of FAM99B, fragment #A was further truncated into #A1, #A2, #A3 and #A4 (fragment #A1: 177-239; 869-926 nt, fragment #A2: 927-1008 nt, fragment #A3: 1-41; 1009-1066 nt, fragment #A4: 42-176 nt) ( Figure 6 The same RNA pulldown experiment was performed using probes of FAM99B truncations #A1, #A2, #A3, and #A4. The experimental results showed that FAM99B truncations #A4 bind to DDX21 ( Figure 6 Finally, #A4 was further truncated into #A4-1, #A4-2, #A4-3 and #A4-4 (fragment #A4-1: 42-64 nt, fragment #A4-2: 65-146 nt, fragment #A4-3: 147-176 nt), and RNA pulldown was performed using the probes. The experimental results showed that the truncated form of FAM99B that binds to DDX21 is #A4-2 (in the following content, the truncated form of FAM99B #A4-2 is referred to as FAM99B core )( Figure 6 Middle C).

[0101] ASGPR is a heterologous endocytic receptor that exists only in liver parenchymal cells and can specifically recognize and bind GalNAc. Due to its high efficiency in targeted delivery to the liver, various RNA therapeutics are conjugated with GalNAc for drug development. core The inventors synthesized GalNAc-FAM99B core FAM99B fragment used to verify binding to DDX21 coreThe inventors used GalNAc-FAM99B to study the biological functions of HCC cells. core The results showed that GalNAc-FAM99Bcore could inhibit the proliferation, cloning, migration and invasion of Huh7 cells in vitro. Figure 6 In summary, the FAM99B core sequence that interacts with DDX21 in HCC cells is FAM99B core , FAM99B core GalNAc-FAM99B can inhibit the proliferation, cloning, migration and invasion of liver cancer cells core It has a strong potential to become a drug.

[0102] 2.7GalNAc-FAM99B core Therapeutic effects in vivo

[0103] To further evaluate GalNAc-FAM99B core In order to investigate the therapeutic effect in vivo, the inventors injected Huh7 cells stably expressing GFP-luciferase into the liver of BALB / c nude mice to establish an orthotopic xenograft model of liver cancer. core or GalNAc-NC (n=6 / group), at a dose of 5 mg / kg, once a week for two consecutive weeks ( Figure 7 A in Figure 1). The inventors analyzed weekly imaging data of orthotopic xenografts of liver cancer in nude mice and found that GalNAc-FAM99B core The fluorescent area of ​​the tumor in the treatment group was significantly smaller than that in the control group on the 21st day, and the tumor growth rate was slower ( Figure 7 B and C), H&E staining results show that GalNAc-FAM99B core The treatment group had less liver tumor metastasis than the control group ( Figure 7 D and E), indicating that GalNAc-FAM99B core The treatment group was able to significantly inhibit tumor growth. The results of tumor tissue sectioning and immunohistochemical staining showed that Ki67-positive cells, a cell proliferation marker, were significantly increased in GalNAc-FAM99B core The treatment group significantly reduced ( Figure 7 F), these results further demonstrated that GalNAc-FAM99B core The treatment group was able to significantly inhibit tumor growth and metastasis. core After treatment, Western blot assay was performed to detect the protein level of DDX21 in xenograft tumors, and the results showed that GalNAc-FAM99B coreThe treatment group was significantly lower than the control group ( Figure 7 In summary, GalNAc-FAM99B core GalNAc-FAM99B can significantly inhibit the growth and metastasis of orthotopic liver cancer transplanted tumors. core This provides a new potential strategy for the treatment of HCC.

[0104] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention. Therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the attached claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims are included in the present invention. Any figure mark in the claims should not be regarded as limiting the claims involved.

[0105] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This description method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.

Claims

1. An isolated nucleic acid, characterized in that The nucleotide sequence comprises the nucleotide sequence shown in SEQ ID NO: 2 or a variant sequence obtained by inserting, deleting or replacing one or more bases based on SEQ ID NO:

2.

2. The nucleic acid according to claim 1, wherein the variant sequence has at least 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 2, and has the function of directly binding to DDX21 and promoting the cleavage and degradation of DDX21. 3 . The nucleic acid according to claim 1 , which does not comprise the nucleotide sequence shown in SEQ ID NO:

1. The nucleic acid according to any one of claims 1 to 3, which is DNA or RNA.

5. The nucleic acid according to any one of claims 1 to 4, comprising a modification; preferably, the modification comprises a 2'-OMe modification, a 2'-F modification, a 2'-MOE or a phosphorothioate PS backbone modification.

6. A drug delivery system, characterized in that Comprising the nucleic acid according to any one of claims 1 to 5 and a delivery vector; preferably, the delivery vector is selected from liposomes, lipid nanoparticles (LNP), lipid complexes, lipid polymer complexes (LPP) and N-acetylgalactosamine (GalNAc).

7. The delivery system according to claim 6, characterized in that The nucleic acid is conjugated to GalNAc.

8. A pharmaceutical composition, characterized in that Comprising the nucleic acid of any one of claims 1-5 or the delivery system of any one of claims 6-7.

9. The pharmaceutical composition according to claim 8, further comprising a second therapeutic agent; preferably, the second therapeutic agent is selected from small molecule therapeutic drugs, therapeutic antibodies, CAR-T, TCR-T, chemotherapy drugs and radiotherapy drugs.

10. Use of the nucleic acid according to any one of claims 1 to 5, the delivery system according to any one of claims 6 to 7, or the composition according to any one of claims 8 to 9 in the preparation of a drug for treating liver cancer.

Images