Multiplexed rna modulation platform for primary immune cell engineering

Abstract

The present disclosure provides a universal and multifunctional platform for transcriptome modulation that utilizes RNA-guided RNA targeting activity that binds to a VI-D type CRISPR effector with RNA-guided RNA endonuclease activity that expresses a guide array of a plurality of guide RNAs. The system can be used for quantitative, reversible and large-scale multiplex gene knock-down in primary human T cells, and multiplex inhibition of consumption related genes in T cells. The system can be used for enhancing the anti-tumor activity of dysfunctional CAR T cells.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 63 / 400,578, filed on August 24, 2022, the disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0003] STATEMENT AS TO RIGHTS TO INVENTS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0004] This invention was made with U.S. Government support under Grant No. 1R21CA270609-01 awarded by the National Cancer Institute. The U.S. Government has certain rights in this invention. Background Art

[0005] Adoptive T-cell therapy, including chimeric antigen receptor (CAR) T-cell therapy, has revolutionized the treatment of patients with refractory B-cell and plasma cell malignancies and has demonstrated promising curative potential in other aggressive preclinical cancer models. However, despite these successes, significant barriers to progression remain, including high rates of primary and acquired resistance, and very limited clinical efficacy against solid cancers. 1-5 Recent studies have implicated T cell-intrinsic mechanisms of dysfunction, such as T cell exhaustion and metabolic dysregulation, in these failure models. 1,6-10 .

[0006] The next generation of genetically engineered CAR T cells, resulting from the concurrent development of CRISPR / Cas9-based methods and technologies, offers potential solutions to these challenges and opportunities for the creation of new treatment paradigms. 3,11 For example, Cas9 can be used to introduce convergent, systemic genetic perturbations in primary human T cells, often on a genome-wide scale, to screen for negative regulators of T cell activity in a variety of cancer-related settings. 12-19 Screening hits can then be specifically deleted via Cas9 knockout or base editing strategies to prevent dysfunction or enhance antitumor activity, including T cell expansion and persistence, solid tumor infiltration, cytokine secretion, and cytotoxicity. 12–16,19–24 Alternatively, components of donor-specific proteins such as TRAC (TCR) and B2M (HLA) can be knocked out to generate “off-the-shelf” allogeneic T cells that do not trigger immune rejection or graft-versus-host disease. 3，11，25–28 .

[0007] Although the intersection of CRISPR engineering and adoptive T cell therapy holds great promise for the future of cancer treatment, Cas9-based systems are limited in their safety and efficacy, as well as in their potential for broader application. Both Cas9 nucleases and base editors introduce binary and irreversible changes to the T cell genome. 29,30 These approaches completely eliminate gene function, which may adversely affect T cell fitness and activity. 21,31-35 , and prevents such perturbations from being dynamically regulated. Furthermore, Cas9 nucleases are incompatible with safe and efficient large-scale multiplexing of gene knockouts—the induction of multiple double-strand breaks (DSBs) may cause chromosomal translocations / truncations. 27,36,37 p53-related genotoxicity 11,38 Although Cas9 base editors mitigate the risks associated with DSBs by cleaving genomic DNA, the trade-off between on-target editing efficiency and extensive off-target editing due to promiscuous deaminase activity limits large-scale multiplexing. 3 , 27,39-41 In summary, Cas9-based tools are completely incapable of safely and efficiently interfering with complex multigenic programs (such as those driving T-cell metabolism, signaling, and exhaustion), which may be necessary for engineering optimized next-generation adoptive T-cell therapies.

[0008] To overcome the limitations of current cutting-edge gene editing technologies in primary human T cells, the present disclosure provides MEGA (Multiplexed Effector Guide Arrays), a versatile platform for transcriptome regulation using CRISPR / Cas13d. Cas13d is a recently described compact class 2 type VI-D CRISPR effector with RNA-guided RNA endonuclease activity. 42,43 Unlike Cas9, Cas13d does not bind, target, or cleave DNA 42 Instead, it complexes with CRISPR-associated RNA (crRNA), which contains a programmable ~23nt spacer that guides the ribonucleoprotein to sequence-specific RNA transcripts for targeted degradation without PAM restrictions. In addition, Cas13d has the unique ability to process poly-crRNA guide arrays into individual crRNAs to facilitate efficient simultaneous targeting of multiple RNA transcripts in a single cell. 42，44 Finally, Cas13d is about two-thirds the size of wild-type Cas9 (fusion Cas9 variants are even larger), making it well suited for T-cell production.

[0009] The present disclosure describes compositions and methods for large-scale multiplexing, quantitative and reversible perturbation of cellular transcriptomes. To address established unmet needs, the present disclosure describes the deployment of MEGA across a wide range of applications, ranging from modulation of CAR signaling to enhancement of anti-tumor activity in dysfunctional high-affinity GD2-targeted (HA-28z) CAR T cells, a well-characterized in vitro model that recapitulates key molecular, phenotypic and functional features of T cell depletion 7,45-47 The present disclosure also describes the use of MEGA to target different sets of genes involved in metabolic reprogramming and disrupt entire metabolic pathways to alleviate adenosine-mediated CAR T cell immunosuppression. Summary of the invention

[0010] The present disclosure provides a composition comprising a genetically modified T cell, wherein the genetically modified T cell expresses (i) a Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity; and (ii) a guide array comprising multiple CRISPR-associated RNA (crRNA) molecules, and provides a system for multiplexed transcriptomic regulation, comprising a Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity, a fusion protein of a destabilization domain (DD), a nucleic acid (e.g., a plasmid and a vector) encoding a Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity of the present disclosure, a guide array, a CAR and / or a fusion protein, and a guide array comprising a nucleic acid (polynucleotide) containing a direct repeat sequence and a spacer sequence. The present disclosure also provides methods for generating modified T cells expressing the Class 2 Type VI-D CRISPR effectors and guide arrays of the present disclosure, methods for regulating gene expression of T cells, methods for screening to identify regulatory factors of T cell activity, methods for increasing T cell proliferation, methods for treating cancer or tumors in a subject or patient in need of treatment, and methods for increasing the anti-tumor activity of T cells.

[0011] In one aspect, the present disclosure provides a genetically modified T cell comprising:

[0012] (i) a Class 2, Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity; and

[0013] (ii) A guide array comprising a plurality of CRISPR-associated RNA (crRNA) molecules, wherein the crRNA molecules independently comprise a direct repeat sequence and a spacer sequence that binds to a target RNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA.

[0014] In some embodiments, the genetically modified T cell comprises a nucleic acid encoding (i), a nucleic acid encoding (ii), or a nucleic acid encoding both (i) and (ii), wherein the nucleic acid encoding (i) or (ii) or both (i) and (ii) is stably integrated into the genome of the T cell.

[0015] In some embodiments, a Class 2, Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity comprises a fusion protein containing a destabilization domain (DD).

[0016] In some embodiments, the Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof.

[0017] In some embodiments, the guide array is a polycistronic array comprising multiple crRNA molecules. In some embodiments, the guide array comprises 2 to 10 crRNA molecules. In some embodiments, the guide array comprises greater than 10 crRNA molecules.

[0018] In some embodiments, the guide array comprises a crRNA molecule bound to an mRNA encoding a T cell depletion-related protein. In some embodiments, the T cell depletion-related protein is selected from TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1, ​​CD46, B2M, and a combination thereof.

[0019] In some embodiments, the T cell or primary T cell further comprises a chimeric antigen receptor (CAR). In some embodiments, the CAR binds to an antigen expressed by the tumor. In some embodiments, the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD30, EGFR, EGFRvIII, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, FAB, WT-1, PSMA, AFP, BCMA, mesothelin, GPC3, MUC1, and CTAG1B.

[0020] In some embodiments, the intracellular signaling of CAR upregulates T cell depletion markers in control T cells. In some embodiments, the control T cells do not include (i) 2 types of VI-D type CRISPR effectors with RNA-guided RNA endonuclease activity; and (ii) a guide array comprising multiple CRISPR-related RNA (crRNA) molecules, wherein the crRNA molecules independently include forward repeat sequences and spacer sequences binding to target RNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA.

[0021] In some embodiments, the depletion marker is selected from LAG3, PDCD1 (PD-1), HAVCR2 (TIM3), CTLA4, and ENTPD1, ​​and combinations thereof.

[0022] In some embodiments, the guide array comprises crRNA molecules bound to mRNA encoding LAG3, PDCD1 (PD-1), HAVCR2 (TIM3), CTLA4 and ENTPD1 or a combination thereof. In some embodiments, the guide array comprises crRNA molecules bound to mRNA expressed by CAR.

[0023] In some embodiments, the T cell is selected from a human T cell and a primary human T cell.

[0024] On the other hand, the present disclosure provides nucleic acids encoding (i) 2 types of VI-D CRISPR effectors with RNA-guided RNA endonuclease activity; and (ii) guide arrays comprising multiple CRISPR-related RNA (crRNA) molecules, wherein the crRNA molecules independently comprise forward repeat sequences and spacer sequences that bind to target RNAs, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA. In some embodiments, the 2 types of VI-D CRISPR effectors with RNA-guided RNA endonuclease activity are Cas13 nucleases, which are selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof. In some embodiments, the guide array is a polycistronic array comprising multiple crRNA molecules. In some embodiments, the guide array comprises 2 to greater than or equal to 10 crRNA molecules. In some embodiments, the guide array comprises crRNA molecules bound to mRNA encoding proteins associated with T cell consumption. In some embodiments, the T cell depletion-associated protein is selected from TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1, ​​CD46, B2M, and combinations thereof.

[0025] In another aspect, the present disclosure provides a system for multiplexed transcriptomic modulation, comprising: (i) an expression cassette comprising a nucleic acid sequence encoding a Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity; and (ii) an expression cassette comprising a nucleic acid sequence encoding a guide array comprising a plurality of crRNA molecules, wherein the crRNA molecules comprise a direct repeat sequence and a spacer sequence that binds to a target mRNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA.

[0026] In some embodiments, the system further comprises (iii) T cells or primary T cells.

[0027] In another aspect, the present disclosure provides a method for producing modified T cells, the method comprising: (i) transducing T cells with an expression vector comprising a nucleic acid sequence encoding a class 2, type VI-D CRISPR effector having RNA-guided RNA endonuclease activity; and (ii) transducing T cells with an expression vector comprising a nucleic acid sequence encoding a guide array, the guide array comprising a plurality of CRISPR-associated RNA (crRNA) molecules, wherein the crRNA molecules independently comprise a direct repeat sequence and a spacer sequence that binds to a target mRNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA, thereby producing modified T cells.

[0028] In some embodiments, the method further comprises (iii) transducing the T cells with an expression vector comprising a nucleic acid sequence encoding the CAR.

[0029] In some embodiments of the method, step (i) is performed before step (ii); step (iii) is performed before step (ii), or steps (i) and (iii) are performed before step (ii).

[0030] In some embodiments, one or more expression vectors of steps (i), (ii) and / or (iii) are stably integrated into the genome of the T cell.

[0031] In some embodiments of the method, expression and intracellular signaling of the CAR upregulates T cell depletion markers in control T cells that do not comprise the expression vector of steps (i) and (ii).

[0032] In another aspect, the present disclosure provides a fusion protein comprising a Class 2, Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity covalently linked to a destabilization domain (DD) polypeptide.

[0033] In some embodiments, the Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof.

[0034] In some embodiments, the DD comprises an E. coli dihydrofolate reductase DD linked to the C-terminus of a Class 2, Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity.

[0035] In some embodiments, the present disclosure provides nucleic acids encoding the fusion proteins described herein.

[0036] In another aspect, the present disclosure provides a method for regulating gene expression in T cells, the method comprising:

[0037] (a) transducing a T cell with: (i) an expression vector comprising a nucleic acid sequence encoding a fusion protein described herein; and (ii) an expression vector comprising a nucleic acid sequence encoding a guide array comprising a crRNA molecule, wherein the crRNA molecule comprises a direct repeat sequence and a spacer sequence that binds to a target mRNA expressed by a target gene, and

[0038] (b) contacting the T cell with a compound that binds to and stabilizes the DD, wherein expression of the target gene is reduced in the presence of the compound compared to expression of the target gene in the absence of the compound, thereby modulating gene expression in the T cell.

[0039] In some embodiments, the fusion protein is degraded in T cells in the absence of the compound.

[0040] In some embodiments, expression of the target gene increases upon removal of the compound, thereby reversibly regulating expression of the target gene.

[0041] In some embodiments, the guide array comprises multiple crRNA molecules that bind to different target mRNAs or different regions of the same target mRNA.

[0042] In some embodiments, the expression of the target gene is modulated by the compound in a dose-dependent manner. In some embodiments, the compound is trimethoprim (TMP).

[0043] In another aspect, the present disclosure provides a method for screening to identify regulators of T cell activity, the method comprising expressing in a T cell or a population of T cells: (i) a Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity; and (ii) a library of guide arrays, wherein individual guide arrays comprise one or more CRISPR-associated RNA (crRNA) molecules, wherein the crRNA molecules comprise a direct repeat sequence and a spacer sequence that binds to a target RNA, and wherein the one or more crRNA molecules bind to different target mRNAs or different regions of the same target mRNA; culturing the T cells to produce a clonal population of expanded T cells; and determining whether the guide array is enriched or depleted in the clonal population of expanded T cells, wherein if the guide array is enriched, the target mRNA encodes a negative regulator of T cell activity, or if the guide array is depleted, the target mRNA encodes a positive regulator of T cell activity.

[0044] In some embodiments, the T cell activity is T cell proliferation, increased cytokine secretion, or increased tumor cell killing.

[0045] In some embodiments, T cells comprising the enriched guide array have an effector memory phenotype and T cells comprising the depleted guide array have a central memory or stem cell memory phenotype.

[0046] In some embodiments of the method, a separate guide array comprises a crRNA molecule bound to an mRNA encoding a T cell depletion-related protein. In some embodiments, the T cell depletion-related protein is selected from TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1, ​​CD46, B2M, and combinations thereof.

[0047] In some embodiments, the library of guide arrays comprises one or more separate guide arrays comprising a polycistronic array containing multiple crRNA molecules. In some embodiments, a separate guide array comprises 2 to 10 crRNA molecules. In some embodiments, a separate guide array comprises a pair of crRNA molecules.

[0048] In some embodiments, determining whether the guide array is enriched or depleted in the clonal population of expanded T cells comprises sequencing the guide RNA present in the T cells.

[0049] In another aspect, the present disclosure provides a method for increasing proliferation of T cells, the method comprising transducing the T cells with:

[0050] (i) an expression vector comprising a nucleic acid sequence encoding a Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity; and

[0051] (ii) an expression vector comprising a nucleic acid sequence encoding a guide array comprising one or more crRNA molecules, wherein the crRNA molecules independently comprise a direct repeat sequence and a spacer sequence that binds to a target mRNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA,

[0052] wherein proliferation of the T cells is increased compared to a control T cell expressing a non-targeting control guide array comprising one or more crRNA molecules that do not bind to the target mRNA in (ii).

[0053] In some embodiments, the method further comprises (iii) transducing the T cells with an expression vector comprising a nucleic acid sequence encoding the CAR.

[0054] In another aspect, the present disclosure provides a method for treating a tumor in a subject, the method comprising: administering the genetically modified T cells of the present disclosure to the subject, wherein the modified T cells kill tumor cells in the subject, thereby treating the tumor.

[0055] On the other hand, the present disclosure provides a method for increasing the anti-tumor activity of T cells, the method comprising contacting tumor cells with genetically modified T cells of the present disclosure, wherein contacting tumor cells with genetically modified T cells increases the expression of anti-tumor cytokines or kills tumor cells, thereby increasing the anti-tumor activity compared to control T cells. In some embodiments, the control T cells do not contain the expression vectors of (i) or (ii) or both (i) and (ii) above.

[0056] In some embodiments, the method is an in vitro method. In some embodiments, the method is an in vivo method.

[0057] In another aspect, the present disclosure provides a guide array comprising a plurality of CRISPR-associated RNA (crRNA) molecules, wherein the crRNA molecules comprise a direct repeat sequence and a spacer sequence that binds a target RNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA.

[0058] In any embodiments of the present disclosure, the Class 2 Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e and functional variants thereof.

[0059] In any of the embodiments of the present disclosure, the guide array is a polycistronic array comprising a plurality of crRNA molecules.

[0060] In any of the embodiments of the present disclosure, the guide array comprises 2 to greater than or equal to 10 crRNA molecules.

[0061] In any embodiments of the present disclosure, the guide array comprises crRNA molecules bound to mRNA encoding proteins selected from the group consisting of TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1, ​​CD46, B2M, and combinations thereof.

[0062] In any embodiments of the present disclosure, the T cell or primary T cell further comprises a chimeric antigen receptor (CAR).

[0063] In any of the embodiments of the present disclosure, the CAR binds to an antigen expressed by the tumor.

[0064] In any embodiment of the present disclosure, the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD30, EGFR, EGFRvIII, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, FAB, WT-1, PSMA, AFP, BCMA, mesothelin, GPC3, MUC1, and CTAG1B.

[0065] In any embodiments of the present disclosure, expression of CAR and intracellular signaling upregulates markers of T cell exhaustion in control T cells compared to T cells comprising: (i) an expression cassette comprising a nucleic acid sequence encoding a class 2, type VI-D CRISPR effector with RNA-guided RNA endonuclease activity; and (ii) an expression cassette comprising a nucleic acid sequence encoding a guide array comprising a plurality of crRNA molecules, wherein the crRNA molecules comprise a direct repeat sequence and a spacer sequence that binds to a target mRNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA.

[0066] In any embodiment of the present disclosure, the depletion marker is selected from LAG3, PDCD1 (PD-1) or HAVCR2 (TIM3) or a combination thereof.

[0067] In any embodiments of the present disclosure, the guide array comprises crRNA molecules bound to mRNA encoding LAG3, PDCD1 (PD-1) or HAVCR2 (TIM3) or a combination thereof.

[0068] In any of the embodiments of the present disclosure, the guide array comprises crRNA molecules that bind to the mRNA expressed by the CAR.

[0069] In any of the embodiments of the present disclosure, the T cells are selected from human T cells and primary human T cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1.MEGA HA-28z CAR T cells robustly suppress depletion-associated inhibitory receptor upregulation. (A) Schematic diagram of the relevant lentiviral constructs in MEGACAR T cells. CRISPR / Cas13d enables multiplexed RNA targeting by a single guide array to effectively suppress inhibitory receptor upregulation. DR: forward repeat sequence. (B) Overview of the optimized workflow for generating MEGA CART cells from primary human T cells for phenotypic evaluation. FACS: fluorescence-activated cell sorting. (C) Violin plots and box plots depicting surface LAG3, PD-1, and TIM3 expression of single and dual guides, as measured by flow cytometry from 1 representative donor on day 10. On-target guides are colored (LAG3, yellow; PD-1, red; TIM3, blue); off-target guides are gray. The dotted lines represent the median fluorescence intensity (MFI) values ​​of simulated untransduced cells or depleted non-targeted cells for normalization. Marked numbers represent normalized values ​​for each condition (simulated MFI = 0; non-targeted MFI = 1). NT: non-targeted guide. (D) Aggregation normalized surface LAG3 (L), PD-1 (P), and TIM3 (T) expression, as described in (C) for single and double guides on n = 2-3 donors from independent experiments. The dotted line represents the non-targeted MFI. *p < 0.05, **p < 0.005, ***p < 0.0005, ****p < 0.0001, ordinary one-way ANOVA with Dunnett's multiple comparison test. Error bars are ± sd. (E) Correlation plot between mRNA transcript expression (as measured by RT-qPCR) and normalized surface LAG3, PD-1, and TIM3 expression of single and double guides from 1 representative donor relative to NT. On-target guides are pink; off-target guides are black. The colored line represents the best fit of the linear regression. Error bars are sem. (F) Volcano plot representing the main RNA-Seq data from MEGA CAR T cells on day 10, n = 2 donors from independent experiments. Genes significantly differentially expressed compared to NT are highlighted (log2fc <-1, padj <0.001). (G) Polymerized normalized surface LAG3, PD-1, and TIM3 expression on triple-guided arrays for n = 2-3 donors from independent experiments. The dotted line represents non-targeted MFI. ***p < 0.0005, ****p < 0.0001, ordinary single-factor ANOVA with Dunnett's multiple comparison test. Error bars are ± sd. (H) Correlation diagram between mRNA transcript expression and normalized surface LAG3, PD-1, and TIM3 expression from triple-guided arrays of 1 representative donor relative to NT. The colored line represents the best fit of the linear regression. The error bar is sem.(I) Pie chart depicting the relative percentage of LAG3+ / -PD-1+ / -TIM3+ / -MEGA CAR T cells for the triple-guided array, as measured by flow cytometry from 1 representative donor on day 10. Triple-positive cells are highlighted in yellow; triple-negative cells are highlighted in blue.

[0071] Figure 2 .Combinatorial CRISPR screening in dysfunctional CAR T cells identified paired proliferation regulators. (A) Overview of the 2D CRISPR screening strategy in dysfunctional CD8+HA-28z CAR T cells. (B) Volcano plot depicting the differential abundance (log2 fold change, l2fc) of guide arrays between early (plasmid DNA) and late (day 13) time points for n=2 replicates. Blue dots: significantly depleted arrays (adjusted p<0.05, l2fc<-0.5); red dots: significantly enriched arrays (adjusted p<0.05, 12fc>0.5); hollow black dots: non-targeted arrays. p values ​​were adjusted from the Wald test using the Benjamini-Hochberg correction as implemented in DESeq2. (C) 2D heat map of guide array enrichment between early and late time points. Top left: targeted dual array; top right and bottom left: targeted single array; bottom right: non-targeted array. (D) Guide arrays ranked using a likelihood ratio test as implemented in DESeq2 with n = 2 replicates. The highest ranked arrays with the most significant count changes across all screening time points are colored (blue: depletion; red: enrichment). (E) Top: Histogram depicting the distribution of l2fcs between early and late time points for all 6,400 guide arrays in the library. Bottom: Rug plot of 12fcs for all 9 guide arrays targeting significantly enriched (red) or depleted (blue) gene pairs relative to the l2fc distribution of all 64 non-targeting guides (gray). (F) Fold change amplification of FACS-sorted RfxCas13d+CD8+HA-28z CAR T cells compared to non-targeting controls after 15 days of culture from n = 3-4 donors from independent experiments. Significantly enriched guide arrays are red; significantly depleted guide arrays are blue; non-targeting control guides are black. The dotted line represents the amplification of the non-targeting control. p<0.0001, ordinary one-way ANOVA. Error bars are ± sem.

[0072] Figure 3. Paired transcriptomic perturbations broadly enhance the antitumor activity of dysfunctional MEGA CAR T cells. (A) Overview of the experimental workflow for generating dysfunctional MEGA CAR T cells expressing validation arrays. (B) Schematic detailing the experimental conditions used for cytokine secretion assays. (C, D) Secretion of IFNγ (C) or IL-2 (D) after 24 h of culture with (pink dots, stimulated) or without (black dots, baseline) antigen-positive tumor cells at 1:1 E:T. Data are the mean of n = 3 replicate wells from 1 representative donor. *p<0.05, **p<0.005, ***p<0.0005, ****p<0.0001, ordinary one-way ANOVA with Dunnett's multiple comparison test. Error bars are ± sd. (E) Top: Schematic detailing the continuous stimulation assay. MEGACAR T cells were repeatedly challenged with antigen-positive tumor cells every 48-72 h at 1:1 E:T. Bottom: Kinetics of tumor killing (1:1 E:T) as measured using Incucyte live cell imaging. Data are the average of n=3 replicate wells from 1 representative donor. Red trace: enriched guide array; black trace: non-targeted control. p<0.0001, repeated measures one-way ANOVA. Shaded areas are ±sem. (F) As Figure 5 (G) Incucyte live cell imaging at a lower E:T of 1:5 in E. Figure 3 Incucyte images at 0 and 48 h time points after three rounds of tumor stimulation in E. Green: Nalm6-GD2 tumor cells; Red: MEGA HA-28z CAR T cells. (H) Schematic illustration of the putative mechanism of enhanced anti-tumor activity in dual CBLB+FAS knockdown CAR T cells (bottom) compared to non-targeting controls (top).

[0073] Figure 4.MEGA enables rapid, quantitative, and reversible control of the T cell transcriptome. (A) Schematic detailing exogenous regulation of RfxCas13d-DD expression by the small molecule drug trimethoprim (TMP). (B) Overlay of violin and box plots depicting surface CD46 expression, as measured by flow cytometry from 1 representative donor on day 5. On-target conditions are shown in purple; off-target conditions are shown in gray. The numbers on the graph represent paired fold changes in CD46 expression. (C) Left: Overlay of violin and box plots depicting TMP-dependent surface CD46 expression, as measured by flow cytometry from 1 representative donor on day 5. Right: Dose-response curve depicting TMP-dependent CD46 knockdown titration, as measured by flow cytometry on day 5. Data are the averages of n=3 replicate wells from 1 representative donor. The linear regime of the sigmoid curve is shown in pink. Error bars are ± sd. (D) Depicts the time course of the kinetics of CD46 knockdown after TMP addition (left, yellow) or removal (right, dark blue), as measured by flow cytometry over 72 hours. Data are the averages of n=3 replicate wells from 1 representative donor. Error bars are ± sd. (E) Violin and box plot overlays depicting surface LAG3, PD-1, and TIM3 expression with or without TMP, as measured by flow cytometry from 1 representative donor on day 10. Colored histograms: on-target conditions; gray histograms: off-target conditions. Dashed lines represent the MFI values ​​of simulated untransduced cells or depleted non-targeted cells for normalization. The labeled numbers represent the normalized values ​​for each condition. (F) Violin and box plot overlays depicting surface LAG3, PD-1, and TIM3 expression relative to increasing TMP concentrations, as measured by flow cytometry from 1 representative donor on day 10. (G) Dose-response curves depicting TMP-dependent LAG3 (yellow), PD-1 (red), or TIM3 (blue) knockdown titrations as measured by flow cytometry at day 10. Data are the mean of n=3 replicate wells from 1 representative donor. Error bars are ± sd.

[0074] Figure 5.MEGA achieves large-scale multiplexed knockdown of immune-related endogenous genes in primary human T cells. (A) Overview of an optimized two-step method for quickly and easily assembling guide arrays of arbitrary length via overlapping amplification PCR. (B) mRNA transcript levels of LAG3, FAS, CTLA4, PD-1, and TIM3 relative to NT, as measured by RT-qPCR from n=2 donors on day 10. The numbers marked within the bars represent the mean. ****p<0.0001, Welch's t-test. Error bars are ± sd. (C) Violin and box plots depicting surface LAG3, FAS, CTLA4, PD-1, and TIM3 expression are overlaid, as measured by flow cytometry from 1 representative donor on day 10. The target guide array is colored (LAG3, yellow; FAS, green; CTLA4, dark blue; PD-1, red; TIM3, light blue); the control is gray. The dotted line represents the MFI value of the mock or non-targeted cells. (D) Polymeric surface LAG3, FAS, CTLA4, PD-1, and TIM3 expression on n=3 donors from independent experiments relative to NT. Dashed lines represent the MFI of mock or non-targeted cells. **p<0.005, ***p<0.0005, ordinary one-way ANOVA with Dunnett's multiple comparison test. Error bars are ± sd. (E) mRNA transcript levels of LAG3, FAS, CD5, CD39, CD46, TRAC, B2M, CTLA4, PD-1, and TIM3 relative to NT, as measured by RT-qPCR from n=2 donors on day 10. The numbers marked within the bars represent the mean. *p<0.05, **p<0.005, ***p<0.0005, ****p<0.0001, Welch's t-test. Error bars are ± sd.

[0075] Figure 6Metabolic engineering promotes CAR T cell function via full-pathway disruption of the purinergic signaling cascade. (A) Schematic diagram detailing pathways associated with purinergic signaling and adenosine-mediated immunosuppression. (B) Schematic diagram detailing the expected effects of purinergic signaling disruption on metabolite levels and immune activity. (C) mRNA transcript levels of purinergic signaling components A2BR, A2AR, CD73, and CD39 relative to NT, as measured by RT-qPCR at day 10, n = 3 technical replicates from 1 representative donor. Numbers marked within the bar represent mean values. ****p < 0.0001, Welch's t-test. Error bars are ± sd. (D, E, F) Concentrations of metabolites ATP (D), AMP (E), and adenosine (F) in the culture medium of MEGA HA-28z CAR T cells expressing PURI arrays (green) or non-targeted guides (grey). Data are averages of n = 2-3 replicate wells from 1 representative donor. *p<0.05, **p<0.005, unpaired t-test. Error bars are ± sd. (G, H) Depict the time course of the concentration of metabolites ATP (G) and AMP (H) in the culture medium of MEGA HA-28z CAR T cells after spiking with 20 μM ATP. Green trace: PURI array; gray trace: non-targeted control. Data are the average of n = 3 replicate wells from 1 representative donor. **p<0.005, ****p<0.0001, two-way repeated measures ANOVA, column factor. Error bars are ± sd. (I, J) Secretion of IFNγ (I) or IL-2 (J) by dysfunctional MEGA CAR T cells after 24 hours of culture with (stimulated) or without (baseline) antigen-positive tumor cells at 1:1E:T. Data are the average of n = 3 replicate wells from 1 representative donor. Green bar: PURI array; gray bar: NT control. ****p<0.0001, two-way ANOVA with Bonferroni multiple comparison test. Error bars are ±sd. (K, L) Kinetics of tumor killing (K) and T cell proliferation (L) as measured using Incucyte live cell imaging at a 1:1:E:T ratio. Data are the mean of n=3 replicate wells from 1 representative donor. Green trace: PURI array; gray trace: NT control. **p<0.005, two-way repeated measures ANOVA, column factor. Shaded areas are ±sem.

[0076] Figure 7 MEGA is a flexible and versatile platform for transcriptomic regulation in primary human T cells using CRISPR / Cas13d.

[0077] Figure 8 ,and Figure 1 Related. Characterization and optimization of RfxCas13d expression and activity in primary human T cells. (A) Overview of lentiviral constructs and experimental settings for GFP reporter inhibition experiments. (B) GFP expression, as measured by flow cytometry on day 5 with increasing amounts of GFP virus. Green line: cells transduced with RfxCas13d: GFP and GFP reporter; dotted black line: cells transduced with GFP reporter only. Data are averages of n=3 replicate wells from 1 representative donor. (C) Overview of lentiviral constructs for inhibiting depletion markers in HA-28z CAR T cells. (D) Expression of LAG3, PD-1, and TIM3 relative to NT, as measured by flow cytometry on n=3 donors from independent experiments on day 10. Colored bars: on-target guides (LAG3, yellow; PD-1, red; TIM3, blue); gray bars: off-target guides. (E) Histograms depicting the expression of RfxCas13d, as measured by flow cytometry from 1 representative donor at day 10. Black unfilled histogram: simulated untransduced cells; magenta filled histogram: cells transduced with RfxCas13d. (F) Overlay of violin plots and box plots depicting the expression of RfxCas13d, as measured by flow cytometry from 1 representative donor at day 5. Black unfilled histogram: simulated untransduced cells; magenta filled histogram: cells transduced with RfxCas13d constructs of different configurations. (G) Model describing the context-dependent effect of RfxCas13d activity in LX293T cells on lentiviral titers during viral packaging. (H, I) Violin plots depicting (H) RfxCas13d and (I) HA-28z CAR expression by co-transduced primary human T cells, as measured by flow cytometry at day 5 with increasing viral load.

[0078] Fig. 9 ,and Figure 1 Multiplexed inhibition of depletion markers in MEGA HA-28z CAR T cells. (A) mRNA transcript expression of LAG3, PD-1, and TIM3 for single and dual guides, as measured by RT-qPCR at day 10 (see Figure 1E). Data are means of n = 3 technical replicates from 1 representative donor. Error bars are ± sd. M: mock; N: non-targeted; L: LAG3; P: PD-1; T: TIM3. (B) Violin plot and box plot overlay depicting HA-28z CAR expression of single and dual guides at day 5, as measured by flow cytometry from 1 representative donor. Blue histogram: transduced cells; gray histogram: mock untransduced cells. (C) Violin plot and box plot overlay depicting surface LAG3, PD-1, and TIM3 expression of triple guides, as measured by flow cytometry from 1 representative donor at day 10 (see Figure 1 F). On-target guides are colored (LAG3, yellow; PD-1, red; TIM3, blue); controls are gray. Dashed lines represent the MFI values ​​of mock untransduced cells or depleted non-targeted cells used for normalization. Labeled numbers represent the normalized values ​​for each condition. (D) mRNA transcript expression of LAG3, PD-1, and TIM3 for the triple guide, as measured by RT-qPCR at day 10 (see Figure 1 H). Data are means of n=3 technical replicates from 1 representative donor. Error bars are ± sd. (E) Violin and box plot overlay depicting HA-28z CAR expression of triple guides at day 5, as measured by flow cytometry from 1 representative donor. Blue histogram: transduced cells; gray histogram: mock untransduced cells. (F, G) Figure 1 Gating strategy used in I to identify the LAG3+ / -PD-1+ / -TIM3+ / - population in unsorted MEGA HA-28zCAR T cells expressing (F) non-targeting control or (G) triple-guided array. Data were measured by flow cytometry from 1 representative donor on day 10. From left to right: live cell (lymphocyte) gate, single cell gate, RfxCas13d+ gate, LAG3+ / -PD-1+ / - gate, TIM3+ / - gate.

[0079] Fig.10 ,and Figure 2Related. Further characterization of Cas13-based CRISPR screening in HA-28z CAR T cells. (A) A graph representing the distribution of guide arrays in plasmid DNA preparations of assembled custom libraries, as determined by NGS. Guide array counts are sorted in order of abundance. Dashed lines represent the 90th and 10th percentiles. The numbers marked in blue represent general indicators for quantifying library coverage and bias. (B) Histograms depicting the expression of RfxCas13d (left) and HA-28zCAR (right) over the duration of the screen. Colored histograms: screened cells (RfxCas13d: magenta; CAR: blue); unfilled histograms: simulated untransduced cells. (C) A graph representing the distribution of guide arrays on two replicates over the duration of the screen. (D) A graph depicting the correlation of guide array abundance between two replicates. Left: early time point; right: late time point. (E) Volcano plot depicting the mean differential abundance of gene pairs between early (plasmid DNA) and late (day 13) time points for n = 2 replicates. Blue dots: significantly depleted pairs; red dots: significantly enriched pairs; open black dots: non-targeted controls. p-values ​​are from robust ranking aggregation, as implemented in MAGeCK. (F) 2D heatmap of gene pair enrichment between early and late time points. Genes were ranked by hierarchical clustering, as implemented in pheatmap.

[0080] Fig.11 ,and Figure 2 Related. Validation and phenotypic analysis of 2D CRISPR screening hits. (A) Violin plot and box plot overlay depicting HA-28z CAR expression (top) and RfxCas13d expression (bottom) of the validation array at day 5 (before FACS), as measured by flow cytometry from 1 representative donor. The dotted line represents the gate of RfxCas13d+ cells. Red histogram: enriched array; blue histogram: depleted array; gray histogram: control. (B) Aggregate % RfxCas13d+ on n=3 donors from independent experiments as detailed in (A). Red bars: enriched array; blue bars: depleted array; gray bars: non-targeted. **p<0.005, ****p<0.0001, ordinary one-way ANOVA with Dunnett's multiple comparison test. Error bars are ± sd. (C) Expansion trace of FACS-sorted RfxCas13d+CD8+HA-28z CAR T cells over 15 days of culture (see Figure 2F). Each graph corresponds to a new donor from an independent experiment. Red line: enriched array; blue line: depleted array; black line: non-targeted; shaded gray area: AUC of non-targeted control. (D) Fold change amplification of FACS-sorted RfxCas13d+HA-28z CAR T cells compared to non-targeted controls cultured for 15 days from n=3-4 donors from independent experiments. Significantly enriched guide arrays are in red; significantly depleted guide arrays are in blue; non-targeted control guides are in black. The dotted line represents the amplification of the non-targeted control. p<0.0001, ordinary one-way ANOVA. Error bars are ±sem. (E) Proliferation traces of FACS-sorted RfxCas13d+HA-28z CAR T cells over 15 days in culture on n=4 donors from independent experiments (each Figure 1 Bars). Red line: enriched array; blue line: depleted array; black line: non-targeted; shaded grey area: AUC of non-targeted control. (F, G) Density plots depicting the levels of CD62L and CD45RA on HA-28z CAR T cells expressing non-targeted (F) or targeted (G) guided arrays, as measured by flow cytometry from 1 representative donor on day 10. The numbers marked in each quadrant represent the relative frequency of the indicated T cell subset (pink: maximum global frequency).

[0081] Fig.12 ,and Figure 3 Evaluation of the antitumor activity of dysfunctional MEGA CAR T cells. (A, B) Secretion of IFNγ (A) or IL-2 (B) by dysfunctional MEGA CAR T cells after culturing with (pink dots, stimulated) or without (black dots, baseline) antigen-positive tumor cells at 1:1 E:T for 24 h, as shown in Figure 2 Figure 3 B to Figure 3 C. Data are the mean of n=3 replicate wells. Each graph corresponds to a new donor from an independent experiment. *p<0.05, **p<0.005, ***p<0.0005, ****p<0.0001, ordinary one-way ANOVA with Dunnett's multiple comparison test. Error bars are ± sd. (C) Tumor killing kinetics (1:1E:T), as measured using Incucyte live cell imaging, as Figure 3 D. Data are the mean of n=3 replicate wells. Each row corresponds to a new donor from an independent experiment. Red trace: enriched guide array; blue trace: depleted guide array; black trace: non-targeted control. p<0.0001, one-way repeated measures ANOVA with Dunnett's multiple comparison test. Shaded areas are ± sem.

[0082] Fig.13 ,and Figure 4 Related. Regulation of RfxCas13d activity by small molecule drugs. (A) Density plot representing the expression of RfxCas13d and LAG3 / PD-1 / TIM3 in MEGA HA-28z CAR T cells on day 10, as measured by flow cytometry from 1 representative donor. Left column: targeting guide; right column: non-targeting control. (B) Violin plot and box plot overlay depicting intracellular RfxCas13d expression on day 5, as measured by FLAG tag staining and flow cytometry from 1 representative donor. Blue histogram: high expression conditions; gray histogram: low expression conditions. (C) Violin plot and box plot overlay depicting surface CD46, as measured by flow cytometry from 1 representative donor over 72 hours (see Figure 4 D). Top: TMP addition; bottom: TMP removal. Solid filled histograms: TMP addition (yellow) or removal (dark blue); dashed unfilled histograms: non-targeted control. (D) Time course depicting the kinetics of CD46 degradation after CHX addition, as measured by flow cytometry. Data are the average of n=3 replicate wells from 1 representative donor. Error bars are ± sd. (E) Bar graphs depicting CD46 expression (left), mCherry expression (middle), or cell viability (right) with different concentrations of TMP. Colored bars: CD46 targeting guide (CD46 expression: purple; mCherry expression: magenta; cell viability: blue); gray bars: non-targeting guide. Numbers marked on the bars represent fold changes relative to NT. Data are the average of n=3 replicate wells from 1 representative donor. *p<0.05, **p<0.005, ****p<0.0001, multiple unpaired t-test with FDR correction (Benjamini, Krieger and Yekutieli). Error bars are ± sd.

[0083] Fig.14 ,and Figure 5 Knockdown is robust across spacer and target transcript abundance. (A) Relative to NT Figure 5 mRNA transcript levels of all targeted genes in (three spacers per transcript), as measured by RTqPCR at day 10, n = 3 technical replicates from one donor. *p < 0.05, **p < 0.005, ***p < 0.0005, ****p < 0.0001, ordinary one-way ANOVA with Dunnett's multiple comparison test. Error bars are ± sd. (B) Relative transcript expression plotted against transcript abundance, as measured by bulk RNA-Seq of HA-28z CAR T cells. Figure 5 Each gene targeted in the

[0084] Fig.15.Disruption of glycolytic activity driven by PI3K / Akt regulates CAR T cell metabolism and alleviates consumption. (A) Schematic diagram depicting aerobic glycolysis as a metabolic driver of T cell effector differentiation and final consumption. Four gene guide arrays (GLY) interfere with upstream glycolytic genes HK1, HK2, AKT1, and AKT2. (B) mRNA transcript levels of HK1, HK2, AKT1, and AKT2 relative to NT, as measured by RT-qPCR on day 10, from n=3 technical replicates of one donor representing two independent experiments. The numbers marked within the bars represent the mean. **p<0.01, ***p<0.001, ****p<0.0001, ordinary one-way ANOVA with Dunnett's multiple comparison test. Error bars are ± sd. (C) 2D t-distributed random neighbor embedding (t-SNE) visualization of clustered high-dimensional mass cytometry (CyTOF) data from MEGA HA-28z CAR T cells expressing GLY array (n = 9871 cells) or non-targeted (NT) guide (n = 8025 cells) on day 10. Points represent cell clusters with similar protein expression profiles, as determined by unsupervised FlowSOM clustering. Point positions represent cluster centroids. Point size represents the number of cells represented by a cluster. Point color represents the enrichment (log2 fold change count) of cells in each cluster labeled with GLY (dark green) or NT (yellow) after debarcoding. Contour lines represent kernel density estimates in two-dimensional latent space. (D) t-SNE visualization of cell clusters as described in (C), colored according to normalized marker expression (% max). Highly expressed cell clusters are colored dark purple, while lowly expressed cell clusters are colored light orange. (E) Whole transcriptome quantification of bulk RNA-seq data from MEGA HA-28z CAR T cells with targeted GLY array (y-axis) or NT control (x-axis) on day 10, averaged over n=2 donors from independent experiments. Each dot represents a single gene; gene-level expression was determined by aggregating the transcript per million (TPM) value and p-value for each gene over all detected transcripts. Differentially expressed genes with adjusted p-values ​​<0.2 and absolute log2 fold changes >0.5 are highlighted (red: upregulated in GLY; blue: downregulated in GLY). Point size is scaled by statistical significance (-log10 adjusted p-value). The green line indicates that gene expression is equal in both conditions (y=x). (F) Results from gene set enrichment analysis (GSEA), including all Hallmark gene sets as well as previously described NK-like T cell dysfunction gene signatures. The top 5 most significantly enriched gene sets are shown. Genes were ranked according to the following ranking metric = -log10(adjusted p-value)*sign(log2 fold change GLY / NT).The marked genes contribute most to the normalized enrichment score (NES). (G) Extracellular pH measurement of MEGA HA-28z CART cell culture supernatant after 48 hours of culture. Cells were plated in triplicate wells at 1×106 cells / ml. Data represent n=3 donors in independent experiments. ***p<0.001, unpaired t-test. Error bars are ±sd. (H, I) Secretion of IL-2 (H) or IFNγ (I) by dysfunctional MEGA HA-28z CAR T cells after 24 hours of culture with antigen-positive tumor cells at 1:1E:T. Data are the average of n=3 replicate wells from 1 representative donor. Dark green bar: GLY array; yellow bar: NT control. ***p<0.001, unpaired t-test. Error bars are ±sd. (J) Kinetics of tumor killing (1:1E:T) in repeated stimulation assays, as measured using Incucyte live cell imaging. Data are the averages of n = 3 replicate wells from 1 representative donor. Black trace: mock T cells; yellow trace: non-targeted control; dark green trace: GLY array. ****p<0.0001, two-factor repeated measures ANOVA. Shaded areas are ± sem. (K) Schematic diagram outlining the generation of Cas9 gene-edited HA-28z CAR T cells via RNP electroporation. HA-28z CAR T cells were electroporated with a mixture of Cas9 complexed with a control guide targeting the AAVS1 safe harbor locus (AAVS1) or with four guides (4KO) targeting HK1, HK2, AKT1, and AKT2 on day 3 of culture. (L) Editing efficiency of the four-gene knockout (4KO, dark blue bars) compared to the control (AAVS1, cyan bars), as determined by TIDE analysis of PCR amplicons from the indicated genomic loci. n = 2 donors in independent experiments. ****p<0.0001, two-way ANOVA with Bonferroni multiple comparison test. (M) Fold change amplification of HA-28z CAR T cells with HK1, HK2, AKT1, and AKT2 knockdown (left) or knockout (right) on n=3-4 donors from independent experiments within 10 days of culture. Left: GLY array (dark green) vs. NT control (yellow). Right: 4KO (dark blue) vs. AAVS1 control (cyan). ***p<0.001, unpaired t-test. Error bars are ± sd. (N) Tumor killing of HA-28z CAR T cells at different effector: target ratios. Data represent endpoint (t=48 hours) tumor intensity normalized to initial (t=0 hours) tumor intensity. Gray: simulation; dark green: Cas13 GLY array; yellow: Cas13 NT control; dark blue: Cas9 4KO; cyan: Cas9 AAVS1 control.**p<0.01, ****p<0.0001, two-way ANOVA with FDR-corrected multiple comparison test (Benjamini, Krieger, and Yekutieli). (O) Whole transcriptome quantification of the main RNA-seq data of HA-28z CAR T cells edited with Cas9 4KO (y axis) or Cas9AAVS1 control (x axis) on day 10, averaged on n=2 donors from independent experiments. Each point represents a single gene; gene level expression is determined by aggregating the transcript per million (TPM) value and p value of each gene on all detected transcripts. Differentially expressed genes with adjusted p-values ​​<0.2 and absolute log2 fold changes >0.5 are highlighted (red: upregulated in 4KO; blue: downregulated in 4KO). Point size is scaled with statistical significance (-log10 adjusted p-value). The green line indicates that gene expression is equal under both conditions (y=x). (P) Results from gene set enrichment analysis (GSEA), including all Hallmark gene sets and previously described NK-like T cell dysfunction gene signatures. The top 5 most significantly enriched gene sets are shown. Genes are ranked according to the following ranking metric = -log10 (adjusted p-value) * sign (log2 fold change 4KO / AAVS1). The marked genes contribute most to the normalized enrichment score (NES). (Q) An area ratio Euler diagram depicting significantly differentially expressed genes identified from (E) and (O). Upper: downregulated genes; Lower: upregulated genes. The Cas13 gene set (n = 188 downregulated, n = 123 upregulated) represents genes with significant differences between GLY and NT conditions; the Cas9 gene set (n = 87 downregulated, n = 92 upregulated) represents genes with significant differences between 4KO and AAVS1 conditions. (R) GSEA results of Cas13 (GLY vs. NT) mapped for Cas9 GSEA results (4KO vs. AAVS1). Points represent the overall GSEA ranking metric for each gene set = -log10(adjusted p-value)*sign(NES). The gene sets included in (F) and (P) are labeled and colored by category: green points are decreased in Cas13 and Cas9; blue points are decreased only in Cas9; magenta points are increased only in Cas13; orange points are increased only in Cas9.

[0085] Fig.16.RfxCas13d does not show collateral activity in primary human MEGA T cells. (A) Schematic diagram of the experimental workflow for evaluating RfxCas13d RNA levels and protein level collateral activity produced by on-target B2M cleavage in primary human T cells from n=2 donors. (B) A dot plot depicting protein expression levels of mCherry-P2A-RfxCas13d for B2M (on-target), CD46 (off-target) or CD3 (off-target) for MEGA T cells expressing B2M targeting guides (left column) or non-targeting (NT) controls (right column). The data were measured from 1 representative donor on day 10 by flow cytometry. The marked numbers represent the percentage of cells in each quadrant, respectively. (C) Mean fluorescence intensity (MFI) of mCherry in MEGA T cells expressing B2M targeting guides (purple bars) or non-targeting controls (grey bars). The data are the averages of n=2 donors. The error bars are ± sd. p = 0.0596 (ns), paired t-test. (D) Cell viability of MEGAT cells expressing B2M targeting guides (purple bars) or non-targeting controls (gray bars). Data are the averages of n = 2 donors. Error bars are ± sd. p = 0.8949 (ns), paired t-test. (E) Cell counts (total yield) of FACS-sorted MEGA T cells expressing B2M targeting guides (purple bars) or non-targeting controls (gray bars). Data are the averages of n = 2 donors. Error bars are ± sd. p = 0.5410 (ns), paired t-test. (F) Total RNA (total yield) extracted from FACS-sorted MEGA T cells expressing B2M targeting guides (purple bars) or non-targeting controls (gray bars). Data are the averages of n = 2 donors. Error bars are ± sd. p = 0.8820 (ns), paired t-test. (G) Principal component analysis (PCA) of bulk RNA-seq data generated from FACS-sorted MEGA T cells expressing B2M targeting guides (purple dots) or non-targeting controls (grey dots) from n=2 donors (DN). (H) Whole transcriptome quantification of bulk RNA-seq data from MEGA T cells with targeting B2M guides (y-axis) or NT control guides (x-axis) on day 5, averaged over n=2 donors. Each dot represents a single gene; gene-level expression is determined by aggregating transcripts per million (TPM) values ​​and p-values ​​over all detected transcripts for each gene. Differentially expressed genes with adjusted p-values ​​<0.1 and absolute log2 fold changes >1 are highlighted (red: upregulated in B2M; blue: downregulated in B2M). Targeted B2M transcripts are colored purple. Mitochondrial RNAs are colored orange. Point size is scaled by statistical significance (-log10 adjusted p-value).The green line indicates that gene expression is equal in both conditions (y=x).

[0086] Fig.17 .MEGA CAR T cells with disrupted glycolytic metabolism exhibit enhanced anti-tumor efficacy in vivo. (A) Schematic diagram detailing the experimental procedure for in vivo tumor attack of MEGA HA-28z CAR T cells. On day 0, NSG mice were inoculated with 1e6 antigen-positive Nalm6-GD2 (GFP+Luc+). One week later, mice were injected with 1) simulated untransduced T cells, 2) MEGA HA-28z CAR T cells expressing non-targeted control guides, or 3) MEGA HA-28z CAR T cells expressing GLY (HK1 / HK2 / AKT1 / AKT2) arrays. (B) Tumor burden in mice bearing Nalm6-GD2 tumors was quantified by bioluminescence imaging (BLI) on day 12; gray bars: non-targeted control; dark gray bars: GLY array; light gray bars: simulation. Each point represents the tumor BLI measurement of each mouse. Data are the mean of n=5 mice per condition (error bars are ± sem). (C) Tumor burden in mice bearing Nalm6-GD2 tumors was quantified by bioluminescence imaging (BLI) over 12 days. Dark grey trace: MEGA T cells expressing GLY array; grey trace: MEGAHA-28z CAR T cells expressing non-targeting control guide; light grey trace: mock untransduced T cells. n=5 mice per condition.

[0087] Fig.18 .Large-scale multiplexed knockdown of ten genes in MEGA HA-28z CAR T cells extensively and robustly reprograms the transcriptome at the single-cell level. (A) Two-dimensional Uniform Manifold Approximation and Projection (UMAP) visualization of single-cell RNA sequencing data (scRNA-seq) of MEGA HA-28z CAR T cells expressing a ten-gene guide array (SURF2, blue dots, n=113 cells) or a non-targeted control (NT, gray dots, n=307 cells). (B) UMAP visualization of scRNA-seq data colored by normalized gene expression as in (A). Single-cell expression data of the top 12 most significantly enriched genes in SURF2 cells compared to NT are shown. (C) UMAP visualization of scRNA-seq data colored by normalized gene expression as in (A). Single-cell expression data of the top 12 most significantly depleted genes in SURF2 cells compared to NT are shown. DETAILED DESCRIPTION

[0088] introduction

[0089] The present disclosure provides compositions and methods for multiplexed transcriptomic regulation in cells, which provide a general and multifunctional platform for programmable and scalable regulation of cell transcriptomes. The compositions and methods disclosed herein provide advantages over existing CRISPR gene editing techniques, which are limited in terms of their safety, effectiveness and scope. The compositions and methods disclosed herein can be quantitatively, reversibly and massively multiplexed gene knockdowns in cells without targeting or cutting genomic DNA.

[0090] Compositions and methods use a Class 2 CRISPR / Cas system that uses a single RNA-guided protein effector with RNA-guided RNA endonuclease activity. In some embodiments, the Class 2 CRISPR / Cas system includes a Type VI-D CRISPR effector. Unlike Cas9, Type VI-D CRISPR effectors do not bind, target, or cleave DNA 42 In contrast, type VI-D CRISPR effectors are complexed with CRISPR-associated RNA (crRNA) containing a programmable spacer sequence that directs ribonucleoproteins to specific RNA transcripts for targeted degradation.

[0091] Type VI-D CRISPR effector proteins are believed to be guided to their target RNAs by single crRNAs, which contain a forward repeat stem-loop sequence and a spacer sequence (guide RNA) that binds to the target sequence via RNA-RNA hybridization. The forward repeat sequence used depends on the specific 2 types of type VI-D CRISPR effector proteins co-expressed in the cell. For example, the forward repeat sequence in the guide RNA that forms a complex with Cas13d is highly conserved in length and secondary structure.

[0092] Representative non-limiting examples of VI-D type CRISPR effectors disclosed herein include the Cas13 family, which includes Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof. In some embodiments, the VI-D type CRISPR effector is Cas13d. Cas13d has the unique ability to process poly-crRNA guide arrays into different crRNAs to facilitate efficient simultaneous targeting of multiple RNA transcripts in a single cell. 42,44 Finally, Cas13d is about two-thirds the size of wild-type Cas9 (and Cas9 fusion variants are even larger), making it highly suitable for T cell manufacturing.

[0093] General Description

[0094] Unless otherwise indicated, the practice of the present disclosure employs conventional immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA techniques within the skill of the art. See Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd edition (1989), Current Protocols in Molecular Biology (FM Ausubel, et al. eds., (1987), Methods in Enzymology (Academic Press, Inc.) series: PCR 2: A Practical Approach (MJ MacPherson, BD Hames and GR Taylor eds. (1995), Antibodies, A Laboratory Manual, and Animal Cell Culture (RI Freshney, ed. (1987).

[0095] Oligonucleotides that are not commercially available can be chemically synthesized, for example, according to the solid phase phosphoramidite triester method first described by Beaucage and Caruthers, Tetrahedron Lett. 22: 1859-1862 (1981), using an automated synthesizer, such as Van Devanter et.al., Nucleic Acids Res. 12: 6159-6168 (1984). Purification of oligonucleotides is carried out using any art-recognized strategy, such as non-denaturing acrylamide gel electrophoresis or anion exchange high performance liquid chromatography (HPLC), such as Pearson and Reanier, J. Chrom. 255: 137-149 (1983).

[0096] definition

[0097] Unless otherwise specifically stated, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present disclosure belongs. In addition, any method or material similar or equivalent to the method or material described herein may be used in the practice of the present disclosure. For the purposes of the present disclosure, the following terms are defined.

[0098] As used herein, the terms "a," "an," or "the" include not only aspects having one member, but also aspects having more than one member. For example, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells and reference to "the agent" includes reference to one or more agents known to those skilled in the art, and so forth.

[0099] The term "about" in relation to a reference value may include a range of values ​​plus or minus 10% from that value. For example, an amount of "about 10" includes amounts from 9 to 11, including the reference numbers 9, 10, and 11. The term "about" in relation to a reference value may also include a range of values ​​plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from that value.

[0100] The term "nucleic acid", "nucleotide" or "polynucleotide" refers to deoxyribonucleic acid (DNA), ribonucleic acid (RNA) and polymers thereof in single-stranded, double-stranded or multi-stranded form. The term includes, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising purine and / or pyrimidine bases or other natural, chemically modified, biochemically modified, non-natural, synthetic or derived nucleotide bases. In some embodiments, nucleic acid may comprise a mixture of DNA, RNA and their analogs. Unless specifically limited, the term includes nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a specific nucleic acid sequence also implicitly includes conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, interspecies homologs, single nucleotide polymorphisms (SNPs) and complementary sequences as well as sequences explicitly indicated. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).

[0101] The term "guide array" refers to a nucleic acid molecule comprising one or more, two, three or more sequences encoding RNA molecules (e.g., CRISPR-related RNA or "crRNA"), wherein the RNA comprises a forward repeating stem-loop sequence and a spacer sequence (e.g., guide RNA) that can bind to an RNA target sequence via RNA-RNA hybridization. The term includes DNA molecules or vectors comprising one or more, two, three or more sequences encoding different crRNA molecules, and includes polycistronic and polycistronic DNA molecules encoding different crRNA molecules.

[0102] The term "encode" or "encodes" refers to a nucleic acid sequence comprising an open reading frame that can be transcribed by an RNA polymerase and translated into a polypeptide or protein of the present disclosure (e.g., a Class 2, Type VI-D CRISPR effector). The term also includes nucleic acid sequences that are transcribed to produce RNA that is not translated into a polypeptide or protein, such as nucleic acid sequences encoding a guide array of the present disclosure.

[0103] As used herein, the term "non-targeting control primer" is a crRNA with a randomly generated spacer and BLASTed against the human transcriptome to ensure no matches to any known human RNA transcripts.

[0104] The term "gene" means a segment of DNA involved in producing a polypeptide chain. A DNA segment may include regions before and after the coding region (leader and trailer sequences) that participate in the transcription / translation of the gene product and the regulation of transcription / translation, as well as intervening sequences (introns) between individual coding segments (exons).

[0105] The term "cassette" refers to a combination of genetic sequence elements that can be introduced as a single element and can work together to achieve a desired result. The cassette typically contains polynucleotides that are not found in nature. The cassette can be inserted into a vector, such as an expression vector.

[0106] The term "operably linked" refers to the relative positions of two or more genetic sequence elements (e.g., a polynucleotide coding sequence and a promoter sequence) in a polynucleotide, cassette or vector that allow for proper biological function of the elements (e.g., a promoter directing transcription of the coding sequence).

[0107] The term "inducible promoter" refers to a promoter that responds to environmental factors and / or external stimuli that can be artificially controlled to change the expression or expression level of a polynucleotide sequence, or refers to a combination of elements, such as an exogenous promoter and additional elements such as transactivators that are operably linked to a separate promoter. An inducible promoter can be responsive to abiotic factors, such as oxygen levels or chemical or biological molecules. In some embodiments, the chemical or biological molecule can be a molecule that does not naturally occur in humans.

[0108] The terms "vector" and "expression vector" refer to a nucleic acid construct produced by recombination or synthesis, which has a series of specific nucleic acid elements that allow a specific polynucleotide sequence to be transcribed in a host cell. An expression vector can be a part of a plasmid, a viral genome, or a nucleic acid fragment. Typically, an expression vector comprises a polynucleotide to be transcribed that is operably connected to a promoter. The term "promoter" used herein refers to an array of nucleic acid control sequences that direct nucleic acid transcription. As used herein, a promoter includes essential nucleic acid sequences near the start site of transcription, for example, in the case of a type II polymerase promoter, including a TATA element. The promoter also optionally includes a distal enhancer or repressor element, which can be located at a position up to several thousand base pairs from the transcription start site. Other elements that may be present in an expression vector include those that enhance transcription (e.g., enhancers) and terminate transcription (e.g., terminators).

[0109] "Recombinant" refers to a genetically modified polynucleotide, polypeptide, cell, tissue or organism. For example, a recombinant polynucleotide (or a copy or complementary sequence of a recombinant polynucleotide) is a polynucleotide manipulated using well-known methods. A recombinant expression cassette comprising a promoter operably linked to a second polynucleotide (e.g., a coding sequence) may comprise a promoter that is heterologous to the second polynucleotide due to artificial manipulation (e.g., by methods described in Sambrook et al., Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, (1989) or Current Protocols in Molecular Biology Volumes 1-3, John Wiley & Sons, Inc. (1994-1998)). A recombinant expression cassette (or expression vector) typically comprises a combination of polynucleotides not found in nature. For example, artificially manipulated restriction enzyme sites or plasmid vector sequences may flank or separate a promoter from other sequences. A recombinant protein is a protein expressed by a recombinant polynucleotide, and recombinant cells, tissues and organisms are those that contain recombinant sequences (polynucleotides and / or polypeptides).

[0110] The terms "subject", "individual" and "patient" are used interchangeably herein to refer to vertebrates, including mammals or humans. Mammals include, but are not limited to, mice, apes, humans, farm animals, sports animals and pets. It also includes tissues, cells and their progeny of biological entities obtained in vivo or cultured in vitro.

[0111] In the context of polynucleotide or peptide sequences, "percent similarity" or "percent identity" is determined by comparing two optimally aligned sequences over a comparison window, wherein portions of the sequences in the comparison window may contain additions or deletions (i.e., gaps) compared to a reference sequence that does not contain additions or deletions, to optimally align the two sequences. The percentage is calculated by determining the number of positions at which the same nucleotide or amino acid occurs in the two sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window and multiplying the result by 100 to yield a percentage of similarity or identity (e.g., sequence similarity).

[0112] When polynucleotides or peptides are compared and aligned for maximum correspondence over a comparison window or designated region, a polynucleotide or peptide is considered to be substantially similar when it comprises a sequence having at least or greater than or equal to about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% similarity to a reference sequence, as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. With respect to polynucleotide sequences, this definition also refers to the complementary sequence of a test sequence.

[0113] For sequence comparison, usually a sequence is used as a reference sequence, and a test sequence is compared with the reference sequence. When using a sequence comparison algorithm, the test and reference sequences are input into a computer, subsequence coordinates are specified as required, and sequence algorithm program parameters are specified. Default program parameters can be used, or selectable parameters can be specified. The sequence comparison algorithm then calculates the sequence similarity percentage of the test sequence relative to the reference sequence based on the program parameters. For sequence comparisons of nucleic acids and proteins, BLAST and BLAST 2.0 algorithms and the default parameters discussed below are used.

[0114] Alignment methods for sequences for comparison are well known in the art. The best alignment for sequences for comparison can be performed by the following methods, for example, by Smith & Waterman, Adv. Appl. Math. 2:482 (1981) local homology algorithm, by Needleman & Wunsch, J. Mol. Biol. 48:443 (1970) homology alignment algorithm, by Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988) search similarity method, by computer implementation of these algorithms (Genetics Computer Group, 575 Science Dr., Madison, WI, GAP, BESTFIT, FASTA and TFASTA in the software package of Wisconsin Genetics), or by manual comparison and visual inspection (see, for example, Current Protocols in Molecular Biology (Ausubel et al., eds. 1995 Appendix)).

[0115] Additional examples of algorithms suitable for determining percentages of sequence similarity are BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., (1990) J. Mol. Biol. 215: 403-410 and Altschul et al. (1977) Nucleic Acids Res. 25: 3389-3402, respectively. Software for performing BLAST analysis is publicly available at the National Center for Biotechnology Information website at ncbi.nlm.nih.gov. The algorithm includes first identifying high-scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that match or satisfy a certain positive threshold score T when aligned with a word of the same length in the database sequence. T is referred to as the neighboring word score threshold (Altschul et al., supra). These initial neighboring word hits serve as seeds for initial searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence as far as the cumulative alignment score can be increased. For nucleotide sequences, the parameters M (reward score for a pair of matching residues; always>0) and N (penalty score for mismatching residues; always<0) are used. The BLASTN program (for nucleotide sequences) uses a word length (W) of 28, an expectation value (E) of 10, M=1, N=-2, and a comparison of both chains as defaults. For amino acid sequences, the BLASTP program uses a word length (W) of 3, an expectation value (E) of 10, and the BLOSUM62 scoring matrix as defaults (see, e.g., Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).

[0116] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, Proc. Nat'l. Acad. Sci. USA, 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability that a match occurs by chance between two nucleotide or amino acid sequences. For example, if the smallest sum probability in a comparison of a test nucleic acid to a reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001, then the nucleic acid is considered similar to the reference sequence.

[0117] As used herein, the term "administer" includes oral administration, topical contact, administration as a suppository, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration to a subject. Administration is by any route, including parenteral and transmucosal (e.g., oral, sublingual, palate, gums, nose, vagina, rectum or transdermal). Parenteral administration includes, for example, intravenous, intramuscular, intraarterial, intradermal, subcutaneous, intraperitoneal, ventricular and intracranial. Other modes of delivery include, but are not limited to, use of liposome preparations, intravenous infusion and transdermal patches.

[0118] The term "treatment" refers to an approach to obtaining beneficial or desired results, including, but not limited to, therapeutic benefit and / or prophylactic benefit. Therapeutic benefit means any therapeutically relevant improvement or effect on one or more diseases, conditions, or symptoms under treatment. For prophylactic benefit, the compositions of the present disclosure can be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more physiological symptoms of a disease, even though the disease, condition, or symptom may not yet be manifested.

[0119] The term "effective amount" or "sufficient amount" refers to an amount of an agent sufficient to achieve a beneficial or desired result. The therapeutically effective amount may vary depending on one or more of the following: the subject and disease condition being treated, the subject's weight and age, the severity of the disease condition, the mode of administration, etc., which can be readily determined by one of ordinary skill in the art. The specific amount may vary depending on one or more of the following: the specific agent selected, the host cell type, the location of the host cell in the subject, the dosing regimen followed, whether it is administered in combination with other compounds, the time of administration, and the physical delivery system carried by the agent.

[0120] The term "pharmaceutically acceptable carrier" refers to a substance that helps to administer an active agent to a cell, an organism, or a subject. The term also refers to a carrier or excipient that can be included in the composition of the present disclosure and has no significant adverse toxicological effects on the patient. Non-limiting examples of pharmaceutically acceptable carriers include water, NaCl, saline solution, lactated Ringer's solution, ordinary sucrose, ordinary glucose, cell culture medium, etc. Those skilled in the art will recognize that other pharmaceutical carriers can be used in the present disclosure.

[0121] Detailed description of implementation method

[0122] I. Genetically modified T cells

[0123] Provided herein are genetically modified T cells expressing (i) 2 types of VI-D CRISPR effectors with RNA-guided RNA endonuclease activity; and (ii) a guide array comprising multiple CRISPR-related RNA (crRNA) molecules. In some embodiments, the crRNA molecules independently comprise forward repeat sequences and spacer sequences that bind to target RNA. In some embodiments, the crRNA molecules bind to different target mRNAs. In some embodiments, the crRNA molecules bind to different regions of the same target mRNA.

[0124] In some embodiments, the modified T cell comprises a nucleic acid encoding a Class VI-D type CRISPR effector having RNA-guided RNA endonuclease activity, and / or a nucleic acid encoding or expressing a guide array comprising multiple CRISPR-related RNA (crRNA) molecules. In some embodiments, the nucleic acid encoding (i), or the nucleic acid encoding or expressing (ii), or the nucleic acid encoding or expressing both (i) and (ii) is stably integrated into the genome of the T cell. In some embodiments, the nucleic acid encoding (i), or the nucleic acid encoding or expressing (ii), or the nucleic acid encoding or expressing (i) and (ii) is not integrated into the genome of the T cell (e.g., transient transfection of nucleic acid).

[0125] For a given 2 types of VI-D type CRISPR effectors, the forward repeat sequence generally comprises the same sequence for all crRNA molecules in the guide array. Therefore, a guide array comprising N different crRNA molecules can comprise crRNA molecules having the same or substantially the same forward repeat sequence and N different spacer sequences. In some embodiments, the guide array comprises different spacer sequences bound to different or unique target mRNAs, and the mRNA is expressed by different target genes, such as 2 to N different target genes. In some embodiments, the guide array comprises different spacer sequences, which are bound to different sequences in the same target mRNA (e.g., mRNA expressed by TOX gene) expressed by a given target gene. The spacer sequence can be bound to a unique, separate or non-overlapping sequence present in the same target mRNA, or to a partially overlapping sequence in the same target mRNA. In some embodiments, the guide array comprises the following combinations: i) spacer sequences bound to different or unique target mRNAs expressed by different target genes, and ii) spacer sequences bound to different sequences in the same target mRNA expressed by a given target gene.

[0126] In some embodiments, the guide array is a polycistronic array comprising multiple crRNA molecules. The guide array may include 2 or more crRNA molecules. In some embodiments, the guide array includes 2 to 10 crRNA molecules. In some embodiments, the guide array includes more than 10 crRNA molecules. It should be understood that the number of crRNA molecules in the guide array is a function of the transcription extension activity and / or processivity of the promoter in the nucleic acid for including the polycistronic array. In embodiments where the promoter has increased transcription extension activity and / or processivity, it is expected that a longer guide array is transcribed from the polycistronic array, for example, including more than 10 crRNA molecules. In some embodiments, the promoter is an RNA polymerase (Pol) III promoter, such as U6 and H1 promoters, or a modified form of the above. In some embodiments, the promoter is an RNA polymerase II promoter.

[0127] In some embodiments, the Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants or interspecies homologs thereof. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence similarity or identity to the amino acid sequence of a nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, and Cas13e. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:1.

[0128] In some embodiments, a Class 2, Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity comprises a fusion protein containing a destabilization domain (DD).

[0129] In some embodiments, the guide array comprises a crRNA molecule bound to an mRNA encoding a T cell depletion-related protein. In some embodiments, the T cell depletion-related protein is selected from TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1, ​​CD46, B2M, and a combination thereof.

[0130] In some embodiments, the guide array comprises crRNA molecules that bind to mRNA encoding a protein selected from CCNC, CDK8, CDK19, MED12, MED12L, MED13, MED13L, MED15, MED16, MED19, MED24, MED26, and combinations thereof.

[0131] II. CAT-T cells

[0132] In some embodiments, the modified T cell further comprises a chimeric antigen receptor (CAR). CAR T cells express receptors that bind to antigens on target cells (eg, tumor cells), and activate natural T cell functions to target and kill target cells. The first generation CAR T cell therapy receptor comprises an extracellular antigen binding domain and an intracellular T cell activation domain. The second generation CAR T cell therapy receptor comprises a co-stimulatory domain and a T cell activation domain on its intracellular side. The co-stimulatory domain improves the therapeutic response of T cells by increasing T cell proliferation or cytotoxicity. In some embodiments, CAR comprises an antigen binding scFv or nanobody. In some embodiments, CAR comprises intramembrane signaling domains CD28 and CD3ζ (CD247). In some embodiments, CAR comprises intramembrane signaling domains 4-1BB (CD137) and CD3ζ.

[0133] In some embodiments, the CAR binds to an antigen expressed by the tumor. In some embodiments, the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD30, EGFR, EGFRvIII, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, FAB, WT-1, PSMA, AFP, BCMA, mesothelin, GPC3, MUC1, and CTAG1B.

[0134] As is known in the art, chronic intracellular signaling of CAR may lead to T cell consumption, thereby producing dysfunctional CAR T cells. Similarly, prolonged intracellular signaling of endogenous T cell receptors (TCRs) may also lead to T cell consumption, resulting in reduced anti-tumor activity. T cell consumption is characterized by increased expression of genes associated with consumption. The modified T cells disclosed herein can be used to reduce the expression of genes whose expression increases during T cell consumption, thereby increasing the anti-tumor activity of modified T cells. Therefore, in some embodiments, compared with the modified T cells disclosed herein, the intracellular signaling of CAR or endogenous TCR upregulates T cell consumption markers in control T cells. In some embodiments, the control T cells are 2 types of VI-D CRISPR effectors that do not express (i) RNA-guided RNA endonuclease activity; and / or (ii) T cells comprising a guide array of multiple CRISPR-related RNA (crRNA) molecules, wherein the CRISPR-related RNA (crRNA) molecules bind to target RNAs that consume gene expression. In some embodiments, the control T cell is a CAR T cell that does not express (i) a 2-type VI-D CRISPR effector with RNA-guided RNA endonuclease activity; and / or (ii) a guide array of multiple CRISPR-related RNA (crRNA) molecules, which are bound to a target RNA that depletes gene expression. In some embodiments, the control T cell is transfected with a non-targeted control guide array comprising a crRNA molecule that is not bound to the target RNA or expresses a non-targeted control guide array comprising a crRNA molecule that is not bound to the target RNA.

[0135] In some embodiments, the depletion marker is selected from LAG3, PDCD1 (PD-1), HAVCR2 (TIM3), CTLA4 and ENTPD1 or a combination thereof. In some embodiments, the guide array comprises crRNA molecules bound to mRNA encoding LAG3, PDCD1 (PD-1), HAVCR2 (TIM3), CTLA4 and ENTPD1 or a combination thereof.

[0136] In some embodiments, the modified T cells of the present disclosure may include a "safety switch" for downregulating the expression of CAR expressed by CAR T cells in an object or patient undergoing CART cell therapy. Therefore, in some embodiments, the guide array includes a crRNA molecule bound to the mRNA expressed by CAR, thereby reducing the expression of CAR. In some embodiments, the crRNA molecule binds to the region of the mRNA encoding the signal transduction element of CAR (e.g., intramembrane signal transduction domain 4-1BB, CD28, and CD3ζ) or the signal transduction element of endogenous TCR (e.g., ZAP70 and LCK).

[0137] In some embodiments, the T cell is a primary T cell isolated from a subject. In some embodiments, the T cell is a human T cell. In some embodiments, the T cell is a primary human T cell.

[0138] III. Systems for Multiplexed Transcriptomic Modulation

[0139] Also provided herein is a system for multiplexed transcriptomic regulation. The system may include (i) an expression cassette comprising a nucleic acid sequence encoding a Class 2 VI-D type CRISPR effector having RNA-guided RNA endonuclease activity of the present disclosure; and (ii) an expression cassette comprising a nucleic acid sequence encoding a guide array of the present disclosure.

[0140] In some embodiments, the crRNA molecule comprises a direct repeat sequence and a spacer sequence that binds to a target mRNA. In some embodiments, the crRNA molecule binds to different target mRNAs or different regions of the same target mRNA.

[0141] In some embodiments, the Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants or interspecies homologs thereof. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence similarity or identity to the amino acid sequence of a nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, and Cas13e. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:1.

[0142] In some embodiments, a Class 2, Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity comprises a fusion protein containing a destabilization domain (DD).

[0143] In some embodiments, the guide array comprises a crRNA molecule bound to an mRNA encoding a T cell depletion-related protein. In some embodiments, the T cell depletion-related protein is selected from TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1, ​​CD46, B2M, and a combination thereof.

[0144] In some embodiments, the system may further comprise a T cell or a primary T cell. In some embodiments, the T cell is a primary T cell isolated from a subject. In some embodiments, the T cell is a human T cell. In some embodiments, the T cell is a primary human T cell. In some embodiments, the T cell is transformed or transduced with the expression cassette of the system. In some embodiments, the T cell is transformed or transduced with the expression cassette of (i) and (ii) above, so that the T cell expresses the 2 types of VI-D type CRISPR effectors with RNA-guided RNA endonuclease activity disclosed herein; and the guide array disclosed herein.

[0145] In some embodiments, the T cell is a modified T cell comprising a chimeric antigen receptor (CAR). In some embodiments, the CAR binds to an antigen expressed by the tumor. In some embodiments, the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD30, EGFR, EGFRvIII, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, FAB, WT-1, PSMA, AFP, BCMA, mesothelin, GPC3, MUC1, and CTAG1B.

[0146] In some embodiments, intracellular signaling of CAR or endogenous TCR upregulates T cell depletion markers in control T cells. In some embodiments, control T cells are T cells that do not express (i) 2 types of VI-D CRISPR effectors with RNA-guided RNA endonuclease activity; and / or (ii) guide arrays of multiple CRISPR-related RNA (crRNA) molecules. In some embodiments, control T cells are CAR T cells that do not express (i) 2 types of VI-D CRISPR effectors with RNA-guided RNA endonuclease activity; and / or (ii) guide arrays of multiple CRISPR-related RNA (crRNA) molecules. In some embodiments, control T cells are transfected with non-targeted control guide arrays containing crRNA molecules that do not bind to target RNA or express non-targeted control guide arrays containing crRNA molecules that do not bind to target RNA.

[0147] In some embodiments, the depletion marker is selected from LAG3, PDCD1 (PD-1), HAVCR2 (TIM3), CTLA4 and ENTPD1 or a combination thereof. In some embodiments, the guide array comprises crRNA molecules bound to mRNA encoding LAG3, PDCD1 (PD-1), HAVCR2 (TIM3), CTLA4 and ENTPD1 or a combination thereof.

[0148] In some embodiments, T cells include a "safety switch" for downregulating the expression of CAR expressed by CAR T cells in an object or patient undergoing CAR T cell therapy. Therefore, in some embodiments, the guide array includes a crRNA molecule that binds to the mRNA expressed by CAR, thereby reducing the expression of CAR. In some embodiments, the crRNA molecule binds to the region of the mRNA encoding the signal transduction element of CAR (e.g., intramembrane signal transduction domain 4-1BB, CD28, and CD3ζ) or the signal transduction element of endogenous TCR (e.g., ZAP70 and LCK).

[0149] In some embodiments, the T cell is a primary T cell isolated from a subject. In some embodiments, the T cell is a human T cell. In some embodiments, the T cell is a primary human T cell.

[0150] IV. Fusion Proteins

[0151] In some aspects, the class 2 type VI-D CRISPR effector with RNA-guided RNA endonuclease activity comprises a fusion protein comprising a destabilization domain (DD). In some embodiments, the DD comprises an E. coli dihydrofolate reductase DD linked to the C-terminus of the class 2 type VI-D CRISPR effector with RNA-guided RNA endonuclease activity.

[0152] In some embodiments, the Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants or interspecies homologs thereof. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence similarity or identity to the amino acid sequence of a nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, and Cas13e. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:1.

[0153] In some embodiments, the DD domain comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence similarity or identity to SEQ ID NO:5.

[0154] In some embodiments, the fusion protein comprises a linker sequence connecting a Class 2 Type VI-D CRISPR effector and DD. In some embodiments, the linker sequence comprises APKKKRKVGGSPAAKRVKLD (SEQ ID NO: 11).

[0155] V. Nucleic Acids and Vectors

[0156] Also provided are nucleic acids encoding 2 types of VI-D CRISPR effectors, guide arrays, CARs and / or fusion proteins with RNA-guided RNA endonuclease activity disclosed herein. The nucleic acid may include a plasmid and a vector comprising a nucleic acid encoding the following: i) any 2 types of VI-D CRISPR effectors with RNA-guided RNA endonuclease activity disclosed herein, ii) any CAR disclosed herein, iii) guide arrays disclosed herein, and / or iv) fusion proteins disclosed herein. In some embodiments, the 2 types of VI-D CRISPR effectors with RNA-guided RNA endonuclease activity are Cas13 nucleases, and the Cas13 nucleases are selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e and functional variants thereof. In some embodiments, the guide array is a polycistronic array comprising multiple crRNA molecules. In some embodiments, the guide array comprises 2 to greater than or equal to 10 crRNA molecules. In some embodiments, the guide array comprises a crRNA molecule bound to an mRNA encoding a T cell depletion-related protein. In some embodiments, the T cell depletion-related protein is selected from TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1, ​​CD46, B2M, and a combination thereof.

[0157] In some embodiments, the vector is an expression vector or comprises an expression cassette. In some embodiments, the vector comprises a sequence regulating transcription, translation and / or RNA stability, such as an enhancer, a 5'UTR, a promoter, a polyA sequence, a 3'UTR and / or a nuclear localization sequence. It should be understood that the sequence regulating transcription, translation and / or RNA stability can be operably connected to other sequences in the vector. For example, a promoter can be operably connected to an open reading frame encoding a 2-class VI-D type CRISPR effector with RNA-guided RNA endonuclease activity, a CAR and / or a fusion protein of the present disclosure. In some embodiments, a promoter is operably connected to a nucleic acid expressing a guide array disclosed herein. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is an inducible promoter.

[0158] In some embodiments, the vector is a viral vector. The viral vector can be any viral vector suitable for delivering nucleic acid to a cell. The vector can be, for example, an adeno-associated virus (AAV) vector, an adenoviral vector, a retroviral vector, a lentiviral vector, or a herpes simplex virus (HSV) vector. In some embodiments, the vector is a lentiviral vector.

[0159] VI. Boot array

[0160] Also provided is a guide array. The guide array includes a nucleic acid (polynucleotide) containing a forward repeat sequence and a spacer sequence. The guide array is usually expressed by a plasmid or vector containing a promoter operably connected to the guide array. The forward repeat sequence can form a stem-loop structure, and the spacer sequence includes a sequence complementary to the target RNA in the cell. The spacer sequence binds to the target RNA through RNA-RNA hybridization. Exemplary non-limiting spacer sequences are provided in Table 1 and Table 2.

[0161] In some embodiments, the guide array is a polycistronic array comprising multiple crRNA molecules. The guide array may include 2 or more crRNA molecules. In some embodiments, the guide array includes 2 to 10 crRNA molecules. In some embodiments, the guide array includes more than 10 crRNA molecules. It should be understood that the number of crRNA molecules in the guide array is a function of the transcription extension activity and / or persistence of the promoter in the nucleic acid for including the polycistronic array. In embodiments where the promoter has increased transcription extension activity and / or persistence, it is expected that a longer guide array is transcribed from the polycistronic array, for example, including more than 10 crRNA molecules. In some embodiments, the promoter is an RNA polymerase (Pol) III promoter, such as U6 and H1 promoters, or a modified form of the above. In some embodiments, the promoter is an RNA polymerase II promoter.

[0162] As described above, the forward repeat sequence generally includes the same sequence for guiding all crRNA molecules in the array. Therefore, the guide array comprising N different crRNA molecules can include crRNA molecules with the same or substantially the same forward repeat sequence and N different spacer sequences. In some embodiments, the guide array includes different spacer sequences combined with different or unique target mRNAs, and the mRNA is expressed by different target genes, such as 2 to N different target genes. In some embodiments, the guide array includes different spacer sequences, and the spacer sequences are combined with different sequences in the same target mRNA (for example, mRNA expressed by TOX genes) expressed by a given target gene. The spacer sequence can be combined with a unique, separate or non-overlapping sequence present in the same target mRNA, or with a partially overlapping sequence in the same target mRNA. In some embodiments, the guide array includes the following combination: i) spacer sequences combined with different or unique target mRNAs expressed by different target genes, and ii) spacer sequences combined with different sequences in the same target mRNA expressed by a given target gene.

[0163] In some embodiments, the direct repeat sequence comprises AACCCCTACCAACTGGTCGGGGTTTGAAAC (SEQ ID NO: 9). In some embodiments, the direct repeat sequence comprises CAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC (SEQ ID NO: 10).

[0164] VII. Methods for Producing Modified T Cells

[0165] Also provided are methods for producing modified T cells expressing Class 2 Type VI-D CRISPR effectors and guide arrays of the present disclosure. The methods may include transfecting or transducing T cells with one or more expression vectors encoding Class 2 Type VI-D CRISPR effectors with RNA-guided RNA endonuclease activity and / or expressing a guide array comprising one or more or a plurality of CRISPR-associated RNA (crRNA) molecules.

[0166] In some embodiments, T cells are transfected or transduced with two separate vectors, the first vector comprising a nucleic acid sequence encoding a Class VI-D type CRISPR effector with RNA-guided RNA endonuclease activity, and the second vector comprising a nucleic acid sequence encoding a guide array comprising multiple CRISPR-related RNA (crRNA) molecules. In some embodiments, co-transduction of T cells with two separate vectors improves targeting efficiency compared to transduction with a single vector expressing Class VI-D type CRISPR effectors and guide arrays. In some embodiments, before transduction with a second vector comprising a guide array, T cells are transduced with a first vector expressing Class VI-D type CRISPR effectors. In some embodiments, T cells are transduced with a first vector expressing Class VI-D type CRISPR effectors about 12 hours to 36 hours before transduction with a second vector comprising a guide array.

[0167] In some embodiments, the guide array is a polycistronic array comprising multiple crRNA molecules. The guide array may include 2 or more crRNA molecules. In some embodiments, the guide array includes 2 to 10 crRNA molecules. In some embodiments, the guide array includes more than 10 crRNA molecules. It should be understood that the number of crRNA molecules in the guide array is a function of the transcription extension activity and / or persistence of the promoter in the nucleic acid for including the polycistronic array. In embodiments where the promoter has increased transcription extension activity and / or persistence, it is expected that a longer guide array is transcribed from the polycistronic array, for example, including more than 10 crRNA molecules. In some embodiments, the promoter is an RNA polymerase (Pol) III promoter, such as U6 and H1 promoters, or a modified form of the above. In some embodiments, the promoter is an RNA polymerase II promoter.

[0168] In some embodiments, the Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants or interspecies homologs thereof. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence similarity or identity to the amino acid sequence of a nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, and Cas13e. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:1.

[0169] In some embodiments, the guide array comprises a crRNA molecule bound to an mRNA encoding a T cell depletion-related protein. In some embodiments, the T cell depletion-related protein is selected from TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1, ​​CD46, B2M, and a combination thereof.

[0170] In some embodiments, T cells are also transduced with or optionally with a third vector comprising a nucleic acid sequence encoding CAR. T cells can be transduced at about the same time with a first vector encoding 2 types of VI-D CRISPR effectors disclosed herein and a third vector encoding CAR, for example, at the same time or in the same period, or transduced within minutes or hours (e.g., 1 hour to 8 hours) of each other. In some embodiments, T cells are transduced with the first and third vectors, and then transformed with a second vector comprising a guide array after 12 to 36 hours.

[0171] In some embodiments, the first, second and / or third vector is stably integrated into the genome of the host T cell. In some embodiments, the first, second and / or third vector is not integrated into the genome of the T cell (e.g., transient transfection of the vector).

[0172] In some embodiments, the CAR binds to an antigen expressed by the tumor. In some embodiments, the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD30, EGFR, EGFRvIII, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, FAB, WT-1, PSMA, AFP, BCMA, mesothelin, GPC3, MUC1, and CTAG1B.

[0173] In some embodiments, the CAR binds to a tumor antigen described herein.

[0174] In some embodiments, intracellular signaling of CAR or endogenous TCR upregulates T cell depletion markers in control T cells. In some embodiments, control T cells are T cells that do not express (i) 2 types of VI-D CRISPR effectors with RNA-guided RNA endonuclease activity; and / or (ii) guide arrays comprising multiple CRISPR-related RNA (crRNA) molecules, wherein the CRISPR-related RNA (crRNA) molecules bind to RNA that depletes gene expression. In some embodiments, control T cells are CAR T cells that do not express (i) 2 types of VI-D CRISPR effectors with RNA-guided RNA endonuclease activity; and / or (ii) guide arrays comprising multiple CRISPR-related RNA (crRNA) molecules, wherein the CRISPR-related RNA (crRNA) molecules bind to RNA that depletes gene expression. In some embodiments, control T cells are transfected with non-targeted control guide arrays comprising crRNA molecules that do not bind to target RNA or express non-targeted control guide arrays comprising crRNA molecules that do not bind to target RNA.

[0175] In some embodiments, the depletion marker is selected from LAG3, PDCD1 (PD-1), HAVCR2 (TIM3), CTLA4 and ENTPD1 or a combination thereof. In some embodiments, the guide array comprises crRNA molecules bound to mRNA encoding LAG3, PDCD1 (PD-1), HAVCR2 (TIM3), CTLA4 and ENTPD1 or a combination thereof.

[0176] In some embodiments, T cells include a "safety switch" for downregulating the expression of CAR expressed by CAR T cells in an object or patient undergoing CAR T cell therapy. Therefore, in some embodiments, the guide array includes a crRNA molecule bound to the mRNA expressed by CAR, thereby reducing the expression of CAR. In some embodiments, the crRNA molecule is bound to the region of the mRNA encoding the signal transduction element of CAR (e.g., intramembrane signaling domain 4-1BB, CD28, and CD3ζ) or the signal transduction element of endogenous TCR (e.g., ZAP70 and LCK).

[0177] VIII. Methods for Regulating Gene Expression in T Cells

[0178] In some aspects, the present disclosure provides a method for regulating the gene expression of T cells. The method provides the advantages of adjustable and reversible control of T cell transcriptomes. In some embodiments, T cells express the fusion protein of the present disclosure and a guide array comprising crRNA molecules, wherein the crRNA molecules comprise forward repeats and spacers that bind to target mRNA. In some embodiments, the fusion protein comprises 2 types of VI-D type CRISPR effectors and destabilization domains (DD) with RNA-guided RNA endonuclease activity. In some embodiments, DD comprises an E. coli dihydrofolate reductase DD connected to the C-terminus of 2 types of VI-D type CRISPR effectors with RNA-guided RNA endonuclease activity.

[0179] In steady state, Class 2 VI-D type CRISPR effector-DD fusion proteins are rapidly degraded by the proteasome due to DD disorder. Therefore, in some embodiments, the fusion protein is degraded in T cells in the absence of the compound. In the presence of a suitable compound, the tertiary structure of DD is stabilized, allowing Class 2 VI-D type CRISPR effector-DD fusion proteins to bind and target RNA. In addition, the inventors of the present application found that T cells expressing fusion proteins and guide RNAs cultured in the presence of compounds can conditionally inhibit the expression of target genes, while not inhibiting the expression of target genes in the absence of compounds. Therefore, in some embodiments, the expression of the target gene in the presence of the compound is reduced compared to the expression of the target gene in the absence of the compound.

[0180] The inventors of the present application have also found that by controlling the dose of the compound that stabilizes the DD of the fusion protein, the expression of the target gene in T cells can be regulated. The regulation of the expression of the target gene was observed in an S-shaped dose-response curve of about 1 nM to 100 nM, as shown in Examples and Figure 4 Thus, in some embodiments, the expression of one or more target genes is modulated by the compound in a dose-dependent manner.

[0181] The inventors of the present application further discovered that by removing the compound that stabilizes the DD of the fusion protein from the culture medium, the inhibition of target gene expression in T cells expressing the fusion protein and the guide RNA bound to the target mRNA can be reversed, so that removing the compound from the culture medium leads to a rapid increase in target gene expression. Therefore, in some embodiments, after removing the compound, the expression of the target gene is increased in the T cells, thereby reversibly regulating the expression of the target gene.

[0182] In some embodiments, the method comprises: (a) transducing T cells with (i) an expression vector comprising a nucleic acid sequence encoding a fusion protein of the present disclosure; and (ii) an expression vector comprising a nucleic acid sequence encoding a guide array comprising crRNA molecules, wherein the crRNA molecules comprise a direct repeat sequence and a spacer sequence that binds to a target mRNA; (b) contacting the T cells with a compound that binds to and stabilizes DD, wherein expression of the target gene is reduced in the presence of the compound compared to expression of the target gene in the absence of the compound.

[0183] In some embodiments, the compound is trimethoprim (TMP).

[0184] In some embodiments, the Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants or interspecies homologs thereof. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence similarity or identity to the amino acid sequence of a nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, and Cas13e. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:1.

[0185] In some embodiments, the guide array comprises one or more crRNA molecules that bind to different target mRNAs or different regions of the same target mRNA. In some embodiments, the method can regulate the expression of more than one target gene in a T cell. In some embodiments, the method can simultaneously inhibit the expression of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more target genes. In some embodiments, the method can simultaneously inhibit the expression of one or more target genes associated with consumption in a T cell. In some embodiments, the method can simultaneously inhibit the expression of a protein selected from TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1, ​​CD46, B2M, and a combination thereof.

[0186] IX. Methods for Screening to Identify Modulators of T Cell Activity

[0187] In another aspect, the present disclosure provides a method for screening to identify regulatory factors of T cell activity. The method allows for systemic genetic interference in primary T cells. In some embodiments, the method includes expressing in a T cell or a population of T cells:

[0188] (i) a Class 2, Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity; and

[0189] (ii) a library of guide arrays, wherein individual guide arrays comprise one or more CRISPR-associated RNA (crRNA) molecules, wherein the crRNA molecules comprise a direct repeat sequence and a spacer sequence that binds to a target RNA, and wherein the one or more crRNA molecules bind to different target mRNAs or different regions of the same target mRNA;

[0190] culturing the T cells to produce a clonal population of expanded T cells; and

[0191] Determine whether the guide array is enriched or depleted in the clonal population of expanded T cells,

[0192] Wherein the target mRNA encodes a negative regulator of T cell activity if the guide array is enriched, or encodes a positive regulator of T cell activity if the guide array is depleted.

[0193] In some embodiments, the T cell activity is T cell proliferation, increased cytokine secretion, or increased tumor cell killing.

[0194] In some embodiments, T cells comprising an enriched guide array have an effector memory phenotype, and T cells comprising a depleted guide array have a central memory or stem cell memory phenotype. In some embodiments, determining whether the guide array is enriched or depleted in a clonal population of expanded T cells comprises sequencing the guide RNA present in the T cells.

[0195] In some embodiments, the individual guide arrays in the library comprise crRNA molecules bound to mRNA encoding T cell depletion-related proteins. In some embodiments, the T cell depletion-related proteins are selected from TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, and combinations thereof.

[0196] In some embodiments, the guide array library comprises one or more separate guide arrays comprising a polycistronic array containing multiple crRNA molecules. In some embodiments, a separate guide array comprises 2 to 10 crRNA molecules. In some embodiments, a separate guide array comprises a pair of crRNA molecules.

[0197] In some embodiments, the Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence similarity or identity to the amino acid sequence of a nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, and Cas13e. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:1.

[0198] In some embodiments, the T cells also express a chimeric antigen receptor (CAR). The expression of CAR can lead to tonic signaling, which leads to T cell expansion and subsequent dysfunction.

[0199] In some embodiments, the CAR binds to an antigen expressed by the tumor. In some embodiments, the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD30, EGFR, EGFRvIII, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, FAB, WT-1, PSMA, AFP, BCMA, mesothelin, GPC3, MUC1, and CTAG1B.

[0200] X. Methods for increasing proliferation of T cells

[0201] In another aspect, the present disclosure provides a method for increasing the proliferation of T cells. The method allows for systemic genetic perturbation in primary T cells to identify novel combinations of putative depletion-related genes that regulate the proliferation of dysfunctional T cells.

[0202] In some embodiments, the method comprises transducing T cells with:

[0203] (i) an expression vector comprising a nucleic acid sequence encoding a Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity; and

[0204] (ii) an expression vector comprising a nucleic acid sequence encoding a guide array comprising one or more crRNA molecules, wherein the crRNA molecules independently comprise a direct repeat sequence and a spacer sequence that binds to a target mRNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA,

[0205] wherein proliferation of the T cells is increased compared to a control T cell expressing a non-targeting control guide array comprising one or more crRNA molecules that do not bind to the target mRNA in (ii).

[0206] In some embodiments, the guide array comprises a crRNA molecule bound to an mRNA encoding a T cell depletion-related protein. In some embodiments, the T cell depletion-related protein is selected from FAS, ZC3H12A, CTLA4, SOCS1, CBLB, PD-1, TOX, TOX2, FLI1, CD5, CD39, CD46, TRAC, B2M, JUNB, IRF4, PDCD1 (PD-1), HAVCR2 (TIM3), DHX37, and a combination thereof.

[0207] In some embodiments, the guide array is a library of guide arrays or is included in a library of guide arrays, wherein the library of guide arrays includes one or more separate guide arrays. A separate guide array may include a polycistronic array containing one or more or more crRNA molecules. In some embodiments, the guide array includes a polycistronic array containing multiple crRNA molecules. In some embodiments, the guide array includes 2 to greater than or equal to 10 crRNA molecules. In some embodiments, a separate guide array includes a pair of (2) crRNA molecules.

[0208] In some embodiments, the Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence similarity or identity to the amino acid sequence of a nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, and Cas13e. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:1.

[0209] In some embodiments, the method further comprises (iii) transducing T cells with an expression vector comprising a nucleic acid sequence encoding the CAR. In some embodiments, the CAR binds to an antigen expressed by the tumor. In some embodiments, the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD30, EGFR, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, EGFR, FAB, WT-1, PSMA, AFP, CEA, and CTAG1B.

[0210] XI. Methods for treating tumors

[0211] The present disclosure also provides a method for treating cancer or tumors in an object or patient in need of treatment. In some embodiments, the method includes administering an effective amount of genetically modified T cells of the present disclosure to the object, wherein the modified T cells kill tumor cells in the object, thereby treating the tumor. In some embodiments, the modified T cells express or contain (i) 2 types of VI-D type CRISPR effectors with RNA endonuclease activity guided by RNA of the present disclosure, (ii) a guide array of the present disclosure, or (iii) both (i) and (ii).

[0212] In some embodiments, the modified T cell comprises (i) an expression vector comprising a nucleic acid sequence encoding a class 2, type VI-D CRISPR effector with RNA-guided RNA endonuclease activity; and (ii) an expression vector comprising a nucleic acid sequence encoding a guide array comprising one or more crRNA molecules, wherein the crRNA molecules independently comprise a direct repeat sequence and a spacer sequence that binds to a target mRNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA.

[0213] In some embodiments, the guide array comprises a crRNA molecule bound to an mRNA encoding a T cell depletion-related protein. In some embodiments, the T cell depletion-related protein is selected from FAS, ZC3H12A, CTLA4, SOCS1, CBLB, PD-1, TOX, TOX2, FLI1, CD5, CD39, CD46, TRAC, B2M, JUNB, IRF4, PDCD1 (PD-1), HAVCR2 (TIM3), DHX37, and a combination thereof.

[0214] In some embodiments, the Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence similarity or identity to the amino acid sequence of a nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, and Cas13e. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:1.

[0215] In some embodiments of the method, the modified T cell further comprises a modified CAR. In some embodiments, the CAR binds to an antigen expressed by the tumor. In some embodiments, the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD30, EGFR, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, EGFR, FAB, WT-1, PSMA, AFP, CEA, and CTAG1B.

[0216] XII. Methods for increasing the anti-tumor activity of T cells

[0217] The present disclosure also provides a method for improving the anti-tumor activity of T cells. In some embodiments, the method includes contacting tumor cells with genetically modified T cells of the present disclosure, wherein contacting tumor cells with genetically modified T cells increases the expression of anti-tumor cytokines or kills tumor cells. In some embodiments, modified T cells express or include (i) 2 types of VI-D type CRISPR effectors with RNA-guided RNA endonuclease activity disclosed herein, (ii) guide arrays disclosed herein, or (iii) (i) and (ii) both. In some embodiments of the method, compared with control T cells not including (i) or (ii) or (i) and (ii), tumor cells are contacted with genetically modified T cells disclosed herein to increase anti-tumor activity.

[0218] In some embodiments, the method is an in vitro method, so that tumor cells are contacted with genetically modified T cells of the present disclosure in culture. In some embodiments, the method is an ex vivo method, wherein T cells are isolated from an object suffering from cancer or a tumor, and T cells are modified in culture to express 2 types of VI-D type CRISPR effectors with RNA-guided RNA endonuclease activity disclosed herein and the guide array of the present disclosure. After ex vivo modification, the modified T cells (e.g., autologous treatment) can be administered to the object. In some embodiments, the method is an in vivo method, wherein an effective amount of modified T cells of the present disclosure are administered to the object.

[0219] In some embodiments of the method, the modified T cell comprises (i) an expression vector comprising a nucleic acid sequence encoding a class 2, type VI-D CRISPR effector with RNA-guided RNA endonuclease activity; and (ii) an expression vector comprising a nucleic acid sequence encoding a guide array comprising one or more crRNA molecules, wherein the crRNA molecules independently comprise a direct repeat sequence and a spacer sequence that binds to a target mRNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA.

[0220] In some embodiments, the guide array comprises a crRNA molecule bound to an mRNA encoding a T cell depletion-related protein. In some embodiments, the T cell depletion-related protein is selected from FAS, ZC3H12A, CTLA4, SOCS1, CBLB, PD-1, TOX, TOX2, FLI1, CD5, CD39, CD46, TRAC, B2M, JUNB, IRF4, PDCD1 (PD-1), HAVCR2 (TIM3), DHX37, and a combination thereof.

[0221] In some embodiments, the Class 2 Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence similarity or identity to the amino acid sequence of a nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, and Cas13e. In some embodiments, the Cas13 nuclease comprises an amino acid sequence having at least (e.g., greater than or equal to) about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:1.

[0222] In some embodiments of the method, the modified T cell further comprises a modified CAR. In some embodiments, the CAR binds to an antigen expressed by the tumor. In some embodiments, the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD30, EGFR, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, EGFR, FAB, WT-1, PSMA, AFP, CEA, and CTAG1B.

[0223] In any of the embodiments described herein, the tumor can be selected from the following: acanthoma, acinar cell carcinoma, acoustic neuroma, acral lentiginous melanoma, acrohidroma, acute eosinophilic leukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute myeloblastic leukemia with maturation, acute myeloid dendritic cell leukemia, acute myeloid leukemia, acute promyelocytic leukemia, ameloblastoma, adenocarcinoma, adenoid cystic carcinoma, adenoma, odontogenic adenomatous tumor, adrenocortical carcinoma, adult T-cell leukemia, aggressive NK-cell leukemia, AIDS-related cancer, AIDS-related lymphoma, alveolar soft tissue sarcoma, ameloblastic fibroma, anal carcinoma, anaplastic large cell lymphoma, undifferentiated thyroid carcinoma, angioimmunoblastic T-cell lymphoma, angiomyolipoma, angiosarcoma, appendix carcinoma, astrocytoma, atypical teratoid rhabdoid tumor, basal cell carcinoma, basaloid carcinoma, B-cell leukemia, B-cell lymphoma, Bellini duct carcinoma, biliary tract cancer, bladder cancer, blastoma, bone cancer, osteoma, brain stem glioma, brain tumor, breast cancer, Brenner tumor, bronchiolar carcinoma, bronchioalveolar carcinoma, brown tumor, Burkitt lymphoma, cancer of unknown primary site, carcinoid tumor, epithelial carcinoma, epithelial carcinoma in situ, epithelial carcinoma of penis, epithelial carcinoma of unknown primary site, carcinosarcoma, Castleman disease, embryonal tumor of the central nervous system, cerebellar astrocytoma, brain astrocytoma, cervical cancer, bile duct carcinoma, chondroma , chondrosarcoma, chordoma, choriocarcinoma, choroid plexus papilloma, chronic lymphocytic leukemia, chronic monocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorder, chronic neutrophilic leukemia, clear cell tumor, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, Degos disease, dermatofibrosarcoma protuberans, dermoid cyst, desmoplastic small round cell tumor, diffuse large B-cell lymphoma, dysembryoplastic neuroepithelial tumor, embryonal carcinoma, endodermal sinus tumor, endometrial carcinoma, endometrial uterine carcinoma, endometrioid tumor, enteropathy-associated T-cell lymphoma, ependymoblastoma, ependymoma, epithelioid sarcoma, erythroleukemia, esophageal cancer, olfactory neuroblastoma, Ewing family tumor Tumor, Ewing family sarcoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, extramammary Paget's disease, fallopian tube cancer, fetus in fetus, fibroma, fibrosarcoma, follicular lymphoma, follicular thyroid cancer, gallbladder cancer, gallbladder cancer, ganglioglioma, ganglioneuroma, gastric cancer, gastric lymphoma, gastrointestinal cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gastrointestinal stromal tumor, germ cell tumor, germ cell tumor, gestational choriocarcinoma, gestational trophoblastic tumor, giant cell tumor of bone, glioblastoma multiforme, glioma, gliomatosis, glomus tumor, glucagonoma, gonadal blastoma, granulosa cell tumor, hairy cell leukemia, hairy cell leukemia, head and neck cancer, head and neck cancer, heart cancer, hemangioblastoma,Hemangiopericytoma, angiosarcoma, hematological malignancies, hepatocellular carcinoma, hepatosplenic T-cell lymphoma, hereditary breast-ovarian cancer syndrome, Hodgkin lymphoma, Hodgkin lymphoma, hypopharyngeal cancer, hypothalamic glioma, inflammatory breast cancer, intraocular melanoma, islet cell carcinoma, islet cell tumors, juvenile myelomonocytic leukemia, Kaposi's sarcoma, Kaposi's sarcoma, kidney cancer, Klatskin tumor, Krukenberg tumor, laryngeal cancer, laryngeal cancer, malignant lentigo melanoma, leukemia, leukemia, lip and oral cancer, liposarcoma, lung cancer, flavonoids, lymphangioma, lymphangiosarcoma, lymphoepithelioma, lymphatic leukemia, lymphoma, macroglobulinemia, malignant fibrous tissue tumor, malignant fibrous tissue of bone cell tumor, malignant glioma, malignant mesothelioma, malignant peripheral nerve sheath tumor, malignant rhabdoid tumor, malignant salamander tumor, MALT lymphoma, mantle cell lymphoma, mast cell leukemia, mediastinal germ cell tumor, mediastinal tumor, medullary thyroid carcinoma, medulloblastoma, medulloblastoma, medullary epithelioma, melanoma, melanoma, meningioma, Merkel cell carcinoma, mesothelioma, mesothelioma, occult primary metastatic squamous neck cancer, metastatic urothelial carcinoma, mixed mullerian tumor, monocytic leukemia, oral cancer, mucinous tumor, multiple endocrine neoplasia syndrome, multiple myeloma, multiple myeloma, mycosis fungoides, mycosis fungoides, myelodysplastic disease, myelodysplastic syndrome, myeloid leukemia, myeloid sarcoma, myeloid hyperplasia Physiologic diseases, myxoma, nasal cancer, nasopharyngeal tumor, nasopharyngeal carcinoma, neoplasm, schwannoma, neuroblastoma, neuroblastoma, neurofibroma, neuroma, nodular melanoma, non-Hodgkin lymphoma, non-Hodgkin lymphoma, non-melanoma skin cancer, non-small cell lung cancer, ocular oncology, oligoastrocytoma, oligodendroglioma, oncocytoma, optic nerve sheath meningioma, oral cancer, oral cancer, oropharyngeal cancer, osteosarcoma, osteosarcoma, ovarian cancer, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, Paget's disease of the breast, superior sulcus tumor, pancreatic cancer, pancreatic cancer, papillary thyroid cancer, papillomatosis, paraganglioma, paranasal sinus cancer, parathyroid cancer, penile cancer, perivascular epithelioid cell tumor tumor, pharyngeal cancer, pheochromocytoma, intermediately differentiated pineal parenchymal tumor, pinealoblastoma, pituitary cell tumor, pituitary adenoma, pituitary tumor, plasma cell tumor, pleuropulmonary blastoma, polyembryony, precursor T lymphoblastic lymphoma, primary central nervous system lymphoma, primary effusion lymphoma, primary hepatocellular carcinoma, primary liver cancer, primary peritoneal cancer, primitive neuroectodermal tumor, prostate cancer, pseudomyxoma peritonei, rectal cancer, renal cell carcinoma, respiratory cancer associated with the NUT gene on chromosome 15, retinoblastoma, rhabdomyosarcoma, rhabdomyosarcoma, Richter's transformation, sacrococcygeal teratoma, salivary gland cancer, sarcoma, schwannomatosis, sebaceous gland carcinoma, secondary neoplasms, seminoma, serous tumors,Sertoli-Leydig cell tumor, sex cord-stromal tumor, Sezary syndrome, signet ring cell carcinoma, skin cancer, small blue round cell tumor, small cell carcinoma, small cell lung cancer, small cell lymphoma, small intestinal cancer, soft tissue sarcoma, somatostatinoma, sootypic warts, spinal cord tumor, spinal tumor, splenic marginal zone lymphoma, squamous cell carcinoma, gastric cancer, superficial spreading melanoma, supratentorial primitive neuroectodermal tumor, surface epithelial-stromal tumor, synovial sarcoma, T-cell acute lymphoblastic leukemia, T-cell large granular lymphocytic leukemia blood disease, T-cell leukemia, T-cell lymphoma, T-cell prolymphocytic leukemia, teratoma, terminal lymphatic cancer, testicular cancer, thecoma, pharyngeal cancer, thymic cancer, thymoma, thyroid cancer, renal pelvis and ureter transitional cell carcinoma, transitional cell carcinoma, urachal carcinoma, urethral cancer, genitourinary neoplasms, uterine sarcoma, uveal melanoma, vaginal cancer, Verner-Morrison syndrome, verrucous carcinoma, optic pathway glioma, vulvar cancer, Waldenstrom's macroglobulinemia, Warthin's tumor, Wilms' tumor, and combinations thereof.

[0224] In any of the embodiments described herein, the CAR binds to an antigen expressed by a tumor selected from the group consisting of acanthoma, acinar cell carcinoma, acoustic neuroma, acral lentigo melanoma, acrohidroma, acute eosinophilic leukemia, acute lymphoblastic leukemia, acute megakaryoblastic leukemia, acute monocytic leukemia, acute myeloblastic leukemia with maturation, acute myeloid dendritic cell leukemia, acute myeloid leukemia, acute promyelocytic leukemia, ameloblastoma, adenocarcinoma, adenoid cystic carcinoma, adenoma, odontogenic adenomatous tumor, adrenocortical carcinoma, adult T-cell leukemia, aggressive NK-cell leukemia, AIDS-related cancer, AIDS-related lymphoma, alveolar soft tissue sarcoma, ameloblastic fibroma, anal cancer, interstitial carcinoma, Anaplastic large cell lymphoma, anaplastic thyroid cancer, angioimmunoblastic T-cell lymphoma, angiomyolipoma, angiosarcoma, appendix cancer, astrocytoma, atypical teratoid rhabdoid tumor, basal cell carcinoma, basaloid carcinoma, B-cell leukemia, B-cell lymphoma, Bellini duct carcinoma, biliary tract cancer, bladder cancer, blastoma, bone cancer, osteoma, brain stem glioma, brain tumor, breast cancer, Brenner tumor, bronchiolar carcinoma, bronchioalveolar carcinoma, brown tumor, Burkitt lymphoma, cancer of unknown primary site, carcinoid tumor, epithelial carcinoma, epithelial carcinoma in situ, epithelial carcinoma of penis, epithelial carcinoma of unknown primary site, carcinosarcoma, Castleman disease, embryonal tumor of the central nervous system, cerebellar astrocytoma, cerebral astrocytoma cell tumor, cervical cancer, bile duct cancer, chondroma, chondrosarcoma, chordoma, choriocarcinoma, choroid plexus papilloma, chronic lymphocytic leukemia, chronic monocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorder, chronic neutrophilic leukemia, clear cell tumor, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, Degos disease, dermatofibrosarcoma protuberans, dermoid cyst, desmoplastic small round cell tumor, diffuse large B-cell lymphoma, dysembryoplastic neuroepithelial tumor, embryonal carcinoma, endodermal sinus tumor, endometrial carcinoma, endometrial uterine carcinoma, endometrioid tumor, enteropathy-associated T-cell lymphoma, ependymoblastoma, ependymoma, epithelioid sarcoma, erythroleukemia, esophageal cancer, olfactory neuroblastoma, Ewing family tumors, Ewing family sarcoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, extramammary Paget's disease, fallopian tube cancer, fetus in fetus, fibroma, fibrosarcoma, follicular lymphoma, follicular thyroid cancer, gallbladder cancer, gallbladder cancer, ganglioglioma, ganglioneuroma, gastric cancer, gastric lymphoma, gastrointestinal cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor, gastrointestinal stromal tumor, germ cell tumor, germ cell tumor, gestational choriocarcinoma, gestational trophoblastic tumor, giant cell tumor of bone, glioblastoma multiforme, glioma, gliomatosis, glomus tumor, glucagonoma, gonadal blastoma, granulosa cell tumor, hairy cell leukemia, hairy cell leukemia, head and neck cancer,Head and Neck Cancer, Heart Cancer, Hemangioblastoma, Hemangiopericytoma, Angiosarcoma, Hematological Malignancies, Hepatocellular Carcinoma, Hepatosplenic T-cell Lymphoma, Hereditary Breast-Ovarian Cancer Syndrome, Hodgkin Lymphoma, Hodgkin Lymphoma, Hypopharyngeal Cancer, Hypothalamic Glioma, Inflammatory Breast Cancer, Intraocular Melanoma, Islet Cell Carcinoma, Islet Cell Tumors, Juvenile Myelomonocytic Leukemia, Kaposi's Sarcoma, Kaposi's Sarcoma, Kidney Cancer, Klatskin Tumor, Krukenberg Tumor, Laryngeal Cancer, Laryngeal Cancer, Laryngeal Laryngeal Nevus Malignus Melanoma, Leukemia, Leukemia, Liposarcoma, Lung Cancer, Flavosarcoma, Lymphangioma, Lymphangiosarcoma, Lymphoepithelioma, Lymphatic Leukemia, Lymphoma, Macroglobulinemia, Malignant Fibrous Tissue Tumor, Malignant Fibrous histiocytoma, malignant fibrous histiocytoma of bone, malignant glioma, malignant mesothelioma, malignant peripheral nerve sheath tumor, malignant rhabdoid tumor, malignant salamander tumor, MALT lymphoma, mantle cell lymphoma, mast cell leukemia, mediastinal germ cell tumor, mediastinal tumor, medullary thyroid carcinoma, medulloblastoma, medulloblastoma, medullary epithelioma, melanoma, melanoma, meningioma, Merkel cell carcinoma, mesothelioma, mesothelioma, occult primary metastatic squamous neck cancer, metastatic urothelial carcinoma, mixed mullerian tumor, monocytic leukemia, oral cancer, mucinous tumor, multiple endocrine neoplasia syndrome, multiple myeloma, multiple myeloma, mycosis fungoides, mycosis fungoides, myelodysplastic disease, myelodysplastic syndrome, Myeloid leukemia, myeloid sarcoma, myeloproliferative disorders, myxoma, nasal cancer, nasopharyngeal tumor, nasopharyngeal carcinoma, neoplasm, schwannoma, neuroblastoma, neuroblastoma, neurofibroma, neuroma, nodular melanoma, non-Hodgkin lymphoma, non-Hodgkin lymphoma, non-melanoma skin cancer, non-small cell lung cancer, ocular oncology, oligoastrocytoma, oligodendroglioma, oncocytoma, optic nerve sheath meningioma, oral cancer, oral cancer, oropharyngeal cancer, osteosarcoma, osteosarcoma, ovarian cancer, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, Paget's disease of the breast, superior sulcus tumor, pancreatic cancer, pancreatic cancer, papillary thyroid cancer, papillomatosis, paraganglioma, paranasal sinus cancer, parathyroid cancer, Penile cancer, perivascular epithelioid cell tumor, pharyngeal cancer, pheochromocytoma, intermediately differentiated pineal parenchymal tumor, pinealoblastoma, pituitary cell tumor, pituitary adenoma, pituitary tumor, plasma cell tumor, pleuropulmonary blastoma, polyembryony, precursor T lymphoblastic lymphoma, primary central nervous system lymphoma, primary effusion lymphoma, primary hepatocellular carcinoma, primary liver cancer, primary peritoneal cancer, primitive neuroectodermal tumor, prostate cancer, pseudomyxoma peritonei, rectal cancer, renal cell carcinoma, respiratory cancer associated with NUT gene on chromosome 15, retinoblastoma, rhabdomyosarcoma, rhabdomyosarcoma, Richter's transformation, sacrococcygeal teratoma, salivary gland cancer, sarcoma, schwannomatosis, sebaceous gland carcinoma, secondary neoplasms,Seminomas, serous tumors, Sertoli-Leydig cell tumors, sex cord-stromal tumors, Sezary syndrome, signet ring cell carcinoma, skin cancer, small blue round cell tumors, small cell carcinoma, small cell lung cancer, small cell lymphoma, small intestinal cancer, soft tissue sarcoma, somatostatinoma, sooty warts, spinal cord tumors, spinal tumors, splenic marginal zone lymphoma, squamous cell carcinoma, gastric cancer, superficial spreading melanoma, supratentorial primitive neuroectodermal tumors, surface epithelial-stromal tumors, synovial sarcoma, T-cell acute lymphoblastic leukemia, T-cell large granuloma Granulocytic leukemia, T-cell leukemia, T-cell lymphoma, T-cell prolymphocytic leukemia, teratoma, terminal lymphatic cancer, testicular cancer, thecoma, pharyngeal cancer, thymic cancer, thymoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter, transitional cell carcinoma, urachal cancer, urethral cancer, genitourinary neoplasms, uterine sarcoma, uveal melanoma, vaginal cancer, Verner-Morrison syndrome, verrucous carcinoma, optic pathway glioma, vulvar cancer, Waldenstrom's macroglobulinemia, Warthin's tumor, Wilms' tumor, and combinations thereof.

[0225] Example

[0226] The following examples describe representative, non-limiting methods of the present disclosure.

[0227] method

[0228] Cloning of lentiviral constructs

[0229] All oligonucleotides were synthesized by IDT or by the Stanford Protein and Nucleic Acid (PAN) Facility. To facilitate flexible cloning of the entire guide array and avoid hairpin formation near the Esp31 digestion site, pLentiRNAGuide_002 (Addgene #138151) was modified to remove the forward repeat region (pSLQ4419). The sequence of the high affinity 14g2a-GD2 (E101K) chimeric antigen receptor (HA-28z CAR) and the sequence of mCherry-P2A-Ruminococcus flavefaciens Cas13d (RfxCas13d) (Addgene #155305) were previously described. 7,48 The HA-28z CAR sequence was cloned into a pHR lentiviral backbone (pSLQ5263) with a constitutive SFFV promoter. The regulatable RfxCas13d-DD was constructed by fusing the destabilization domain (DD) from Escherichia coli dihydrofolate reductase (DHFR) to the C-terminus of RfxCas13d with a short glycine-serine linker.

[0230] Use the cas13 design website tool described above (see www.cas13design.nygenome.org) 50RfxCas13d spacer sequences were generated and can be found in Tables 1 and 2. The guide array constructs were cloned using the following method: For traditional restriction ligation cloning, the forward and reverse oligonucleotides for each spacer were annealed together, phosphorylated using T4 PNK (NEB), and ligated into the backbone using T4 DNA ligase (NEB). For In-Fusion HD assembly (Takara), PCR primers containing 5' and 3' homology regions 15nt to 20nt long were used to amplify the entire guide array. The PCR amplicon was then inserted directly into the backbone. For NEBuilder HiFi assembly (NEB), single-stranded oligonucleotides with 5' and 3' homology regions 20nt to 30nt long were synthesized and inserted directly into the backbone.

[0231] Longer (5-plex and 10-plex) guide arrays were cloned using a two-step overlap extension PCR method. The arrays were synthesized as single-stranded oligonucleotide fragments encoding direct repeat sequences flanked by two overlapping spacers (see Figure 5 A and Table 3). In the first PCR reaction, the oligonucleotide pairs were annealed and extended. In the second PCR reaction, the double-stranded fragments were pooled together and amplified for 15 cycles without primers. Then, forward and reverse primers containing 5' and 3' homology regions were added and amplification was continued for another 15 to 20 cycles. The PCR amplicons were run on a 2% agarose gel, purified, and inserted into the backbone using NEBuilder HiFi assembly.

[0232] Cell culture

[0233] Lenti-X 293T cells (Takara) were cultured in 0.22 μm sterile-filtered DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS). Nalm6-GD2 cells were cultured in 0.22 μm sterile-filtered complete medium (CM) [supplemented with 10% FBS, 100 U ml -1 Penicillin and 100 μg ml -1 All cells were cultured in RPMI (Gibco) containing streptomycin. All cells were cultured in a humidified incubator at 37°C and 5% CO2.

[0234] Primary human T cell isolation and expansion

[0235] Buffy coats from anonymous healthy donors were purchased from the Stanford Blood Center. Primary human T cells were isolated using the EasySep Human T Cell Isolation Kit (STEMCELL) with Ficoll-Paque PLUS (GE Healthcare) and SepMate-50 tubes according to the manufacturer's protocol. The isolated T cells were immediately plated at 4 × 10 6 to 10×106 Cells / vial were cryopreserved in FBS supplemented with 10% DMSO (Sigma) or CryoStor (STEMCELL).

[0236] Cryopreserved T cells were thawed and activated on the same day using human T activator CD3 / CD28 Dynabeads (Gibco) at a 3:1 bead to cell ratio. HTCM [0.22 μm sterile-filtered 5% FBS, 10 mM HEPES, 2 mM GlutaMAX, 100 U ml -1 Penicillin and 100 μg ml -1 T cells were cultured in AIM V (Gibco) with streptomycin. Human recombinant IL-2 (STEMCELL) was provided at 100 U / ml. On day 3 of culture, Dynabeads were removed by magnetic force. Cells were expanded every other day by adding HTCM to maintain 0.5 × 10 6 to 1×10 6 Viable cell counts were obtained using the Countess 3 automated cell counter (Invitrogen) following the manufacturer's protocol for the trypan blue exclusion method.

[0237] For culture conditions requiring trimethoprim (TMP), a concentrated stock solution of 1000 μM TMP (in DMSO) was freshly thawed and added to cells to a final concentration of 1 μM starting on day 3 of culture, unless otherwise stated. To maintain culture conditions, cells were expanded every other day in HTCM supplemented with 1 μM TMP, unless otherwise stated. To remove TMP, cells were washed twice with FACS buffer [DPBS (Gibco) supplemented with 2% FBS and 1 mM EDTA] and resuspended in fresh pre-warmed HTCM.

[0238] Lentivirus preparation

[0239] 7.5×10 5Lenti-X cells were seeded in 6-well plates containing 2ml DMEM supplemented with 10% FBS overnight. The next morning, 850μl of culture medium was removed and cells were transfected with 0.55μg pMD2.G (Addgene plasmid #12259), 1.28μg psPAX2 (Addgene plasmid #12260) and 1.79μg transfer plasmid in 426μl Opti-MEM (Gibco) using 10.88μl TransIT-LT1 (Mirus Bio). Six hours later, the culture medium was completely removed and replaced with fresh DMEM supplemented with 10% FBS and 1×ViralBoost (Alstem Bio). 24 hours after transfection, viral supernatants were collected and filtered through a 0.45μm syringe filter (MilliporeSigma). The supernatant was mixed with a lentiviral precipitation solution (Alstem Bio), incubated at 4°C for a minimum of 4 hours, and concentrated 10× to 100× in Opti-MEM according to the manufacturer's protocol. The concentrated virus was used fresh or kept frozen at -80°C for future use. Lentivirus production in 10 cm and 15 cm dishes was scaled up in proportion to the surface area of ​​the culture vessel.

[0240] Immunostaining and flow cytometry

[0241] mCherry fluorescence was used as a quantitative measure of RfxCas13d expression in all flow cytometry experiments. The 1A7 anti-14G2a idiotype antibody used to detect HA-28z CAR surface expression was coupled internally with the DyLight 650 antibody labeling kit (ThermoFisher). The following fluorescent antibodies were used to stain human T cell surface markers: [TIM3-BV421 (clone F38-2E2), LAG3-FITC (clone 11C3C65), PD-1-APC (clone A17188B), FAS-FITC (clone DX2), CTLA4-APC (clone BNI3), CD46-APC (clone TRA-2-10), CD62L-PerCP-Cy5.5 (clone DREG-56) and CD45RA-PE-Cy7 (clone HI100)] (Biolegend), [CD8-AF405 (clone 3B5)] (Invitrogen). Approximately 1×10 5 to 2×10 5Cells were resuspended in 100 μl FACS buffer and stained for 20 min at room temperature. Samples for probing CAR surface expression were stained on ice for 10 min to minimize receptor internalization. Cells were washed twice with FACS buffer before flow cytometry, which was performed on a CytoFLEX S (Beckman Coulter). For all samples, a minimum of approximately 1 × 10 4 an event.

[0242] Transduction of primary human T cells

[0243] 24 to 48 hours after bead activation, transduce primary human T cells with concentrated lentivirus at 1% to 10% v / v (unless otherwise stated). Construct expression was verified by flow cytometry on day 5 of culture as described above. For constructs requiring puromycin selection, thaw 10 μg μl -1 A concentrated stock solution of puromycin was prepared and added to cells at 1 μg ml on day 3 of culture (24 h to 48 h after transduction). -1 Puromycin selection was completed on the 5th day of culture.

[0244] Cell sorting

[0245] On day 5 of culture, primary human T cells were spun down and cultured at 1 × 10 7 to 2×10 7 Resuspended in ice-cold FACS buffer at a concentration of 10 cells / ml. Cells were sorted in "semi-pure" or "pure" mode using a 130 μm chip at low sample pressure on a Sony SH800 sorter (Sony Biotechnology). RfxCas13d was measured using mock untransduced T cells. + / – Gating. + The cells were sorted into collection tubes containing cold HTCM. After sorting, the cells were spun down and resuspended in 4% paraformaldehyde supplemented with 100 U ml -1 IL-2 in fresh pre-warmed HTCM to reach approximately 3 x 10 5 to 5×10 5 After sorting, cells were expanded as described above.

[0246] RNA extraction and quantitative reverse transcription PCR (RT-qPCR)

[0247] The RNEasy Plus kit (QIAGEN) was used according to the manufacturer's protocol with additional 2-mercaptoethanol, starting from approximately 1 × 10 6 to 10×10 6Total RNA was extracted from primary human T cells. RNA concentration was measured using NanoDrop One (Thermo Fisher) and normalized for all cell samples, followed by reverse transcription using the iScript cDNA Synthesis Kit (Bio-Rad). Diluted cDNA was added to iTaq Universal SYBR Green Supermix (Bio-Rad) and run on a CFX384Touch (Bio-Rad) using the following PCR conditions: 50°C for 10 min, 95°C for 30 s, 40× (95°C for 10 s, 60°C for 30 s). Gene expression was measured using 2 SDHA as an internal control. –ΔΔCt Method Quantification. Primer sequences can be found in Table 3.

[0248] Main body RNA-seq and differential expression analysis

[0249] On the 10th day of culture, about 5 × 10 6 Total RNA was extracted from primary human T cells as described above. Main RNA-seq was performed on an Illumina NovaSeq 6000 by Novogene (Davis, CA), with 20 × 10 6 to 30×10 6 150bp paired reads. 81 Transcript abundance was quantified from raw reads. Differential expression analysis was performed using custom scripts in R (version 4.1.2): 82 Import quants and use DESeq2 83 Batch calibration and analysis using apeglm 84 The resulting log2 fold changes were scaled down and visualized using ggplot2.

[0250] Design and assembly of pooled dual-prime array libraries

[0251] Based on the results of previous CRISPR-Cas9 proliferation and functional knockout screens in primary human T cells, a custom, curated library of 24 putative depletion-associated genes was designed (see Table 3). As described above, the cas13 design tool was used. 50, three top-ranked 23nt guide spacer sequences were generated for each gene, which targeted the broadest range of CDSs of human transcript homologues, resulting in a total of 72 targeted guide spacers. In addition, 8 23nt random non-targeted guide spacers were generated that were not aligned with the human transcriptome (as confirmed by nucleotide BLAST). A total of 80 guide spacers were generated. A custom Python script was used to concatenate the RfxCas13d forward repeat sequence to the spacer sequence and output all paired guide array combinations, resulting in 80×80=6,400 dual guide array sequences (see Table 3). Flanking 5' and 3' homology regions were added to facilitate insertion into the pSLQ4419 backbone as described above. The guide array library was synthesized as a single-stranded oligonucleotide pool (TwistBioscience), and 10 ng of template was amplified using the following PCR conditions using KAPA HiFi HotStart (Roche): 95°C for 3 min, 8× (98°C for 20 s, 55°C for 15 s, 72°C for 15 s), and 72°C for 1 min. The reaction products were recovered using the NucleoSpin PCR Cleanup Kit (Macherey-Nagel) and run on the 2100 Bioanalyzer (Agilent) at the Stanford PAN facility for size determination and quantification (85% dual guide array) and quality control (minimal PCR overamplification). The amplified library was efficiently cloned into pSLQ4419 (Esp31) with less than 5% background using NEBuilder HiFi DNA assembly, and the variable spacer region matching the nucleotide distribution of the library was confirmed by Sanger sequencing. Minimal bias was further verified by Miseq v3 600-cycle paired-end sequencing (Illumina). 85 The complete library representation of (Gini coefficient: 0.146, 90th percentile / 10th percentile of guide array reads: 1.96, see Fig.10 A).

[0252] CD8+CAR T cell proliferation screening

[0253] Thaw 8×10 7 Primary human T cells (adjusted CD4 + With CD8 + The ratio was 1:1) and activated on the same day with 3:1 CD3 / CD28 Dynabeads as described above. + T cells and CD4 + T cells were supplemented with 100 U ml -1On the first day of culture, cells were co-transduced with the following freshly harvested and 100× concentrated lentivirus (prepared with endotoxin-free plasmid DNA as described above): 2% v / v mCherry-P2A-RfxCas13d, 1.5% v / v HA-28z CAR, and 0.2% v / v pooled dual-guide array library. On the third day of culture, cells were transduced with 1 μg ml -1 Puromycin selected cells. Approximately 28.9% of cells survived puromycin selection, corresponding to approximately 83.9% single lentiviral integration (assuming independent transduction events following a Poisson distribution). On day 5, a portion of cells was stained and flow cytometry was used to measure HA-28z CAR and CD8 expression to determine CAR + CD8 + The total percentage of T cells. This percentage has an impact on the subsequent RfxCas13d + FACS of cells plays a role and ensures that sufficient number of cells are sorted to achieve CAR + CD8 + Approximately 1000× library coverage within the T cell subset population. After sorting, cells were divided into two replicates with approximately 1000× representation and expanded every other day as described above. On days 11, 13, and 15 of culture, a portion of the cells were stained and analyzed by flow cytometry to determine CD8 + 、RfxCas13d + and CAR + After flow cytometry, CD8 + T cells were harvested at approximately 1000× using the EasySep Human CD8 Positive Selection Kit (STEMCELL). Proliferation screening was terminated after 15 days of ex vivo expansion.

[0254] Genomic DNA extraction and library preparation

[0255] CD8 + T cell genomic DNA (gDNA) was extracted. The cells were lysed using Buffer AL and spun down at maximum speed for three minutes to pellet the positive selection beads. The cell lysate supernatant was then carefully transferred to a clean tube and followed by the manufacturer's gDNA isolation protocol.

[0256] Dual-guide array libraries were prepared for next-generation sequencing by a two-step PCR protocol. Briefly, PCR1 primers targeted and amplified the lentiviral integrated guide array sequences, appended Illumina sequencing primer binding sites, and increased the overall sequence diversity of the amplicons with eight custom staggered sequences to improve cluster identification. PCR2 primers appended a dual-end index for sample identification and contained Illumina P5 / P7 sequences for binding to the flow cell. The primer sequences for both PCR1 and PCR2 can be found in Table 3. For each collected sample, a total of approximately 40 μg gDNA (6 μg gDNA corresponds roughly to 1×10 6 cells): A maximum of 2 μg of gDNA template was amplified per 50 μl reaction using the following cycling conditions: 95°C 3min, 24×(98°C 20s, 70°C 15s, 72°C 15s), 72°C 1min. A 200ng plasmid DNA (pDNA) library was also amplified by PCR1. PCR1 products were pooled together by sample and column purified. Approximately 10ng of each purified PCR1 product was loaded as template DNA for PCR2 using the following cycling conditions: 95°C 3min, 12×(98°C 20s, 65°C 15s, 72°C 15s), 72°C 1min. All reactions were set up using KAPA HiFi HotStart (Roche). PCR2 products were run on a 2% ultrapure agarose gel (Invitrogen), bands were gel extracted using a Nucleospin gel cleanup kit (Macherey-Nagel), and DNA was quantified on a Qubit fluorometer (Invitrogen).

[0257] Screening readout and analysis

[0258] CRISPR-guided array enrichment was read out via pooled Miseq v3 600-cycle paired-end sequencing (Illumina). Samples were accurately identified based on paired-end indexes. Raw fastq files were trimmed for 5' and 3' adapters and filtered by quality (-q 30) and length using cutadapt. End-to-end alignment was performed using bowtie2 86 Processed reads were aligned to a custom index constructed from a reference library of all dual-prime arrays combined. Primer array counts were generated from the alignment data using samtools.

[0259] Screening data were analyzed using the DESeq2 negative binomial distribution model within a custom R script. Technical replicate pair correlations were assessed by linear regression of normalized replicate count data. Significant guide array enrichment and depletion were analyzed via pairwise comparisons using the Wald test to calculate log2 fold changes and adjust p-values ​​for each guide array. Based on previously described methods 87Log2 fold changes were determined by comparing array abundance in collected cell samples (collected on day 11, 13, or 15 of culture) to array abundance in the original plasmid DNA preparation as the starting time point. Likelihood ratio tests were performed by comparing the full (~time point) model and the reduced (~1) model. These results were used to rank the guide arrays based on how significantly their count changes across samples were attributed to the (reduced) time point variables. Robust ranking aggregation using guide-level Wald test results 88 Significant gene-level enrichment and depletion were determined. Data were visualized using ggplot2 and gene-level hierarchical clustering was performed using pheatmap.

[0260] Cytokine secretion

[0261] On day 10 of culture, primary human T cells and GFP + Nalm6-GD2 cells were spun down and resuspended in fresh pre-warmed CM. 1 × 10 5 GFP + Nalm6-GD2 cells were seeded in a clear flat-bottom 96-well plate and incubated with 1 × 10 5 Primary human HA-28z CAR T cells were co-cultured. Three replicate wells were plated for each condition. After 24 hours, the plates were spun down and the co-culture supernatants were collected for immediate analysis or frozen at -80°C. Cytokine concentrations were measured using IFNγ or IL-2 ELISA Max kits (Biolegend) according to the manufacturer's protocol.

[0262] Tumor killing and serial restimulation

[0263] In vitro tumor killing and serial restimulation assays were performed on an IncuCyte S3 (Sartorius). On day 10 of culture, primary human T cells and GFP + Nalm6-GD2 cells were spun down and resuspended in fresh pre-warmed CM. 5 × 10 4 GFP + Nalm6-GD2 cells were seeded in clear flat-bottom 96-well plates and co-cultured with primary human HA-28zCAR T cells in a total volume of 200 μl of CM at different effector:target (E:T) ratios as indicated in the figure legend. Three replicate wells were plated per condition and four images per well were acquired over a total of 48 to 72 hours. The total integrated GFP intensity per well was used as a quantitative GFP + Metrics of Nalm6-GD2 cells. All values ​​were normalized to the corresponding initial scan and plotted over time using IncuCyte analysis software. For continuous restimulation experiments, GFP +Nalm6-GD2 and HA-28z CAR T cells were co-cultured as described above. 48 to 72 hours after the initial stimulation, the remaining cells were spun down, resuspended in fresh pre-warmed CM, counted, and cultured with an additional 5 × 10 4 GFP + Nalm6-GD2 were co-cultured at different E:T ratios as described above. This process was repeated twice for a total of three stimulations.

[0264] Detection of metabolites in cell culture media

[0265] On the 10th day of culture, 5×10 4 Primary human HA-28z CAR T cells were seeded in a flat-bottom 96-well plate in a total volume of 200 μl without phenol red and supplemented with 100 U ml -1 AIM-V (Gibco) for IL-2. ATP (Sigma) was added to a final concentration of 20 μM. Cells were incubated at 37°C and 5% CO2 for one hour (unless otherwise stated). Cells were then spun down and culture supernatants were collected for immediate analysis using ATP (Promega), AMP (Promega) and adenosine (Abcam) detection kits according to the manufacturer's protocol.

[0266] Data representativeness

[0267] Use ggplot2 to create box plots and violin plots, and each sample represents at least about 1 × 10 4 cells. Box plots indicate median and first and third quartiles. Whiskers extend from the box to no more than 1.5 × the distance between the first and third quartiles. Unless otherwise stated, all bar graphs show the mean and standard deviation of replicates plotted as dots.

[0268] Statistical analysis

[0269] Unless otherwise stated, statistical analysis of significance between groups was performed using ordinary or repeated measures one-way ANOVA and correction for multiple comparisons (using Dunnett's test) in GraphPad Prism 9. Linear regression analyses were performed in R or in GraphPad Prism 9.

[0270] result

[0271] Development of Cas13d for optimal expression and activity in primary human T cells

[0272] The CRISPR / Cas13d system derived from Ruminococcus xanthus XPD3002 (RfxCas13d) exhibits excellent catalytic activity and targeting specificity in mammalian cells 42,48We initially demonstrated the functional activity of lentivirally integrated RfxCas13d in primary human T cells by characterizing crRNA-guided knockdown of a transgenic GFP reporter ( Figure 8 AB). We then sought to target endogenous genes associated with T cell depletion in HA-28z CAR T cells. Antigen-independent clustering of HA-28z CAR resulted in tonic signaling and depletion-associated reprogramming, including upregulation of inhibitory receptors LAG3, PD-1, and TIM3 on day 10 of ex vivo culture. 7 Previous studies have demonstrated that blocking these typical markers of wasting has clinical implications. 49 Therefore, we hypothesized that MEGA HA-28z CAR T cells co-expressing RfxCas13d and targeted guide RNA arrays could simultaneously inhibit the upregulation of LAG3, PD-1, and TIM3 ( Figure 1 A) We first designed three single guides for each gene 50 The knockdown efficiency was evaluated by flow cytometry on day 10, and the corresponding surface expression of LAG3 / PD-1 / TIM3 was determined compared with the non-targeting control guide. Figure 8 CD). Using the bicistronic CRISPR system, we observed limited knockdown in three different donors due to inefficient lentiviral transduction of RfxCas13d ( Figure 8 E). Interestingly, we found that all bicistronic configurations resulted in low functional viral titers due to either RfxCas13d array processing of lentiviral RNA during packaging (in the forward direction) or crRNA-guided cleavage (in the reverse direction) ( Figure 8 FG). Guided by these data, we established an optimized workflow for manufacturing MEGA HA-28z CAR T cells, in which primary human T cells were co-transduced with separate RfxCas13d and HA-28z CAR constructs prior to transduction with crRNA constructs ( Figure 1 B, Figure 8 HI).

[0273] MEGA CAR T cells robustly and specifically suppress upregulation of typical exhaustion markers driven by tonic signaling

[0274] To evaluate whether the optimized MEGA HA-28z CAR T cells could inhibit the upregulation of LAG3, PD-1, and TIM3, we isolated primary T cells from multiple healthy blood donors and co-transduced the cells with RfxCas13d and HA-28z CAR constructs. One day later, we transduced the cells with 1) a single guide targeting each receptor, 2) a dual guide array targeting all pairwise combinations of receptors, or 3) a non-targeting control guide. This sequential transduction process ensured that RfxCas13d and CAR expression were consistent in all experimental conditions. We then sorted RfxCas13d using the co-expressed mCherry as a marker on day 5. + Cells were cultured and the receptor surface expression was measured by flow cytometry on day 10 ( Figure 1 B). As previously reported, we observed robust upregulation of LAG3 / PD-1 / TIM3 in HA-28z CAR T cells expressing a non-targeting guide compared to mock-untransduced T cells ( Figure 1 C). Single-guide and dual-guide arrays specifically inhibited upregulation of each targeted receptor to near baseline levels. These results were consistent in independent experiments with multiple donors ( Figure 1 D).

[0275] To confirm that inhibitory receptor repression at the protein level was due to RfxCas13d activity at the transcript level, we isolated bulk RNA from MEGA HA-28z CAR T cells at day 10 and quantified the abundance of LAG3, PDCD1 (PD-1), and HAVCR2 (TIM3) mRNA transcripts relative to non-targeting controls using quantitative reverse transcription-PCR (RT-qPCR). Figure 1 E, Fig. 9 A). We observed a strong correlation between transcript abundance and surface protein expression in all samples. Interestingly, we noticed a spacer-dependent position effect within the dual-guide array. While the LAG3-targeted spacer showed efficient knockdown regardless of array position, the PD-1 and TIM3-targeted spacers were generally more efficient at the 3' proximal position. The knockdown efficiency of the LAG3 and TIM3 spacers was also more robust across donors than the PD-1 spacer, which could be attributed to a narrower and more variable dynamic range of PD-1 upregulation across donors, or to a suboptimal PD-1 spacer sequence.

[0276] To assess potential transcriptome-wide off-target and / or by-pass effects, we performed bulk RNA-Seq on RNA extracted from day 10 MEGA HA-28zCAR T cells generated from two donors. Recent studies have questioned whether RfxCas13d by-pass activity correlates with on-target transcript cleavage activity in mammalian cells.51-53 Therefore, we chose to analyze LAG3, TIM3, and LAG3+TIM3 targeting guides because they showed the greatest knockdown efficiency on the donors. We identified significant on-target knockdown of LAG3 and / or HAVCR2 transcripts in all samples compared to non-targeted controls, with no significant (adjusted p-value < 0.001) off-target activity detected ( Figure 1 F) We did not observe activation of the interferon pathway in response to crRNA expression or target RNA cleavage 54 Of note, we also did not observe an effect on off-target protein levels, as CAR surface expression was consistent in all targeted and non-targeted samples ( Fig. 9 B).

[0277] We next constructed triple-guide arrays encoding all unique permutations of LAG3 / PD-1 / TIM3 targeting spacers to simultaneously knock down all three inhibitory receptors in MEGA HA-28z CAR T cells. All triple-guide arrays were able to suppress upregulation of depletion markers measured by flow cytometry on 2 to 3 different donors ( Figure 1 G, Fig. 9 C). Transcript abundance strongly correlates with surface protein expression ( Figure 1 H, Fig. 9 D), and CAR expression was consistent in all samples, as expected ( Fig. 9 E). Certain spacer configurations exhibited more robust triple knockdown efficiencies than others, and this pattern was consistent with the positional dependence observed in the dual-guide array experiments. To examine whether triple knockdown occurred at the single-cell level, we gated LAG3 + / - PD-1 + / - TIM3 + / - Flow cytometry data of all combinations of cells on day 10 ( Figure 1 I, Fig. 9 F to Fig. 9 G). We observed a decrease in the triple-positive population from 35.01% in the non-targeted control to 5.46% in the cells expressing the best triple-guide array (LPT), while the triple-negative population increased from 15.80% to 55.09%. This suggests that MEGA can achieve highly multiplexed gene knockdown in primary human T cells.

[0278] MEGA facilitates two-dimensional genetic screening and identifies novel pairs of proliferation regulators in models of CD8+ CAR T cell dysfunction

[0279] Although CRISPR / Cas9 screens have identified individual genes that suppress T cell antitumor activity, little is known about the complex network of genetic interactions and the broader genetic programs that implement T cell dysfunction and exhaustion. Combinatorial CRISPR screens that perturb multiple genes per cell provide a powerful approach to decode these interactions, although such studies have not been performed before in primary human T cells. 55,56 .

[0280] The programmable targeting specificity of the MEGA platform is highly amenable to combinatorial CRISPR screening when combined with efficient multiplexing, and the compact guide array allows for easy deconvolution of the perturbation information in each cell. We hypothesized that co-expression of RfxCas13d and a pooled guide array library would enable us to perform systematic pairwise genetic perturbations in primary human T cells. We applied this technology in a proof-of-concept study to identify functionally dysregulated CD8 + A novel combination of putative depletion-related genes for HA-28zCAR T cell proliferation ( Figure 2 A). We initially curated a list of 24 genes based on previous CRISPR-Cas9 knockout studies in primary human CD8+ T cells (see Table 3). We then designed and assembled a custom library of 5,184 dual-guide arrays targeting all 576 pairwise combinations of these genes ( Fig.10 A, Methods, Table 3). Each targeted guide was also paired with a set of 8 randomly generated non-targeted guides to simulate an additional 1,152 "single" guide interferences. Finally, as a control, we included 64 pairs of non-targeted guides for a total of 6,400 unique guide arrays. We used a heuristic screening approach, which did not require prior functional validation of the targeted guides.

[0281] Briefly, we transduced T cells isolated from a single healthy donor with RfxCas13d, HA-28z CAR, and a pooled dual-guide array library ( Figure 2 A, Fig.10 B, see Methods). Cells were sorted on day 5 for RfxCas13d expression and split into two replicates to account for technical variations in culture conditions and downstream processing. Cells were cultured in parallel for two weeks, and HA-28Z tonic signaling drove both T cell expansion and subsequent dysfunction. Samples were then collected on days 11, 13, and 15 of culture, and CD8 + T cells. We quantified guide array abundance by PCR amplification and deep sequencing of guide array expression cassettes. Unlike multiplexed Cas9 screens in cancer cell lines, which require multiple reads and complex barcoding schemes to accurately identify guide pairings, 55), our method readily identifies paired sequences without barcoding by directly sequencing the compact RfxCas13d guide arrays in single reads. Full library coverage is supported by strong replicate correlation and non-zero counts for all guide arrays across all samples ( Fig.10 CD).

[0282] We performed pairwise statistical tests to determine whether guide arrays were significantly enriched (targeting pairs of negative regulators of proliferation) or depleted (targeting pairs of genes essential for proliferation) between early and late screening time points ( Figure 2 BC). We identified many guide arrays that were consistently positively or negatively selected in proliferating HA-28z CAR T cells in replicates. As expected, non-targeted control arrays were neither enriched nor depleted. With the exception of guides targeting IRF4, JUNB, and CBLB, which had observable dominant negative effects, single interferences (those paired with non-targeting spacers) generally resulted in weaker proliferative effects than dual interferences. Due to the design of our library, we were initially surprised by the robust depletion of these guides. However, previous studies have shown that despite their established roles in driving T cell dysfunction, transcription factors IRF4 and JUNB are also critical for the expansion and persistence of T cells 7，31，35，57 In cases of CAR T dysfunction, such as CBLB (a negative regulator of T cell signaling 14 The function of genes in the CAR T cell population warranted further investigation - we noted that the CBLB-1 spacer appeared to have a dominant negative effect, while the CBLB-2 and CBLB-3 spacers were enriched in certain guide combinations. Highly enriched dual arrays frequently included FAS (e.g., in combination with ZC3H12A, CTLA4, or SOCS1), which is supported by previous work implicating FAS as a negative regulator of CAR T cell activity via activation-induced cell death. 58，59 We also observed an effect of guide array position consistent with our previous results, allowing us to sample from a larger perturbation space in which the relative level of repression between two target genes can vary. We compiled guide array data and observed comparable results across a wider range of gene-level interactions ( Fig. 9 EF). Finally, we ranked guide arrays with the most significant count changes across all screening time points, as determined by likelihood ratio tests, and identified top hits consistent with pairwise analysis ( Figure 2 D).

[0283] We selected the set of top ranked guide array hits for functional validation based on both guide and gene level data ( Figure 2E). We generated MEGA HA-28z CAR T cells from 3 to 4 different blood donors and individually perturbed one of the 7 significantly enriched gene pairs or one of the 2 significantly depleted gene pairs. We followed T cell expansion in culture until day 15 and calculated normalized CD8 + Fold change amplification ( Figure 2 F, Fig.11 A) Paired perturbations modulate T cell expansion in culture and in CD8 + The screening results were reproduced in both WT and host T cells ( Figure 2 F, Fig.11 AC). Thus, we also noticed that RfxCas13d was expressed in the host T cells expressing the depleted array at day 5. + The population was significantly smaller (despite consistent CAR expression), suggesting that dysregulation of proliferation is rapid and occurs within 48 hours of transduction ( Fig.11 To explore whether differences in proliferation could be explained by altered T cell differentiation, we measured surface CD62L / CD45RA expression on day 10 ( Fig.11 FG). The effector memory phenotype was more abundant in CAR T cells expressing the enriched guide array (+12% when targeting CBLB+FAS), whereas the depleted guide array inhibited effector differentiation and biased cells toward central memory (+26.4% when targeting TOX2+JUNB) and stem cell memory (+19.3% when targeting PDCD1+IRF4). Paired transcriptomic perturbations enhance the antitumor activity of dysfunctional CAR T cells

[0284] Encouraged by our validation experiments, we next investigated whether the top paired screening hits could improve not only the proliferative potential of dysfunctional CAR T cells but also their antitumor activity. We performed a small-scale secondary screen of the top enriched guide arrays using in vitro cytokine secretion and cytotoxicity in response to antigen-positive tumors as functional readouts ( Figure 3 A). On day 10 of culture, we incubated MEGA HA-28z CAR T cells with Nalm6 leukemia cells expressing GD2 (Nalm6-GD2) and measured the levels of IFN-γ and IL-2 in the co-culture supernatants 24 h later ( Figure 3 BD, Fig.12AB). The forward guide array robustly enhanced IFN-γ secretion in tonic signaling CAR T cells with and without antigen stimulation, while IL-2 secretion was modestly improved after antigen stimulation. To evaluate MEGA CAR T cell cytotoxicity, we used live cell imaging to monitor Nalm6-GD2 abundance within co-cultures over a 48- to 72-hour time period. Across multiple donors and effector:target ratios, the forward guide array significantly improved the tumor killing capacity of dysfunctional CAR T cells compared to nontargeted controls ( Figure 3 EF, Fig.12 C). This was particularly evident when repeated antigen stimulation in serial re-challenge assays (paired knockdowns) of CBLB and FAS enhanced the robust and durable anti-tumor responses of exhausted CAR T cells when compared to non-targeted controls that failed to control tumor growth ( Figure 3 EG). We hypothesized that dual targeting of CBLB and FAS improves CAR T cell activity through potential synergistic disruption of two orthogonal pathways known to negatively regulate T cell activation. 14，59，60 ( Figure 3 H).

[0285] MEGA enables rapid, tunable, and reversible perturbation of the T cell transcriptome

[0286] In early experiments, we noted that transcript knockdown in cells expressing targeted crRNAs was completely dependent on RfxCas13d expression ( Fig.13 A). Based on this data, we were interested in whether modulating the levels of RfxCas13d could achieve tunable and reversible control of the T cell transcriptome. To complement the rapid timescale over which RfxCas13d-mediated RNA degradation occurs, we fused the destabilization domain (DD) from Escherichia coli dihydrofolate reductase to the C-terminus of RfxCas13d ( Figure 4 A) At steady state, the regulatable RfxCas13d-DD is rapidly degraded by the proteasome due to the disordered DD. 61 In the presence of the FDA-approved small-molecule antibiotic trimethoprim (TMP), the tertiary structure of DD was stabilized, allowing RfxCas13d-DD to bind and target RNA.

[0287] We initially demonstrated that RfxCas13d-DD protein expression is regulated by the presence of TMP in primary human T cells by intracellular FLAG-tagged RfxCas13d staining ( Fig.13B). To characterize the activity and dynamic range of RfxCas13d-DD for endogenous gene repression, we generated MEGA T cells expressing RfxCas13d-DD and either a guide targeting CD46 (a ubiquitous surface protein) or a non-targeting guide. After co-transduction, we cultured MEGA T cells in the presence or absence of TMP for 48 h and measured CD46 surface expression on day 5. MEGA T cells conditionally inhibited CD46 in a TMP-dependent manner, remained fully functional in the presence of the drug, displayed minimal leaky activity in its absence, and did not alter guide targeting specificity ( Figure 4 B).

[0288] Next, we investigated whether we could reverse gene repression in MEGA T cells. After transduction with RfxCas13d-DD and CD46-targeting or non-targeting guides, we cultured MEGA T cells in the presence or absence of TMP. On day 5, we removed or added TMP, respectively. We then used flow cytometry to track surface CD46 expression over 72 h, whereby we observed rapid kinetics of both induction and reversal of CD46 downregulation, and further confirmed that gene repression was completely reversed to baseline (pre-induction) levels after TMP removal ( Figure 4 C, Fig.13 C) Reversal of RfxCas13d activity is faster than induction, where t 1 / 2 = 21.36 hours or t after TMP addition 1 / 2 = 23.71 hours. To further characterize the rate of target inhibition after induction with TMP, we measured the kinetics of CD46 protein degradation in primary human T cells. We used cycloheximide (CHX) to transiently block protein translation and performed flow cytometric tracking assays. However, CD46 is highly stable and does not reach half-maximal expression before T cell apoptosis ( Fig.13 D) By fitting our data to an exponential decay curve, we expect t 1 / 2 = 20.74 hours, indicating that gene repression occurs almost immediately after TMP addition.

[0289] Having established clean and reversible binary (ON / OFF) gene regulation, we next sought to quantitatively modulate CD46 surface expression by controlling the dose of TMP administered to MEGA T cells. We performed TMP titration experiments and characterized the CD46 dose response using flow cytometry ( Figure 4DE). We observed a sigmoidal response curve and found that TMP-dependent regulation of CD46 surface expression was very sensitive, with a simulation-like (observed Hill coefficient = -1.425) linear dose response regime from approximately 1 nM to 100 nM.

[0290] We used our inducible RfxCas13d-DD to further investigate whether there were by-pass effects in our system that affected off-target protein expression or cell viability (as reported by others). 51-53 Although increasing concentrations of TMP resulted in increased on-target cleavage activity of RfxCas13d-DD, as measured by decreased CD46 expression, mCherry expression and cell viability were not affected ( Fig.13 E).

[0291] The ability of RfxCas13d to cleave and process the guide array is determined by the HEPN-2 domain located at the C-terminus of the protein 44 To assess whether our C-terminal RfxCas13d-DD fusions could still process guide arrays for drug-regulatable multiplexed knockdown, we extended the system to our approach for inhibiting inhibitory receptor upregulation in dysfunctional CAR T cells. We expanded MEGA HA-28z CAR T cells expressing a triple guide array targeting LAG3 / PD-1 / TIM3 in culture with varying concentrations of TMP for 10 days and measured surface depletion marker expression by flow cytometry ( Figure 4 F). RfxCas13d-DD retains native array processing capabilities and is able to simultaneously suppress all targeted depletion markers in a dose-dependent manner with knockdown efficiencies that are highly comparable to those of the constitutive RfxCas13d system ( Figure 1 G).

[0292] Dynamic regulation of CAR proximal signaling modulates MEGACAR T cell activity and function

[0293] Recent studies from our group and others have shown that the safety and efficacy of CAR T cells can be improved by engineering new CAR designs that achieve synthetic (exogenous) activity control at the protein level. 46，62，63 Taking a receptor-independent approach to modulating CAR activation, we decided to utilize our inducible system to target the proximal signaling proteins LCK and ZAP70, which direct antigen recognition signals to downstream T cell activation circuits using a multiplexed guidance array (termed the “PROX array”). Figure 4G). By titrating the level of LCK and ZAP70 double knockdown using different TMP doses, we reasoned that given a strong input signal (e.g., in the presence of an electronic amplitude limiter), we could adjust the upper limit of CAR activation. Indeed, when stimulated with antigen-positive Nalm6-GD2 tumor cells, MEGA HA-28z CAR T cells showed a dose-dependent decrease in IL-2 secretion with increasing amounts of TMP in culture ( Figure 4 H).

[0294] We next evaluated the efficiency of tonic signal attenuation by measuring the expression of the T cell activation marker CD69 on MEGA HA-28z CAR T cells after 10 days of culture. In cells expressing the PROX array, the proportion of CD69+ cells decreased linearly with increasing levels of TMP (from approximately 1 nM to 100 nM), whereas cells expressing a non-targeting control remained unchanged ( Figure 4 I). To examine off-target effects, we also quantified CD3 expression, which did not change significantly with added TMP in either group ( Figure 4 J). Finally, we measured levels of PD-1, TIM3, and LAG3 relative to nontargeted and mock controls and observed a drug-dependent reduction in the surface phenotype of depleted T cells ( Figure 4 K). Taken together, these data demonstrate the ability of MEGA to fine-tune the amount of CAR signaling that can be transduced to downstream activation pathways by enforcing specific steady-state levels of LCK and ZAP70.

[0295] Large-scale multiplexed knockdown enables robust perturbation of distinct gene sets in primary human T cells

[0296] We next sought to expand MEGA to higher-order multiplexing and target diverse gene sets involved in suppressing T cell function in the context of antitumor immunity. To this end, we designed a simple two-step cloning protocol that enables rapid and precise assembly of RfxCas13d guide arrays of arbitrarily long lengths ( Figure 5 A, see Methods). We used this approach to construct novel multiplexed arrays, which we then expressed in MEGA HA-28z CAR T cells to assess knockdown of targeted gene sets at the RNA level.

[0297] We first targeted lactate metabolism, which has been proposed as a strategy to regulate T cell fitness and function. 64，65We assembled a 3-fold guide array (“LAC array”) targeting PDK1 (an inhibitor of pyruvate to acetyl-CoA conversion) and the lactate dehydrogenase isozymes LDHA and LDHB by screening three different spacers per gene and concatenating the best spacers ( Figure 5 B, Fig.14 A). Notably, most of the spacers we tested resulted in significant gene repression, highlighting the overall robustness of RfxCas13d activity. We then expanded MEGA HA-28z CAR T cells expressing the LAC array or a non-targeting control in culture for 10 days. We analyzed transcript data by RT-qPCR on day 10 and observed significant upregulation of LDHA and LDHB in the non-targeting control. On the other hand, cells expressing the LAC array significantly repressed LDHA, LDHB, and PDK1 to below baseline levels ( Figure 5 C).

[0298] Previous work has shown that inhibiting the PI3K / Akt axis in T cells with small molecule inhibitors can enhance their stemness and anti-tumor activity. 66 Based on these findings, we were interested in whether we could also use MEGA to inhibit PI3K / Akt signaling and downstream glycolytic metabolism in a specific and cell-intrinsic manner. We constructed a 4-plex array (“GLY array”) targeting the two major isoforms of AKT (AKT1 and AKT2) and the two major hexokinase isozymes (HK1 and HK2) expressed in human T cells ( Figure 5 D).

[0299] After expansion of MEGA HA-28z CAR T cells in culture for 10 days, we measured RNA levels and observed robust upregulation of AKT1, AKT2, and HK2 in tonic signaling CAR T cells consistent with activation of PI3K and increased glycolysis ( Figure 5 E) Expression of the GLY array counteracts this upregulation, as demonstrated by significant knockdown of all four targeted transcripts in the gene set.

[0300] Our group recently found that targeting MED12, a core component of the Mediator kinase module (CKM), via CRISPR / Cas9 knockout improves T cell effector function 19 As an alternative strategy, here we designed a guide array (“CKM array”) targeting all four components of CKM: MED12, MED13, CCNC, and CDK8 ( Figure 5F). Notably, although the CKM module was upregulated in HA-28z CAR T cells compared to mock-resting cells at day 10 of culture, cells expressing the CKM array showed significant knockdown of all four genes below baseline levels ( Figure 5 G).

[0301] After successfully demonstrating robust knockdown of multiple three- and four-gene sets, we further scaled up multiplexing to explore potential limits on the number of genes that can be targeted in parallel. We decided to target the surface protein group (surfaceome) of depleted CAR T cells due to the abundance of unique and functional surface proteins with proven clinical relevance. We constructed a 5-fold array ("SURF1 array") by adding two new spacers targeting FAS59 and CTLA467 to our earlier guide array targeting depletion markers LAG3, PDCD1, and HAVCR2. We generated MEGA HA-28z CAR T cells expressing the SURF1 array and observed significant knockdown to baseline levels or lower (0.1% vs. 0.2% on all 5 targeted transcripts compared to non-targeted controls) on day 10 of culture. Figure 5 H).

[0302] Finally, to stress-test the multiplexing capabilities of our system, we constructed a 10-redirected array targeting the following ten genes (the "SURF2 array"): LAG3, FAS, CD568, ENTPD169, CD4670, TRAC, B2M, CTLA4, PDCD1, and HAVCR2. We isolated bulk RNA from day 10 MEGA HA-28z CAR T cells expressing the SURF2 array and quantified transcript abundance for all ten genes compared to non-targeted controls ( Figure 5 H). Notably, 8 of the 10 genes had significant transcript knockdown without prior optimization of spacer sequence or position. Because RfxCas13d is a shared resource across ten different crRNAs, we expected the SURF2 array to show lower knockdown efficiency than SURF1 due to competition between guides for limited Cas13 protein, as noted in previous retrospective studies of Cas9. 40，58 Indeed, for all genes targeted in the SURF1 array, we observed slightly lower knockdown efficiency for SURF2. However, we did not observe any correlation between RfxCas13d activity and target transcript abundance for all gene sets we perturbed using MEGA ( Fig.14B) Overall, our data highlight the power of MEGA to knockdown putative functional gene sets ranging from 3 to 10 targets at a time and provide a powerful approach to study unexplored protein complexes and pathways in primary human T cells.

[0303] Global disruption of purinergic signaling modulates environmental metabolic flux and improves effector function in dysfunctional CAR T cells

[0304] Solid tumors remain challenging for T cell-based therapy, in part due to the accumulation of immunosuppressive metabolites such as adenosine (ADO) in the tumor microenvironment. 71 Although both ATP and ADO are present at high (micromolar) levels in the solid tumor environment 72 However, the purinergic pathway rapidly converts the inflammatory ATP signal into the immunosuppressive ADO signal through a cascade of enzymatic reactions involving four key surface proteins: CD39, CD73, and the adenosine receptors A2AR and A2BR ( Figure 6 A).

[0305] Having established a robust gene set perturbation approach, we wanted to explore whether disrupting the entire purinergic signaling cascade using our platform would slow down ADO production while accumulating ATP to enhance the antitumor activity of dysfunctional CAR T cells. We constructed a four-gene guide array (PURI array) targeting ENTPD1 (CD39), NT5E (CD73), ADORA2A (A2AR), and ADORA2B (A2BR) ( Figure 6 B). To validate array functionality, we generated MEGA HA-28z CAR T cells expressing the PURI array or non-targeting guides and analyzed RNA transcript abundance at day 10 of culture. We observed significant knockdown of all four targeted transcripts, as measured by RT-qPCR ( Figure 6 C). We next performed ATP spike-in experiments to measure the extracellular concentrations of ATP, AMP, and ADO and assess whether the PURI array modulates metabolic flux within the pathway ( Figure 6 DF). MEGA HA-28z CAR T cells expressing the PURI array accumulated significantly more ATP and produced significantly less AMP and ADO than non-targeted controls. We also measured ATP and AMP levels at regular time intervals to calculate the effective rate constant ( Figure 6 GH). Expression of the PURI array significantly slowed ATP hydrolysis and AMP production compared to non-targeted controls.

[0306] Encouraged by these results, we established a co-culture assay with Nalm6-GD2 tumor cells to investigate whether disruption of the purinergic pathway could improve effector function in dysfunctional CAR T cells. Although we did not observe significant changes in cytokine secretion from baseline tonic signaling, MEGA HA-28z CAR T cells stimulated with antigen expressing the PURI array secreted significantly greater amounts of both IFN-γ and IL-2 compared to non-targeting controls ( Figure 6 IJ). In addition, PURI array knockdown significantly enhanced tumor killing as well as T cell activation and proliferation in response to antigen stimulation in vitro ( Figure 6 KL).

[0307] MEGA enables metabolic engineering of CAR T cells to improve anti-tumor activity, modulate T cell differentiation, and mitigate consumption

[0308] We used MEGA to knockdown four genes: AKT1, AKT2, HK1, and HK2. These genes encode redundant protein isoforms involved in PI3K / Akt-driven aerobic glycolysis, a metabolic process initiated by CAR / TCR activation and leading to T cell effector differentiation and eventual exhaustion / dysfunction ( Fig.15 A). After disrupting aerobic glycolysis using MEGA, we observed a healthier (less exhausted) surface phenotype in HA-28z CAR T cells ( Fig.15 We also observed a reduction in molecular / metabolic signatures associated with T cell dysfunction ( Fig.15 In functional assays, these cells behaved less effector-like, were able to proliferate better in culture, and were able to maintain antitumor activity in repeated challenge assays ( Fig.15 J). We then performed a head-to-head comparison with prior art Cas9 knockouts. We electroporated HA-28z CAR T cells with Cas9 RNP targeting the same four genes ( Fig.15 KL). Compared with MEGA, Cas9 knockout resulted in poorer T cell expansion and tumor control in culture ( Fig.15 MN). When examining the transcriptome, we observed that these cells also downregulated p53 and upregulated the DNA damage / G2M checkpoint pathway ( Fig.15 OR), which is consistent with previous findings showing that Cas9 is genotoxic. Importantly, we did not observe differential enrichment of these pathways in MEGA CAR T cells ( Fig.15 OR).

[0309] MEGA can be used to target and degrade specific transcripts in primary human T cells without off-target bystander activity

[0310] Recent work has shown that on-target RfxCas13d activity triggers off-target by-pass activity (non-specific cleavage of RNA). We performed experiments to explore whether such off-target by-pass activity exists in the MEGA system. RfxCas13d RNA levels and protein levels were tested to assess by-pass activity resulting from on-target B2M cleavage in primary human T cells from n=2 donors ( Fig.16 A). No off-target bystander activity was observed at either the RNA or protein level for mCherry-P2A-RfxCas13d in primary human MEGA T cells ( Fig.16 BH). MEGA can be used to improve the anti-tumor efficacy of (CAR) T cells in vivo

[0311] In vitro assays showed that the GLY array targeting HK1, HK2, AKT1, and AKT2 prevented CAR T cells from acquiring a dysfunctional phenotype and terminal effector differentiation by disrupting aerobic glycolysis ( Fig.15 ). Next, we performed in vivo tumor challenge experiments in mice to validate our in vitro findings. We prepared these same cells and injected them into mice bearing antigen-positive tumors (Nalm6-GD2) ( Fig.17 A). GLY arrays improved the anti-tumor response of MEGA HA-28z CAR T cells in vivo when compared to non-targeted controls, as measured by tumor bioluminescence imaging (BLI) over 12 days ( Fig.17 BC).

[0312] Large-scale multiplexed knockdown of ten genes in MEGAHA-28z CAR T cells extensively and robustly reprograms the transcriptome at the single-cell level

[0313] We performed expression of SURF2 arrays ( Figure 5 We performed single-cell RNA sequencing (scRNA-seq) of MEGA HA-28z CAR T cells with either 50- or 20-targeted guides to explore the effects of ten-gene knockdown on global gene expression in single cells. We clustered these cells unsupervisedly based on their global gene expression signatures and visualized the resulting clusters in a 2D UMAP plot, where we observed clear separation of cells by sample ID ( Fig.18AC). This indicates that: 1) SURF2 cells are similar to each other, indicating that MEGA perturbation is robust and consistent; and 2) SURF2 cells are significantly different from non-targeted control cells, indicating that the ten-gene perturbation leads to widespread and global transcriptomic changes. When we visualized the gene expression levels of the most significantly differentially expressed genes (SURF2 vs. NT) on the UMAP plots, we observed that SURF2 increased the expression of genes involved in glycolysis and mitophagy, while decreasing the expression of mitochondrial genes ( Fig.18 BC).

[0314] discuss

[0315] Multiplexed silencing of endogenous genes has become a major focus of recent research attempting to improve T cell therapy or develop allogeneic “off-the-shelf” models 3，25，27 . Despite an ever-increasing array of promising gene targets, it quickly became difficult to scale up multiplexed perturbations to more than three genes using existing methods. Therefore, it is essentially impossible to manipulate larger gene sets, such as metabolic pathways (which typically include several redundant or compensatory protein isomers) or functional heteromeric protein complexes. Here, we show that up to 10 endogenous genes can be suppressed at a time from a single guide array without the induction of DNA double-strand breaks. We have also demonstrated robust knockdown of multiple protein isomers, multi-unit protein complexes, signaling cascades, and complete immunosuppressive metabolic pathways to reshape the chemical composition of the tumor microenvironment. We believe that MEGA paves the way for further metabolic pathway discovery and engineering work in primary human T cells, which is particularly exciting because these studies have so far only been possible in microorganisms and plants.

[0316] Unlike Cas9-based tools, MEGA does not carry significant costs with increasing complexity, such as increased risk of genotoxicity or reduced editing specificity. Our results also show that MEGA does not cause observable off-target or side-cutting effects that could impede T cell viability. Although higher-order multiplexing (≥10 genes) may require optimization of spacer positions or sequences to robustly inhibit all targeted genes, we describe a rapid and facile assembly method for arbitrarily long guide arrays to accelerate the process.

[0317] By applying MEGA to an established model of primary human CAR T cell dysfunction, we demonstrated that MEGA does not disrupt CAR expression or signaling and is compatible with T cell antitumor function. 7，46 and epigenetic 47Actively upregulated, but tonic signaling MEGA CAR T cells were able to robustly suppress the expression of multiple inhibitory receptors. Furthermore, our combinatorial CRISPR screen helped to elucidate synergistic relationships between putative depletion-associated genes described in previous CRISPR / Cas9 single knockout screens, and we showed that pairwise knockdown of these newly identified gene combinations broadly enhanced antitumor activity. Specifically, double knockdown of CBLB+FAS best preserved the ability of dysfunctional CAR T cells to control tumor growth against multiple rechallenges, highlighting potential synergistic mechanisms that warrant further investigation.

[0318] Although our proof-of-concept studies focused on a small subset of gene pairs, MEGA is highly scalable and could be used to screen larger subsets of functionally related gene pairs (e.g., metabolic gene sets), or even comprehensive 2D genome-wide collections. For such applications, pre-validated spacer sequences should reduce false negatives and improve signal-to-noise ratios to allow other modes of analysis, such as quantitative genetic interaction (GI) mapping. 55 Although spacer-dependent variability is common to all CRISPR systems, and particularly to dCas9-based tools 29 Our group and others have begun developing more accurate algorithms to predict and generate efficient RfxCas13d spacer sequences. 48，50，73 .

[0319] To date, no CRISPR system has been stably expressed in primary human T cells for therapeutic applications. A recent landmark Phase 1 clinical trial delivered the first patient infusion of Cas9-edited T cells. 26 However, this and other preclinical studies 14 Relying only on transient Cas9 electroporation to introduce permanent edits to the genome. A research group showed that electroporation of recombinant Cas13d can mediate knockdown of a single gene in T cells 74 However, the scope of this approach is limited to highly transient perturbations within a specific time frame during manufacturing, and it is unclear whether the knockdown efficacy is robust to other endogenous genes. Finally, Cas9-fusion effectors approach or exceed the packaging limits of conventional lentiviruses. 75，76 , and the weak expression levels of these constructs in primary human T cells make them impractical for sustained therapeutic applications 18，77 In contrast to these studies, we report for the first time a robust, genetically encoded CRISPR system capable of modulating the magnitude and duration of multiple genetic perturbations at any point in the cellular lifespan.

[0320] Precise control of transcript expression could enhance the safety and efficacy of adoptive T-cell therapy compared to binary and irreversible knockout approaches. Specifically, modulation of CAR activation has received considerable attention, although current cell-intrinsic approaches rely on laborious and time-consuming protein engineering of the receptor itself, the results of which can vary dramatically due to inherent differences between receptor architectures that affect function. In our work, we show that MEGA can be used to modulate the input-output function of CARs independently of the receptor used by linking the dose of TMP to the expression of the proximal signaling molecules LCK and ZAP70. Our amplitude limiter works across a wide range of input signal strengths, from basal tonic signaling to antigenic stimulation of tumor cells.

[0321] In addition to regulation of CAR signaling, MEGA is able to precisely modulate gene set expression and pathway activity of T cells even after manufacturing. This may help to achieve the “sweet spot” between T cell dysfunction and over-function or autoimmunity in patients after infusion. 78，79 For example, in this study we confirmed previous findings that IRF4 is essential for T cell proliferation, despite its role in driving expiration. Although extremely high or low levels of IRF4 can suppress T cell function, in the context of antitumor immunity, expression at moderate levels may be beneficial. 7，31，35 Recent work has also shown that although lower TET2 expression is associated with enhanced T cell memory, complete genetic ablation of TET2 can generate hyperproliferative T cells with genomic instability. 80 Notably, methods to specifically modulate the metabolism of engineered T cells in patients is an established unmet need. 10 , therefore, MEGA could open the door to a new set of potential metabolic interventions for cancer immunotherapy.

[0322] Finally, the transient and reversible nature of MEGA expands the current genetic perturbation space to include previously unexplored temporal manipulation of specific genes or gene sets. For example, reversible knockdown of B2M / HLA could be developed as an alternative to traditional “safety switches” by exploiting immune rejection to modulate T cell persistence in patients. On the other hand, conditional degradation of specific mRNA or long noncoding RNA (lncRNA) transcripts in highly dynamic T cell processes such as activation, differentiation, and exhaustion could provide new biological and therapeutic insights.

[0323] In summary, we developed a synthetic biology-driven platform, MEGA, for multiple transcriptomic modulation in primary human T cells using CRISPR / Cas13d. Our work highlights a variety of T cell engineering applications enabled by MEGA and addresses key limitations imposed by the state-of-the-art CRISPR / Cas9 gene editing technology ( Figure 7 We envision MEGA as a valuable addition to the synthetic immunology toolkit: engineered MEGA T cells are equipped with a wide range of novel capabilities spanning applications from basic biological discoveries to improved cell-based immunotherapies for cancer, among others.

[0324] References

[0325] 1. Brown, CE & Mackall, CLCAR T cell therapy: inroads to response and resistance. Nat. Rev. Immunol. 19, 73–74 (2019).

[0326] 2. Finck, AV, Blanchard, T., Roselle, CP, Golinelli, G. & June, CHEngineered cellular immunotherapies in cancer and beyond. Nat. Med. 28, 678–689 (2022).

[0327] 3. Dimitri, A., Herbst, F. & Fraietta, JA Engineering the next-generation of CAR T-cells with CRISPR-Cas9 gene editing. Mol. Cancer 21, 78 (2022).

[0328] 4. Majzner, RGet al. GD2-CAR T cell therapy for H3K27M-mutated diffusemidline gliomas. Nature 603,934–941(2022).

[0329] 5.Larson,R.C.&Maus,M.V.Recent advances and discoveries in themechanisms and functions of CAR T cells.Nat.Rev.Cancer 21,145–161(2021).

[0330] 6.Majzner,R.G.&Mackall,C.L.Clinical lessons learned from the firstleg of the CAR T cell journey.Nat.Med.25,1341–1355(2019).

[0331] 7.Lynn,R.C.et al.c-Jun overexpression in CAR T cells inducesexhaustion resistance.Nature 576,293–300(2019).

[0332] 8.Fraietta,J.A.et al.Determinants of response and resistance to CD19chimeric antigen receptor(CAR)T cell therapy of chronic lymphocyticleukemia.Nat.Med.24,563–571(2018).

[0333] 9.Pauken,K.E.&Wherry,E.J.Overcoming T cell exhaustion in infectionand cancer.Trends Immunol.36,265–276(2015).

[0334] 10.O’Sullivan,D.,Sanin,D.E.,Pearce,E.J.&Pearce,E.L.Metabolicinterventions in the immune response to cancer.Nat.Rev.Immunol.19,324–335(2019).

[0335] 11.Guedan,S.,Calderon,H.,Posey,A.D.&Maus,M.V.Engineering and Designof Chimeric Antigen Receptors.Mol.Ther.-Methods Clin.Dev.12,145–156(2019).

[0336] 12.Chen,Z.et al.In vivo CD8+ T cell CRISPR screening reveals controlby Fli1 in infection and cancer.Cell 184,1262-1280.e22(2021).

[0337] 13.Wei,J.et al.Targeting REGNASE-1 programs long-lived effector Tcells for cancer therapy.Nature 576,471–476(2019).

[0338] 14.Shifrut,E.et al.Genome-wide CRISPR Screens in Primary Human TCells Reveal Key Regulators of Immune Function.Cell 175,1958-1971.e15(2018).

[0339] 15.Dong,M.B.et al.Systematic Immunotherapy Target Discovery UsingGenome-Scale In Vivo CRISPR Screens in CD8 T Cells.Cell 178,1189-1204.e23(2019).

[0340] 16.Zhao,H.et al.Genome-wide fitness gene identification revealsRoquin as a potent suppressor of CD8 T cell expansion and anti-tumorimmunity.Cell Rep.37,110083(2021).

[0341] 17.Belk,J.A.et al.Genome-wide CRISPR screens of T cell exhaustionidentify chromatin remodeling factors that limit T cellpersistence.2022.04.20.488974 Preprint at https: / / doi.org / 10.1101 / 2022.04.20.488974(2022).

[0342] 18.Schmidt,R.et al.CRISPR activation and interference screens decodestimulation responses in primary human T cells.Science 375,eabj4008(2022).

[0343] 19.Freitas,K.A.et al.Enhanced T cell effector activity by targetingthe Mediator kinase module.Science 378,eabn5647(2022).

[0344] 20.Chen,J.et al.NR4Atranscription factors limit CAR T cell functionin solid tumours.Nature 567,530–534(2019).

[0345] 21.Khan,O.et al.TOX transcriptionally and epigenetically programs CD8+ T cell exhaustion.Nature 571,211–218(2019).

[0346] 22.Fraietta,J.A.et al.Disruption of TET2 promotes the therapeuticefficacy of CD19-targeted T cells.Nature 558,307–312(2018).

[0347] 23.Rupp,L.J.et al.CRISPR / Cas9-mediated PD-1 disruption enhances anti-tumor efficacy of human chimeric antigen receptor T cells.Sci.Rep.7,737(2017).

[0348] 24.LaFleur,M.W.et al.PTPN2 regulates the generation of exhausted CD8+T cell subpopulations and restrains tumor immunity.Nat.Immunol.20,1335–1347(2019).

[0349] 25.Ren,J.et al.Multiplex Genome Editing to Generate Universal CAR TCells Resistant to PD1 Inhibition.Clin.Cancer Res.23,2255–2266(2017).

[0350] 26.Stadtmauer,E.A.et al.CRISPR-engineered T cells in patients withrefractory cancer.Science 367,eaba7365(2020).22

[0351] 27.Webber,B.R.et al.Highly efficient multiplex human T cellengineering without double-strand breaks using Cas9 baseeditors.Nat.Commun.10,5222(2019).

[0352] 28.Eyquem,J.et al.Targeting a CAR to the TRAC locus with CRISPR / Cas9enhances tumour rejection.Nature 543,113–117(2017).

[0353] 29.Wang,H.,La Russa,M.&Qi,L.S.CRISPR / Cas9 in Genome Editing andBeyond.Annu.Rev.Biochem.85,227–264(2016).

[0354] 30.Komor,A.C.,Kim,Y.B.,Packer,M.S.,Zuris,J.A.&Liu,D.R.Programmableediting of a target base in genomic DNAwithout double-stranded DNAcleavage.Nature 533,420–424(2016).

[0355] 31.Man,K.et al.Transcription Factor IRF4 Promotes CD8+ T CellExhaustion and Limits the Development of Memory-like T Cells during ChronicInfection.Immunity 47,1129-1141.e5(2017).

[0356] 32.Odorizzi,P.M.,Pauken,K.E.,Paley,M.A.,Sharpe,A.&Wherry,E.J.Geneticabsence of PD-1 promotes accumulation of terminally differentiated exhaustedCD8+ T cells.J.Exp.Med.212,1125–1137(2015).

[0357] 33.Collier,J.L.,Weiss,S.A.,Pauken,K.E.,Sen,D.R.&Sharpe,A.H.Not-so-opposite ends of the spectrum:CD8+ T cell dysfunction across chronicinfection,cancer and autoimmunity.Nat.Immunol.22,809–819(2021).

[0358] 34.Wei,J.et al.PD-1 silencing impairs the anti-tumor function ofchimeric antigen receptor modified T cells by inhibiting proliferationactivity.J.Immunother.Cancer 7,209(2019).

[0359] 35.Harberts,A.et al.Interferon regulatory factor 4 controls effectorfunctions of CD8+memory T cells.Proc.Natl.Acad.Sci.118,e2014553118(2021).

[0360] 36.Nahmad,A.D.et al.Frequent Aneuploidy in Primary Human T CellsFollowing CRISPR-Cas9 cleavage.2021.08.20.457092doi:10.1101 / 2021.08.20.457092.

[0361] 37.Kosicki,M.,Tomberg,K.&Bradley,A.Repair of double-strand breaksinduced by CRISPR–Cas9 leads to large deletions and complex rearrangements.Nat.Biotechnol.36,765–771(2018).

[0362] 38.Enache,O.M.et al.Cas9 activates the p53 pathway and selects forp53-inactivating mutations.Nat.Genet.52,662–668(2020).

[0363] 39.Kempton,H.R.&Qi,L.S.When genome editing goes off-target.Science364,234–236(2019).

[0364] 40.McCarty,N.S.,Graham,A.E.,Studená,L.&Ledesma-Amaro,R.MultiplexedCRISPR technologies for gene editing and transcriptionalregulation.Nat.Commun.11,1281(2020).

[0365] 41.Park,S.&Beal,P.A.Off-Target Editing by CRISPR-Guided DNA BaseEditors.Biochemistry 58,3727–3734(2019).

[0366] 42.Konermann,S.et al.Transcriptome Engineering with RNA-TargetingType VI-D CRISPR Effectors.Cell 173,665-676.e14(2018).

[0367] 43.Yan,W.X.et al.Cas13d Is a Compact RNA-Targeting Type VI CRISPREffector Positively Modulated by a WYL-Domain-Containing AccessoryProtein.Mol.Cell 70,327-339.e5(2018).

[0368] 44.Zhang,B.et al.Two HEPN domains dictate CRISPR RNA maturation andtarget cleavage in Cas13d.Nat.Commun.10,2544(2019).

[0369] 45.Long,A.H.et al.4-1BB costimulation ameliorates T cell exhaustioninduced by tonic signaling of chimeric antigen receptors.Nat.Med.21,581–590(2015).

[0370] 46.Weber,E.W.et al.Transient rest restores functionality in exhaustedCAR-T cells through epigenetic remodeling.Science 372,(2021).

[0371] 47.Gennert,D.G.et al.Dynamic chromatin regulatory landscape of humanCAR T cell exhaustion.Proc.Natl.Acad.Sci.118,e2104758118(2021).

[0372] 48.Abbott,T.R.et al.Development of CRISPR as an Antiviral Strategy toCombat SARS-CoV-2 and Influenza.Cell 181,865-876.e12(2020).

[0373] 49.Wherry,E.J.&Kurachi,M.Molecular and cellular insights into T cellexhaustion.Nat.Rev.Immunol.15,486–499(2015).

[0374] 50.Wessels,H.-H.et al.Massively parallel Cas13 screens revealprinciples for guide RNA design.Nat.Biotechnol.(2020)doi:10.1038 / s41587-020-0456-9.

[0375] 51. A.et al.Programmable RNA targeting with the single-proteinCRISPR effector Cas7-11.Nature 597,720–725(2021).

[0376] 52.Kelley,C.P.,Haerle,M.C.&Wang,E.T.Negative autoregulation mitigatescollateral RNase activity of repeat-targeting CRISPR-Cas13d in mammaliancells.2021.12.20.473384 Preprint at https: / / doi.org / 10.1101 / 2021.12.20.473384(2021).23

[0377] 53.Tong,H.et al.High-fidelity Cas13 variants for targeted RNAdegradation with minimal collateral effects.Nat.Biotechnol.1–12(2022)doi:10.1038 / s41587-022-01419-7.

[0378] 54.Marques,J.T.&Williams,B.R.G.Activation of the mammalian immunesystem by siRNAs.Nat.Biotechnol.23,1399–1405(2005).

[0379] 55.Horlbeck,M.A.et al.Mapping the Genetic Landscape of HumanCells.Cell 174,953-967.e22(2018).

[0380] 56.Wessels,H.-H.et al.Efficient combinatorial targeting of RNAtranscripts in single cells with Cas13 RNA Perturb-seq.Nat.Methods 20,86–94(2023).

[0381] 57.Katagiri,T.et al.JunB plays a crucial role in development ofregulatory T cells by promoting IL-2 signaling.Mucosal Immunol.12,1104–1117(2019).

[0382] 58.Ren,J.et al.A versatile system for rapid multiplex genome-editedCAR T cell generation.Oncotarget 8,17002–17011(2017).

[0383] 59.Tschumi,B.O.et al.CART cells are prone to Fas-and DR5-mediatedcell death.J.Immunother.Cancer 6,71(2018).

[0384] 60.Hooper,K.et al.Knockout of CBLB Greatly Enhances Anti-TumorActivity of CAR T Cells.Blood 132,338(2018).

[0385] 61.Banaszynski,L.A.,Chen,L.,Maynard-Smith,L.A.,Ooi,A.G.L.&Wandless,T.J.A Rapid,Reversible,and Tunable Method to Regulate Protein Function inLiving Cells Using Synthetic Small Molecules.Cell126,995–1004(2006).

[0386] 62.Labanieh,L.et al.Enhanced safety and efficacy of protease-regulated CAR-T cell receptors.Cell 185,1745-1763.e22(2022).

[0387] 63.Li,H.-S.et al.High-performance multiplex drug-gated CARcircuits.Cancer Cell 40,1294-1305.e4(2022).

[0388] 64.Quinn,W.J.et al.Lactate Limits T Cell Proliferation via the NAD(H)Redox State.Cell Rep.33,108500(2020).

[0389] 65.Menk,A.V.et al.Early TCR Signaling Induces Rapid AerobicGlycolysis Enabling Distinct Acute T Cell Effector Functions.Cell Rep.22,1509–1521(2018).

[0390] 66.Klebanoff,C.A.et al.Inhibition of AKT signaling uncouples T celldifferentiation from expansion for receptor-engineered adoptiveimmunotherapy.JCI Insight 2,e95103.

[0391] 67.Wei,S.C.et al.Distinct Cellular Mechanisms Underlie Anti-CTLA-4and Anti-PD-1 Checkpoint Blockade.Cell 170,1120-1133.e17(2017).

[0392] 68.Blaize,G.et al.CD5 signalosome coordinates antagonist TCR signalsto control the generation of Treg cells induced by foreignantigens.Proc.Natl.Acad.Sci.117,12969–12979(2020).

[0393] 69.Gupta,P.K.et al.CD39 Expression Identifies Terminally ExhaustedCD8+ T Cells.PLOS Pathog.11,e1005177(2015).

[0394] 70.Kemper,C.et al.Activation of human CD4+cells with CD3 and CD46induces a T-regulatory cell 1 phenotype.Nature 421,388–392(2003).

[0395] 71.Vijayan,D.,Young,A.,Teng,M.W.L.&Smyth,M.J.Targetingimmunosuppressive adenosine in cancer.Nat.Rev.Cancer 17,709–724(2017).

[0396] 72.Allard,B.,Allard,D.,Buisseret,L.&Stagg,J.The adenosine pathway inimmuno-oncology.Nat.Rev.Clin.Oncol.17,611–629(2020).

[0397] 73.Wei,J.et al.Deep learning of Cas13 guide activity from high-throughput gene essentiality screening.2021.09.14.460134 Preprint at https: / / doi.org / 10.1101 / 2021.09.14.460134(2021).

[0398] 74.Méndez-Mancilla,A.et al.Chemically modified guide RNAs enhanceCRISPR-Cas13 knockdown in human cells.Cell Chem.Biol.(2021)doi:10.1016 / j.chembiol.2021.07.011.

[0399] 75.Xu,X.et al.Engineered miniature CRISPR-Cas system for mammaliangenome regulation and editing.Mol.Cell 81,4333-4345.e4(2021).

[0400] 76. J.K.et al.Genome-wide programmable transcriptional memoryby CRISPR-based epigenome editing.Cell 184,2503-2519.e17(2021).

[0401] 77.Chen,X.et al.Functional Interrogation of Primary Human T Cells viaCRISPR Genetic Editing.J.Immunol.201,1586–1598(2018).

[0402] 78.Grebinoski,S.et al.Autoreactive CD8+ T cells are restrained by anexhaustion-like program that is maintained by LAG3.Nat.Immunol.1–10(2022)doi:10.1038 / s41590-022-01210-5.

[0403] 79.Cruz,A.C.et al.Fas / CD95 prevents autoimmunity independently oflipid raft localization and efficient apoptosis induction.Nat.Commun.7,13895(2016).

[0404] 80.Jain,N.et al.TET2 guards against unchecked BATF3-induced CAR Tcell expansion.Nature 1–8(2023)doi:10.1038 / s41586-022-05692-z.24

[0405] 81.Bray,N.L.,Pimentel,H.,Melsted,P.&Pachter,L.Near-optimalprobabilistic RNA-seq quantification.Nat.Biotechnol.34,525–527(2016).

[0406] 82.Love,M.I.et al.Tximeta:Reference sequence checksums for provenanceidentification in RNA-seq.PLOS Comput.Biol.16,e1007664(2020).

[0407] 83.Love,M.I.,Huber,W.&Anders,S.Moderated estimation of fold changeand dispersion for RNA-seq data with DESeq2.Genome Biol.15,550(2014).

[0408] 84.Zhu,A.,Ibrahim,J.G.&Love,M.I.Heavy-tailed prior distributions forsequence count data:removing the noise and preserving largedifferences.Bioinformatics 35,2084–2092(2019).

[0409] 85.Wang,B.et al.Integrative analysis of pooled CRISPR genetic screensusing MAGeCKFlute.Nat.Protoc.14,756–780(2019).

[0410] 86.Langmead,B.&Salzberg,S.L.Fast gapped-read alignment with Bowtie2.Nat.Methods 9,357–359(2012).

[0411] 87. Doench, J Get al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat. Biotechnol. 34, 184–191 (2016).

[0412] 88.Li,W.et al.MAGeCK enables robust identification of essential genes from genome-scale

[0413] CRISPR / Cas9 knockout screens.Genome Biol.15,554(2014).

[0414] It should be understood that the embodiments and implementations described herein are for illustrative purposes only, and various modifications or changes thereto will be suggested to those skilled in the art, and will be included within the spirit and scope of the present application and the scope of the appended claims. All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety for all purposes.

[0415] Table 1. Exemplary crRNA spacer sequences.

[0416]

[0417]

[0418] Table 2. Exemplary crRNA spacer sequences.

[0419]

[0420]

[0421]

[0422]

[0423] Table 3. Cloning primers.

[0424]

[0425]

[0426] Informal Sequence Listing

[0427] RfxCas13d amino acid sequence: (SEQ ID NO: 1)

[0428]

[0429] >RfxCas13d-2XNLS-FLAG amino acid sequence (SEQ ID NO: 2)

[0430]

[0431]

[0432] >RfxCas13d-2XNLS-FLAG amino acid sequence (SEQ ID NO: 3)

[0433]

[0434] Bold: RfxCas13d

[0435] Underline: 2XNLS

[0436] Italic and underlined: FLAG tag

[0437] >DHFR DD domain amino acid sequence (SEQ ID NO:4)

[0438]

[0439] >DHFR DD domain amino acid sequence (SEQ ID NO:5)

[0440]

[0441] >RfxCas13d-2XNLS-DD-FLAG amino acid sequence (SEQ ID NO:6)

[0442]

[0443]

[0444] >RfxCas13d-2XNLS-DD-FLAG amino acid sequence (SEQ ID NO:7)

[0445]

[0446] Underline: RfxCas13d

[0447] Bold: 2XNLS

[0448] Italics: DHFR DD domain

[0449] Bold and underline: FLAG tag

[0450] >RfxCas13d Example 10 Redirecting Array Amino Acid Sequence (SEQ ID NO: 8)

[0451]

[0452] Bold: DR30 (30 nucleotide direct repeat sequence)

[0453] Underline: DR36 (36 nucleotide direct repeat sequence)

[0454] Direct repeat sequence:

[0455]

[0456] Connector sequence:

[0457]

Claims

1. A genetically modified T cell comprising: (i) a Class 2, Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity; and (ii) A guide array comprising a plurality of CRISPR-associated RNA (crRNA) molecules, wherein the crRNA molecules independently comprise a direct repeat sequence and a spacer sequence that binds to a target RNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA.

2. A genetically modified T cell according to claim 1, comprising a nucleic acid encoding (i), a nucleic acid encoding (ii), or a nucleic acid encoding both (i) and (ii), wherein the nucleic acid encoding (i) or (ii) or both (i) and (ii) is stably integrated into the genome of the T cell.

3. A genetically modified T cell according to claim 1 or 2, wherein the Class 2 VI-D type CRISPR effector with RNA-guided RNA endonuclease activity comprises a fusion protein containing a destabilization domain (DD).

4. The genetically modified T cell of any one of claims 1 to 3, wherein the Class 2 VI-D type CRISPR effector with RNA-guided RNA endonuclease activity is a Cas13 nuclease, selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e and functional variants thereof.

5. The genetically modified T cell of any one of claims 1 to 4, wherein the guide array is a polycistronic array comprising the multiple crRNA molecules.

6. A genetically modified T cell according to any one of claims 1 to 5, wherein the guide array comprises 2 to 10 crRNA molecules.

7. A genetically modified T cell according to any one of claims 1 to 5, wherein the guide array comprises greater than 10 crRNA molecules.

8. The genetically modified T cell of any one of claims 1 to 7, wherein the guide array comprises crRNA molecules bound to mRNA encoding a protein associated with T cell depletion.

9. The genetically modified T cells of claim 8, wherein the T cell depletion-related protein is selected from the group consisting of TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1 (CD39), CD46, B2M, ZAP70, LCK, AKT1, AKT2, HK1, HK2, NT5E (CD73), ADORA2A, ADORA2B, LDHA, LDHB, CD147, MCT1, MCT4, GAPDH, and combinations thereof.

10. The genetically modified T cell of any one of claims 1 to 9, wherein the T cell further comprises a chimeric antigen receptor (CAR).

11. The genetically modified T cell of claim 10, wherein the CAR binds to an antigen expressed by a tumor.

12. The genetically modified T cell of claim 10 or 11, wherein the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, C D30, EGFR, EGFRvIII, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, FAB, WT-1, PSMA, AFP, BCMA, mesothelin, GPC3, MUC1, and CTAG1B.

13. A genetically modified T cell according to any one of claims 10 to 12, wherein the intracellular signaling of the CAR upregulates T cell depletion markers in control T cells that do not comprise (i) and (ii) of claim 1.

14. The genetically modified T cell of claim 13, wherein the depletion marker is selected from LAG3, PDCD1 (PD-1), HAVCR2 (TIM3), CTLA4 and ENTPD1, ​​and combinations thereof.

15. The genetically modified T cell of any one of claims 10 to 14, wherein the guide array comprises crRNA molecules bound to mRNA encoding LAG3, PDCD1 (PD-1), HAVCR2 (TIM3), CTLA4, ENTPD1 or a combination thereof.

16. A genetically modified T cell according to any one of claims 10 to 15, wherein the guide array comprises one or more crRNA molecules that bind to the mRNA expressed by the CAR.

17. The genetically modified T cell of any one of claims 1 to 16, wherein the T cell is selected from a combination of human T cells and primary human T cells.

18. A nucleic acid encoding: (i) a Class 2, Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity; and (ii) A guide array comprising a plurality of CRISPR-associated RNA (crRNA) molecules, wherein the crRNA molecules independently comprise a direct repeat sequence and a spacer sequence that binds to a target RNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA.

19. The nucleic acid of claim 18, wherein the Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof.

20. The nucleic acid of claim 18 or 19, wherein the guide array is a polycistronic array comprising the plurality of crRNA molecules.

21. The nucleic acid of any one of claims 18 to 20, wherein the guide array comprises 2 to greater than or equal to 10 crRNA molecules.

22. The nucleic acid of any one of claims 18 to 21, wherein the guide array comprises crRNA molecules that bind to mRNA encoding a protein associated with T cell depletion.

23. The nucleic acid of claim 22, wherein the T cell depletion-related protein is selected from the group consisting of TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1 (CD39), CD46, B2M, ZAP70, LCK, AKT1, AKT2, HK1, HK2, NT5E (CD73), ADORA2A, ADORA2B, LDHA, LDHB, CD147, MCT1, MCT4, GAPDH, and combinations thereof.

24. A system for multiplexed transcriptomic modulation, comprising: (i) an expression cassette comprising a nucleic acid sequence encoding a Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity; and (ii) an expression cassette comprising a nucleic acid sequence encoding a guide array comprising a plurality of crRNA molecules, wherein the crRNA molecules comprise a direct repeat sequence and a spacer sequence that binds to a target mRNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA.

25. The system of claim 24, wherein the Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof.

26. The system of claim 24 or 25, wherein the guide array is a polycistronic array comprising the plurality of crRNA molecules.

27. The system of any one of claims 24 to 26, wherein the guide array comprises 2 to greater than or equal to 10 crRNA molecules.

28. The system of any one of claims 24 to 27, wherein the guide array comprises crRNA molecules that bind to mRNA encoding a protein associated with T cell depletion.

29. The system of claim 28, wherein the T cell depletion-related protein is selected from the group consisting of TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1 (CD39), CD46, B2M, ZAP70, LCK, AKT1, AKT2, HK1, HK2, NT5E (CD73), ADORA2A, ADORA2B, LDHA, LDHB, CD147, MCT1, MCT4, GAPDH, and combinations thereof.

30. The system according to any one of claims 24 to 29, wherein the system further comprises (iii) T cells or primary T cells.

31. The system of claim 30, wherein the T cell or primary T cell further comprises a chimeric antigen receptor (CAR).

32. The system of claim 31, wherein the CAR binds to an antigen expressed by a tumor.

33. The system of claim 31 or 32, wherein the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD30 , EGFR, EGFRvIII, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, FAB, WT-1, PSMA, AFP, BCMA, mesothelin, GPC3, MUC1, and CTAG1B.

34. The system of any one of claims 31 to 33, wherein expression and intracellular signaling of the CAR upregulates T cell depletion markers in control T cells that do not comprise (i) and (ii) of claim 24.

35. The system of claim 34, wherein the depletion marker is selected from LAG3, PDCD1 (PD-1), HAVCR2 (TIM3), CTLA4, ENTPD1 or a combination thereof.

36. The system of any one of claims 31 to 35, wherein the guide array comprises crRNA molecules bound to mRNA encoding LAG3, PDCD1 (PD-1), HAVCR2 (TIM3), CTLA4, ENTPD1, ​​or a combination thereof.

37. The system of any one of claims 31 to 36, wherein the guide array comprises one or more crRNA molecules that bind to the mRNA expressed by the CAR.

38. The system according to any one of claims 30 to 37, wherein the T cells are selected from human T cells and primary human T cells.

39. A method for producing a modified T cell, comprising: (i) transducing T cells with an expression vector comprising a nucleic acid sequence encoding a Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity; and (ii) transducing T cells with an expression vector comprising a nucleic acid sequence encoding a guide array, wherein the guide array comprises a plurality of CRISPR-associated RNA (crRNA) molecules, wherein the crRNA molecules independently comprise a direct repeat sequence and a spacer sequence that binds to a target mRNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA, Thereby generating the modified T cells.

40. The method of claim 39, further comprising (iii) transducing the T cells with an expression vector comprising a nucleic acid sequence encoding CAR.

41. The method of claim 39 or 40, wherein step (i) is performed before step (ii); step (iii) is performed before step (ii), or steps (i) and (iii) are performed before step (ii).

42. The method of any one of claims 39 to 41, wherein (i), (ii) and / or (iii) are stably integrated into the genome of the T cell.

43. The method of any one of claims 39 to 42, wherein the Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof.

44. The method of any one of claims 39 to 43, wherein the guide array is a polycistronic array comprising the plurality of crRNA molecules.

45. The method of any one of claims 39 to 44, wherein the guide array comprises 2 to greater than or equal to 10 crRNA molecules.

46. ​​The method of any one of claims 39 to 45, wherein the guide array comprises crRNA molecules that bind to mRNA encoding a protein associated with T cell depletion.

47. The method of claim 46, wherein the T cell depletion-related protein is selected from the group consisting of TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1 (CD39), CD46, B2M, ZAP70, LCK, AKT1, AKT2, HK1, HK2, NT5E (CD73), ADORA2A, ADORA2B, LDHA, LDHB, CD147, MCT1, MCT4, GAPDH, and combinations thereof.

48. The method of any one of claims 40 to 47, wherein the CAR binds to an antigen expressed by the tumor.

49. The method of any one of claims 40 to 48, wherein the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD 30, EGFR, EGFRvIII, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, FAB, WT-1, PSMA, AFP, BCMA, mesothelin, GPC3, MUC1, and CTAG1B.

50. The method of any one of claims 40 to 49, wherein expression of the CAR and intracellular signaling upregulates T cell depletion markers in control T cells that do not contain the expression vector of steps (i) and (ii).

51. The method of claim 50, wherein the depletion marker is selected from LAG3, PDCD1 (PD-1) or HAVCR2 (TIM3) or a combination thereof.

52. The method of any one of claims 40 to 51, wherein the guide array comprises crRNA molecules that bind to the mRNA expressed by the CAR.

53. The method according to any one of claims 39 to 52, wherein the T cells are selected from human T cells and primary human T cells.

54. A fusion protein comprising a Class 2, Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity covalently linked to a destabilization domain (DD) polypeptide.

55. The fusion protein of claim 54, wherein the Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from the group consisting of Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof.

56. The fusion protein of claim 54 or 55, wherein the DD comprises an E. coli dihydrofolate reductase DD linked to the C-terminus of the Class 2, Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity.

57. A nucleic acid encoding the fusion protein of any one of claims 54 to 56.

58. A method for regulating gene expression in T cells, comprising: (a) T cells were transduced with: (i) an expression vector comprising a nucleic acid sequence encoding the fusion protein of any one of claims 54 to 56; and (ii) an expression vector comprising a nucleic acid sequence encoding a guide array comprising crRNA molecules, wherein the crRNA molecules comprise a direct repeat sequence and a spacer sequence that binds to a target mRNA expressed by a target gene, (b) contacting the T cell with a compound that binds to and stabilizes the DD, wherein expression of the target gene is reduced in the presence of the compound compared to expression of the target gene in the absence of the compound, Thereby regulating the gene expression of the T cells.

59. The method of claim 58, wherein the fusion protein is degraded in the T cell in the absence of the compound.

60. The method of claim 58 or 59, wherein expression of the target gene increases upon removal of the compound, thereby reversibly regulating expression of the target gene.

61. The method of any one of claims 58 to 60, wherein the guide array comprises a plurality of crRNA molecules that bind to different target mRNAs or different regions of the same target mRNA.

62. The method of any one of claims 58 to 61, wherein expression of the target gene is regulated by the compound in a dose-dependent manner.

63. The method of any one of claims 58 to 62, wherein the compound is trimethoprim (TMP).

64. A method for screening to identify a regulator of T cell activity, comprising expressing in a T cell or a population of T cells: (i) a Class 2, Type VI-D CRISPR effector with RNA-guided RNA endonuclease activity; and (ii) a library of guide arrays, wherein individual guide arrays comprise one or more CRISPR-associated RNA (crRNA) molecules, wherein the crRNA molecules comprise a direct repeat sequence and a spacer sequence that binds to a target RNA, and wherein the one or more crRNA molecules bind to different target mRNAs or different regions of the same target mRNA; culturing the T cells to produce a clonal population of expanded T cells; and determining whether the guide array is enriched or depleted in the clonal population of said expanded T cells, Wherein if the guide array is enriched, the target mRNA encodes a negative regulator of T cell activity, or if the guide array is depleted, the target mRNA encodes a positive regulator of T cell activity.

65. The method of claim 64, wherein the T cell activity is T cell proliferation, increased cytokine secretion, or increased tumor cell killing.

66. The method of claim 64 or 65, wherein T cells comprising the enriched guide array have an effector memory phenotype and T cells comprising the depleted guide array have a central memory or stem cell memory phenotype.

67. The method of any one of claims 64 to 66, wherein the separate guide array comprises crRNA molecules that bind to mRNA encoding a protein associated with T cell depletion.

68. The method of claim 67, wherein the T cell depletion-related protein is selected from TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1 (CD39), CD46, B2M, ZAP70, LCK, AKT1, AKT2, HK1, HK2, NT5E (CD73), ADORA2A, ADORA2B, LDHA, LDHB, CD147, MCT1, MCT4, GAPDH, and combinations thereof.

69. The method of any one of claims 64 to 68, wherein the library of guide arrays comprises one or more individual guide arrays comprising a polycistronic array comprising a plurality of crRNA molecules.

70. The method of any one of claims 64 to 69, wherein the separate guide arrays comprise 2 to 10 crRNA molecules.

71. The method of any one of claims 64 to 70, wherein the separate guide array comprises a pair of crRNA molecules.

72. The method of any one of claims 64 to 71, wherein the Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof.

73. The method of any one of claims 64 to 72, wherein the T cells also express a chimeric antigen receptor (CAR).

74. The method of claim 73, wherein the CAR binds to an antigen expressed by the tumor.

75. The method of claim 73 or 74, wherein the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD30 , EGFR, EGFRvIII, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, FAB, WT-1, PSMA, AFP, BCMA, mesothelin, GPC3, MUC1, and CTAG1B.

76. The method of any one of claims 64 to 75, wherein determining whether a guide array is enriched or depleted in the expanded clonal population of T cells comprises sequencing a guide RNA present in the T cells.

77. A method for increasing the proliferation of T cells, the method comprising transducing the T cells with: (i) an expression vector comprising a nucleic acid sequence encoding a Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity; and (ii) an expression vector comprising a nucleic acid sequence encoding a guide array comprising one or more crRNA molecules, wherein the crRNA molecules independently comprise a direct repeat sequence and a spacer sequence that binds to a target mRNA, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA, wherein proliferation of the T cells is increased compared to a control T cell expressing a non-targeting control guide array comprising one or more crRNA molecules that do not bind to the target mRNA in (ii).

78. The method of claim 77, wherein the guide array comprises crRNA molecules that bind to mRNA encoding a protein associated with T cell depletion.

79. The method of claim 78, wherein the T cell depletion-related protein is selected from the group consisting of TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1, HAVCR2, LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1 (CD39), CD46, B2M, ZAP70, LCK, AKT1, AKT2, HK1, HK2, NT5E (CD73), ADORA2A, ADORA2B, LDHA, LDHB, CD147, MCT1, MCT4, GAPDH, and combinations thereof.

80. The method of any one of claims 77 to 79, wherein the guide array comprises a polycistronic array comprising a plurality of crRNA molecules.

81. The method of any one of claims 77 to 80, wherein the guide array comprises 2 to greater than or equal to 10 crRNA molecules.

82. The method of any one of claims 77 to 81, wherein the Class 2, Type VI-D CRISPR effector having RNA-guided RNA endonuclease activity is a Cas13 nuclease selected from Cas13a, Cas13b, 13bt1, Cas13bt2, Cas13c, Cas13d, RfxCas13d, Cas13e, and functional variants thereof.

83. The method according to any one of claims 77 to 82, further comprising (iii) transducing the T cell with an expression vector comprising a nucleic acid sequence encoding a CAR.

84. The method of claim 83, wherein the CAR binds to an antigen expressed by the tumor.

85. The method of claim 83 or 84, wherein the CAR binds to an antigen selected from the group consisting of Her-2, B7-H3, GPC2, GD2, CD19, CD20, CD22, MAGE, BAGE, CAGE, GAGE, HAGE, LAGE, PAGE, PRAME, NY-ESO-1, NY-SEO-1, tyrosinase, Melan-A / MART, gplOO, TRP-1, TRP-2, CD30 , EGFR, EGFRvIII, FAP, CD33, CD123, PD-L1, IGF1R, CD4, CSPG4, B7-H4, NKG2D, CS1, CD138, EpCAM, EBNA3C, GPA7, CD244, CA-125, ETA, CEA, CD52, MUC5AC, c-Met, FAB, WT-1, PSMA, AFP, BCMA, mesothelin, GPC3, MUC1, and CTAG1B.

86. A method for treating a tumor in a subject, comprising: The genetically modified T cells of any one of claims 1 to 17 are administered to the subject, wherein the modified T cells kill tumor cells in the subject, thereby treating the tumor.

87. A method for increasing the anti-tumor activity of T cells, the method comprising contacting tumor cells with the genetically modified T cells of any one of claims 1 to 17, wherein contacting the tumor cells with the genetically modified T cells increases the expression of anti-tumor cytokines or kills the tumor cells, thereby increasing the anti-tumor activity compared to control T cells that do not contain (i) or (ii) or both (i) and (ii).

88. The method of claim 87, wherein the method is an in vitro method.

89. The method of claim 87, wherein the method is an in vivo method.

90. A guide array comprising a plurality of CRISPR-associated RNA (crRNA) molecules, wherein the crRNA molecules comprise direct repeat sequences and spacer sequences that bind to target RNAs, and wherein the crRNA molecules bind to different target mRNAs or different regions of the same target mRNA.

91. The guide array of claim 90, wherein the guide array is a polycistronic array comprising the plurality of crRNA molecules.

92. The guide array of claim 90 or 91, wherein the guide array comprises 2 to 10 crRNA molecules.

93. The guide array of claim 90 or 91, wherein the guide array comprises greater than 10 crRNA molecules.

94. The guide array of any one of claims 90 to 93, wherein the guide array comprises crRNA molecules that bind to mRNA encoding a protein associated with T cell depletion.

95. The guide array of claim 94, wherein the T cell depletion-related proteins are selected from TOX, TOX2, NR4A1, NR4A2, NR4A3, TET2, IRF4, JUNB, BATF3, DHX37, FLI1, ZC3H12A, SOCS1, TCEB2, PDCD1 (PD-1), HAVCR2 (TIM3), LAG3, CTLA4, TIGIT, FAS, TRAC, CBLB, RASA2, PTPN2, CD5, ENTPD1 (CD39), CD46, B2M, ZAP70, LCK, AKT1, AKT2, HK1, HK2, NT5E (CD73), ADORA2A, ADORA2B, LDHA, LDHB, CD147, MCT1, MCT4, GAPDH, and combinations thereof.

Images