Plorizin glycosylation gene and application thereof

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly discloses phlorizin glycosylation protease, a gene and application of the phlorizin glycosylation protease. According to the application, glycosyl transferase genes PGGT1.1 and PGGT1.2 for synthesizing phloretin 2 '-O-xylose glucoside through phlorizin glycosylation are obtained, the PGGT1.1 and the PGGT1.2 are over-expressed in plants, and the content of phloretin 2'-O-xylose glucoside in plant leaves is obviously increased, so that biosynthesis, separation and extraction of phloretin 2 '-O-xylose glucoside are facilitated.

Description

Technical Field

[0001] The present application belongs to the technical field of plant genetic engineering, and specifically relates to a phlorizin glycosylation gene and a method and application of efficiently catalyzing the glycosylation of phlorizin to synthesize phlorizin 2'-O-xylose glucoside. Background Art

[0002] Phlorizin accumulates in the roots, stems, leaves, flowers and fruits of plants, especially apple plants. In apple leaves, the content of phlorizin accounts for more than 90% of the total phenol content. Since phlorizin accumulates in large amounts and is widely present in the leaves of apple plants, it is relatively easy to separate and purify. Phlorizin 2'-O-xylose glucoside accumulates only in fruits, but the high sugar content in fruits increases the difficulty of separating and extracting phlorizin 2'-O-xylose glucoside. Therefore, it is very necessary to identify a glycosyltransferase with high catalytic activity to synthesize phlorizin 2'-O-xylose glucoside.

[0003] In view of this, this application is proposed. Summary of the invention

[0004] In response to the above technical problems, the present application discovered through gene mining and research that PGGT1.1 and PGGT1.2 can glycosylate phlorizin to generate phlorizin 2'-O-xylose glucoside. The present application also discovered that for different plant tissues, it is easier to separate and extract phlorizin 2'-O-xylose glucoside from leaves than from fruits. Therefore, the present application glycosylates phlorizin to generate phlorizin 2'-O-xylose glucoside by regulating the expression or enzyme activity of PGGT1.1 and PGGT1.2, which has important application value for separating and extracting phlorizin 2'-O-xylose glucoside.

[0005] This application specifically provides the following technical solutions:

[0006] The present application first provides a protease, wherein the protease encoding gene is located at chr10:16473722-16475131 (gene number MD10G1211400) or chr15:16963589-16966336 (gene number MD15G1101200) of the reference genome GDDH13v1.1.

[0007] Further, the protease is from the genus Malus; preferably, the protease is from Malus chinensis, Malus chinensis or Malus frutescens.

[0008] In some specific embodiments, the protease has an amino acid sequence as shown in any one of SEQ ID NOs. 6-10, or an amino acid sequence with at least 95% homology to any one of SEQ ID NOs. 6-10.

[0009] In some more specific embodiments, the protease of the present application also includes: a protease as shown in SEQ ID NO.6, and 96Glu of SEQ ID NO.6 is replaced by 96Asp; preferably, 125Glu, 334Ala or 424Gln of SEQ ID NO.6 can be further replaced by 125Gln, 334Val or 424Arg, respectively.

[0010] In other specific embodiments, the protease of the present application also includes: a protease as shown in SEQ ID NO.7-10, wherein 125Gln, 334Val or 424Arg of SEQ ID NO.7-10 can be further replaced by 125Glu, 334Ala or 424Gln, respectively.

[0011] The present application also provides a phlorizin glycosylation gene, which encodes any of the above-mentioned proteases.

[0012] In some embodiments, the phlorizin glycosylation gene has at least 95% homology with SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5; preferably, as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5.

[0013] In some embodiments, the phlorizin glycosylation gene is from the genus Malus.

[0014] Furthermore, the phlorizin glycosylation gene can be applied to the biosynthesis and separation and extraction of phlorizin 2'-O-xylose glucoside.

[0015] The present application also provides a recombinant vector, which comprises the nucleic acid sequence of any of the above-mentioned glycosylation genes.

[0016] In some embodiments, the vector is an expression vector.

[0017] In some preferred embodiments, the expression vector comprises a prokaryotic expression vector or a eukaryotic expression vector;

[0018] In some specific preferred embodiments, the expression vector includes but is not limited to: prokaryotic expression vector Pet28a or overexpression vector pCambia 2300.

[0019] The present application also provides a recombinant cell or a recombinant microorganism, comprising the above-mentioned recombinant vector.

[0020] In some specific embodiments, the recombinant cell or recombinant microorganism is Escherichia coli BL21 (DE3) or Agrobacterium GV3101.

[0021] The present application also provides any of the following applications of the above gene:

[0022] 1) Application in the synthesis of phloretin 2'-O-xylosyl glucoside;

[0023] 2) Application in the separation and extraction of phloretin 2'-O-xylose glucoside.

[0024] Furthermore, the synthesis includes catalytic synthesis or biological synthesis.

[0025] The present application also provides a method for separating and extracting phloretin 2'-O-xylose glucoside, comprising the above-mentioned biosynthesis step, and further comprising the step of separating and extracting phloretin 2'-O-xylose glucoside from plant leaves.

[0026] In some embodiments, the plants mentioned above include but are not limited to apple.

[0027] Compared with the prior art, this application has at least the following advantages:

[0028] 1) The present application discovered that the glycosylation genes PGGT1.1 and PGGT1.2 can glycosylate phlorizin into phlorizin 2'-O-xylose glucoside.

[0029] 2) In the present application, the glycosylation genes PGGT1.1 and PGGT1.2 of phloretin are stably expressed in apples, and the content of phloretin 2'-O-xylose glucoside in the overexpressed transgenic plants is significantly increased, which has important application value for the separation and extraction of phloretin 2'-O-xylose glucoside. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0031] Figure 1 The intersection of Set 1-10 differentially expressed genes described in Example 1;

[0032] Figure 2 This is a heat map of gene expression of PGGT1.1 and PGGT1.2 in different tissues of Malus multiflora described in Example 1;

[0033] Figure 3 This is the gene expression heat map of PGGT1.1 and PGGT1.2 in fruits and leaves of 6 germplasm resources described in Example 1;

[0034] Figure 4 The in vitro enzyme activity detection structure of the PGGT1.1 and PGGT1.2 recombinant proteins described in Example 1;

[0035] Figure 5 The comparison results of PGGT1.1 and PGGT1.2 amino acid sequences of Golden Crown (Md), Malus membranaceus (Mm) and Malus membranaceus (Mw) described in Example 2;

[0036] Figure 6 The results of in vitro enzyme activity detection of the mutant MdPGGT1.1 and MdPGGT1.2 recombinant proteins described in Example 2;

[0037] Figure 7 The detection result of RNA level of the PGGT overexpressing transgenic strain described in Example 3;

[0038] Figure 8 The content of phlorizin and phlorizin 2'-O-xylose glucoside in the leaves of the PGGT-overexpressing transgenic strain described in Example 3;

[0039] Fig. 9 is the purity of phloretin 2'-O-xylose glucoside described in Example 4;

[0040] Fig.10 The results of the detection of 2'-O-xylose glucoside of phloretin after transient expression of the PGGT gene of Golden Crown, Malus cylindrica and Malus cylindrica in tobacco leaves as described in Example 5;

[0041] Fig.11 This is the content of phloretin 2'-O-xylosyl glucoside after transiently expressing the PGGT gene of Golden Crown, Malus chinensis and Malus donghong in tobacco leaves as described in Example 5. DETAILED DESCRIPTION

[0042] Although the application can be implemented in many different forms, what is disclosed here is its specific illustrative embodiment that verifies the principle of the application.It should be emphasized that the application is not limited to the specific embodiment illustrated.In addition, any section title used herein is only used for organizational purposes and is not interpreted as limiting the described subject matter.The following terms or definitions are provided only to help understand the application.These definitions should not be construed as having a scope less than that understood by those skilled in the art.

[0043] Unless otherwise defined below, the meaning of all technical terms and scientific terms used in the specific embodiments of the present application is intended to be the same as those generally understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain the present application.

[0044] The terms "comprise", "include", "have", "contain" or "involve" are inclusive or open-ended and do not exclude other unlisted elements or method steps. The term "consisting of" is considered a preferred embodiment of the term "comprising". If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists of only these embodiments.

[0045] When referring to a singular noun an indefinite or definite article e.g. "a" or "an", "the" or "an" is used, this includes a plural of that noun.

[0046] In addition, the terms first, second, third, (a), (b), (c), and the like in the specification and claims are used to distinguish similar elements and are not necessarily required to describe a sequential or chronological order. It should be understood that the terms so used are interchangeable under appropriate circumstances, and the embodiments described in this application can be implemented in other sequences than those described or illustrated in this application.

[0047] The term "and / or" is considered a specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" as used in phrases such as "A and / or B" herein is intended to include A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to cover each of the following: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0048] The terms "such as" and "ie" are used merely as examples and are not intended to be limiting, and should not be construed as referring only to those items explicitly listed in the specification.

[0049] The terms "approximately" and "substantially" represent the accuracy range that can be understood by those skilled in the art to still ensure the technical effect of the characteristic in question. The term usually represents ±10%, preferably ±5%, of the indicated value.

[0050] As described herein, unless otherwise indicated, any concentration range, percentage range, ratio range or integer range should be understood to include the value of any integer within the recited range and, where appropriate, fractions thereof (e.g., tenths and hundredths of integers).

[0051] Detailed technical solution of this application:

[0052] The protease protected in the present application is a class of proteases, the genes encoding which are located at chr10:16473722-16475131 (gene number MD10G1211400) or chr15:16963589-16966336 (gene number MD15G1101200) of the reference genome GDDH13 v1.1.

[0053] In particular, the protease is from the genus Malus; in some specific embodiments, from Malus japonicus, Malus xifuensis or Malus donghongensis.

[0054] The present application confirms through experimental examples that the protease sequence can achieve changes in catalytic activity through mutation. For example, when Glu96 in MdPGGT1.1 (SEQ ID NO.6) is replaced by Asp96 in MdPGGT1.2 (SEQ ID NO.7), or Asp96 in MdPGGT1.2 (SEQ ID NO.7) is replaced by Glu96 in MdPGGT1.1 (SEQ ID NO.6), the activities of the two proteins will also be exchanged, that is, the mutated MdPGGT1.1 (SEQ ID NO.6) obtains the activity of glycosylated phlorizin, while the mutated MdPGGT1.2 (SEQ ID NO.7) loses the activity of glycosylated phlorizin. When Glu125, Ala334 and Gln424 in MdPGGT1.1 (SEQ ID NO.6) are replaced by Gln125, Val334 and Arg424 in MdPGGT1.2 (SEQ ID NO.7), or Gln125, Val334 and Arg424 in MdPGGT1.2 (SEQ ID NO.7) are replaced by Glu125, Ala334 and Gln424 in MdPGGT1.1 (SEQ ID NO.6), the activities of the two proteins will not change.

[0055] Therefore, the active protease of the present application has Asp at the 96th amino acid position encoded by the above reference sequence. At this time, this type of protease has the corresponding catalytic activity, and mutations at positions 125, 334 or 424 are not restricted and do not affect the activity.

[0056] In some specific embodiments of the present application, the sequence of the protease can be an amino acid sequence as shown in any one of SEQ ID NOs. 6-10, or an amino acid sequence having at least 95% homology with any one of SEQ ID NOs. 6-10.

[0057] In some more specific embodiments, the protease of the present application also includes: a protease as shown in SEQ ID NO.6, and 96Glu of SEQ ID NO.6 is replaced by 96Asp; in some preferred embodiments, 125Glu, 334Ala or 424Gln of SEQ ID NO.6 can be further replaced by 125Gln, 334Val or 424Arg, etc.

[0058] In other specific embodiments, the protease of the present application also includes: a protease as shown in SEQ ID NO.7-10, wherein 125Gln, 334Val or 424Arg of SEQ ID NO.7-10 can be further replaced by 125Glu, 334Ala or 424Gln, etc.

[0059] It is to be understood that the above-mentioned specific protein sequence does not limit the present application. In the embodiments of the present application, it has been verified and confirmed through mutation experiments from multiple sequences: the nucleic acid sequence at the chr10:16473722-16475131 or chr15:16963589-16966336 position of the corresponding reference genome GDDH13 v1.1, when translated into the corresponding protein, when the 96th position of the corresponding protein is Asp, the protein has the phlorizin glycosylation activity of catalyzing phlorizin to synthesize phlorizin 2'-O-xylose glucoside.

[0060] The gene of the present application encodes any of the above-mentioned proteases.

[0061] In some embodiments, the phlorizin glycosylation gene has at least 95% homology with SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5; in some preferred embodiments, the phlorizin glycosylation gene is as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5.

[0062] In some embodiments, the glycosylation gene of phloridzin is derived from the genus Malus; in some specific embodiments, it is derived from Malus chinensis, Malus xifuensis, Malus donghongensis, etc. Further, the glycosylation gene of phloridzin can be applied to the biosynthesis and separation and extraction of phloridzin 2'-O-xylose glucoside.

[0063] The recombinant vector of the present application comprises the nucleic acid sequence of any of the above-mentioned glycosylation genes.

[0064] In some embodiments, the vector is an expression vector. In some preferred embodiments, the expression vector includes a prokaryotic expression vector or a eukaryotic expression vector; in some specific embodiments, the expression vector includes but is not limited to: a prokaryotic expression vector Pet28a or an overexpression vector pCambia 2300.

[0065] The recombinant cell or recombinant microorganism of the present application comprises the above-mentioned recombinant vector. In some specific embodiments, the recombinant cell or recombinant microorganism is Escherichia coli BL21 (DE3) or Agrobacterium GV3101.

[0066] The application of the present application includes the application of the above-mentioned protease or gene in the following aspects:

[0067] 1) Application in the synthesis of phloretin 2'-O-xylosyl glucoside;

[0068] 2) Application in the separation and extraction of phloretin 2'-O-xylose glucoside.

[0069] Furthermore, the synthesis includes catalytic synthesis or biological synthesis.

[0070] The method for biosynthesizing phlorizin 2'-O-xylose glucoside of the present application comprises the step of overexpressing the phlorizin glycosylation gene; preferably, the overexpression is derived from eukaryotic expression or prokaryotic expression; more preferably, the expression is in a plant, including but not limited to apple trees or tobacco plants.

[0071] It can be understood that the examples of the present application have confirmed that the proteases expressed in apples and tobacco after eukaryotic expression can catalyze the synthesis of phloretin 2'-O-xylose glucoside in plants. Therefore, the biosynthesis of phloretin 2'-O-xylose glucoside is not limited to plant hosts, as long as the substrate phloretin and UDP-xylose are present (endogenous presence or exogenous injection, etc.), the corresponding catalytic synthesis can be achieved, and the biosynthesis method of the present application is not limited to plants.

[0072] The method for separating and extracting phloretin 2'-O-xylose glucoside of the present application comprises the above-mentioned biosynthesis step, and further comprises the step of separating and extracting phloretin 2'-O-xylose glucoside from plant leaves. Preferably, the above-mentioned plant is particularly a member of the genus Malus.

[0073] The following are specific examples.

[0074] Example 1. Screening of phlorizin glycosylation genes and in vitro catalytic synthesis of phlorizin 2'-O-xylose glucoside

[0075] Based on the characteristic of specific accumulation of phloretin 2'-O-xylosyl glucoside in fruits, in order to explore the key glycosyltransferase genes for the glycosylation of phloretin to synthesize phloretin 2'-O-xylosyl glucoside, the applicant conducted transcriptome sequencing on leaves and fruits of different germplasm resources of Malus plants (Malus domestica 'Golden Delicious', Malus honanensis, Malus yunnanensis, Malus prattii, Malus halliana and Malus sieboldii) and different tissues (roots, bark, fruit, leaves and petals) of Malus 'Winter Red'. The transcriptome results were divided into 10 groups. Sets 1-6 were the fruit vs. leaves of 'Golden Crown', Henan Begonia, Dianchi Begonia, Xishu Begonia, Weeping Begonia and Trifoliate Begonia, and Sets 7-10 were the fruit vs. petals, leaves, bark and roots of Winter Red Begonia. The differentially expressed genes in each group were screened under the conditions of padj<0.05 and |log2FoldChange|>2. The intersection of the differentially expressed genes in Sets 1-10 contained 110 genes ( Figure 1 Among them, there are two glycosyltransferase genes named PGGT1.1 (MD10G1101200) and PGGT1.2 (MD15G1211400). The expression levels of these two genes in the fruits of 'Golden Crown', Henan Begonia, Dianchi Begonia, Xishu Begonia, Weeping Begonia and Trifoliate Begonia were higher than those in the leaves ( Figure 2 ), and the expression level is high in the fruit of Malus donghongensis, but very low or even absent in other tissues ( Figure 3 ).

[0076] The fruits of Malus chinensis, Malus xifu and Malus donghong were collected and quickly frozen with liquid nitrogen, and RNA was extracted and reverse transcribed into cDNA. Primers PGGT-F: ATGGAGCGCAAAGATGAGAAGA; PGGT-R: TTAAGTTGAAGCGGGCCAAGTTTC were designed to amplify the target gene PGGT. The cDNA of the fruits of Golden Crown, Malus xifu and Malus donghong was used as a template for amplification and connected to the PMD-19T (Takara) vector for sequencing, and five sequences were obtained.

[0077] Among them, the gene sequence of the golden crown MdPGGT1.1 is shown in SEQ ID NO.1, and the sequence corresponds to chr10:16473722-16475131 (gene number MD10G1211400) of the golden crown reference genome GDDH13 v1.1, and the amino acid sequence encoded by it has an amino acid similarity of 95% with that of the Malus xifu MmPGGT1.1 and an amino acid similarity of 96% with that of the Malus donghong MwPGGT1.1;

[0078] The obtained gene sequence of Golden Crown MdPGGT1.2 is consistent with that of Malus mongolica MmPGGT1.2, as shown in SEQ ID NO.2. The sequence corresponds to chr15:16963589-16966336 (gene number MD15G1101200) of the Golden Crown reference genome GDDH13 v1.1, and the amino acid sequence it encodes has an amino acid similarity of 96% with that of Malus mongolica MwPGGT1.2.

[0079] Specifically, the gene sequences of MdPGGT1.1, MdPGGT1.2 / MmPGGT1.2, MmPGGT1.1, MwPGGT1.1, and MwPGGT1.2 are shown in SEQ ID NOs.1-5, respectively, and the encoded amino acid sequences of MdPGGT1.1, MdPGGT1.2 / MmPGGT1.2, MmPGGT1.1, MwPGGT1.1, and MwPGGT1.2 are shown in SEQ ID NOs.6-10, respectively.

[0080] The full-length CDS sequence of the PGGT gene was further connected to the Pet28a vector by one-step cloning (Vazyme ligase-independent single-fragment rapid cloning kit) and transformed into the Escherichia coli BL21 (DE3) strain. The positive colonies were activated and induced with 0.8 mM IPTG for 24 h (18 °C, 120 rpm). The bacterial solution was centrifuged to remove the supernatant, resuspended in a buffer (50 mM NaH2PO4, 30 mM NaCl, 20 mM imidazole, adjusted to pH 8.0 with NaOH) and added to a final concentration of 2 mg L -1 Lysozyme was incubated at 37°C for 30 minutes, frozen and thawed three times in liquid nitrogen, centrifuged at 4°C and 12000g for 10 minutes, and the supernatant was used to measure enzyme activity. The substrates phlorizin and UDP-xylose were added to the enzymatic reaction solution at a final concentration of 0.5mM, 100μl of enzyme solution, and 90μl of 50mM Tris-HCl (pH 8.5). After mixing the components, incubate at 37°C for 20 minutes, add 10μl of 30% TCA to terminate the reaction, centrifuge and filter the reaction solution, and use high performance liquid chromatography to analyze the product phlorizin 2'-O-xylose glucoside.

[0081] The results showed that MdPGGT1.2 / MmPGGT1.2 of Jinguan and H. chinensis, MmPGGT1.1 of H. chinensis, and MwPGGT1.1 and MwPGGT1.2 of H. chinensis all had the activity of catalyzing the synthesis of phloridzin 2'-O-xylosyl glucoside from phloridzin and UDP-xylose in vitro, but MdPGGT1.1 of Jinguan did not have this catalytic activity ( Figure 4 ).

[0082] Example 2, mutation experiment

[0083] The amino acid sequences of PGGT1.1 and PGGT1.2 amplified from Malus japonicus, Malus donghong and Malus xifu, which have catalytic glycosylation activity of phlorizin, and the amino acid sequences of MdPGGT1.1 of Malus japonicus, which have lost this catalytic activity, were compared. It was found that there were four amino acid differences between the sequences with and without catalytic activity of PGGT1.1 and PGGT1.2, which corresponded to Glu96, Glu125, Ala334, Gln424 in MdPGGT1.1 (corresponding to positions 16474009-16474011, 16474094-16474096, 16474722-16474724, 16474992-16474994 on chromosome 10 of the reference genome GDDH13 v1.1) and Asp96, Gln125, Val334, Arg424 ( Figure 5 ); corresponding to positions 16963876-16963878, 16963961-16963963, 16964589-16964591, and 16964859-16964861 of chromosome 15 of the reference genome GDDH13 v1.1.

[0084] After mutation of the four amino acids, the results of enzyme activity assay showed that when Glu96 in MdPGGT1.1 was replaced by Asp96 in MdPGGT1.2, or Asp96 in MdPGGT1.2 was replaced by Glu96 in MdPGGT1.1, the activities of the two proteins would be exchanged, that is, the mutated MdPGGT1.1 acquired the activity of glycosylated phlorizin, while the mutated MdPGGT1.2 lost the activity of glycosylated phlorizin. When Glu125, Ala334 and Gln424 in MdPGGT1.1 were replaced by Gln125, Val334 and Arg424 in MdPGGT1.2, or Gln125, Val334 and Arg424 in MdPGGT1.2 were replaced by Glu125, Ala334 and Gln424 in MdPGGT1.1, the activities of the two proteins would not change ( Figure 6), it can be seen that when other basic sequences are consistent, the 96th amino acid plays a key role in the activity of glycosylated phlorizin.

[0085] Example 3: Genetic transformation of apple to obtain overexpression transgenic strains

[0086] Overexpression vector construction: The full-length CDS sequence of the PGGT gene was connected to the pCambia 2300 vector by one-step cloning (Vazyme ligase-independent single fragment rapid cloning kit), and the target gene was transcribed by the 35S promoter. The target gene PGGT was overexpressed in GL-3 apple seedlings by Agrobacterium-mediated leaf disc transformation.

[0087] The results showed that compared with the wild type, the target genes in the six PGGT overexpression lines were upregulated at the RNA level ( Figure 7 ), and the content of phloretin 2'-O-xylose glucoside increased significantly, about 20 mg g -1 FW( Figure 8 ).

[0088] Example 4: Separation and extraction of phloretin 2'-O-xylose glucoside

[0089] Phloretin 2'-O-xylose glucose was isolated and extracted from transgenic leaves overexpressing PGGT. The extraction process included five main steps: leaching, extraction (petroleum ether and ethyl acetate), polyamide column chromatography, Sephadex LH-20 column chromatography, and concentration and crystallization. Phloretin 2'-O-xylose glucose with a purity of >98% was obtained. Fig. 9 ). Due to the low sugar content in the leaves, phlorizin can be extracted into the ethyl acetate phase during ethyl acetate extraction, while phlorizin 2'-O-xylose glucoside is retained in the aqueous phase, which greatly reduces the difficulty of separating phlorizin 2'-O-xylose glucoside.

[0090] Example 5: Transient expression of tobacco to synthesize phloretin 2'-O-xylose glucoside

[0091] The applicant also transiently expressed the PGGT1.1 and PGGT1.2 genes of Golden Crown, Malus xifu and Malus donghong in Nicotiana benthamiana. After injection of the substrate phlorizin, compared with the empty vector, the tobacco leaves transiently expressing PGGT1.2 detected the production of the product phlorizin 2'-O-xylose glucoside, while the tobacco leaves transiently expressing Golden Crown MdPGGT1.1 did not detect the compound (see Figure 10-11 ).

[0092] From the above experiments, it can be seen that the series of glycosyltransferase genes PGGT1.1 and PGGT1.2 and their encoded proteases screened in this application have efficient catalytic activity of phlorizin and UDP-xylose, and can be used in the biosynthesis and separation and extraction of phlorizin 2'-O-xylose glucoside.

[0093] The foregoing description of the specific exemplary embodiments of the present application is for the purpose of illustration and illustration. These descriptions are not intended to limit the present application to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present application and its practical application, so that those skilled in the art can realize and utilize the various exemplary embodiments of the present application and various selections and changes. The scope of the present application is intended to be limited by the claims and their equivalents.

Claims

1. A protease, characterized in that The protease encoding gene is located at chr10:16473722-16475131 or chr15:16963589-16966336 of the reference genome GDDH13v1.

1.

2. The protease according to claim 1, characterized in that The protease is from the genus Malus; preferably from Golden Delicious, Malus chinensis or Malus frutescens.

3. The protease according to any one of claims 1 to 2, characterized in that The 96th position of the protease is Asp.

4. A phlorizin glycosylation gene, characterized in that: The gene encodes the protease according to any one of claims 1-3.

5. The phlorizin glycosylation gene according to claim 4, characterized in that The glycosylation gene of phlorizin is derived from the genus Malus; preferably, the glycosylation gene of phlorizin can be applied to the biosynthesis and separation and extraction of phlorizin 2'-O-xylose glucoside.

6. A recombinant vector, characterized in that: Comprising the sequence of the phlorizin glycosylation gene according to any one of claims 4-5.

7. A recombinant cell, characterized in that Comprising the recombinant vector according to claim 6.

8. Any of the following uses of the protease according to any one of claims 1 to 3 or the phlorizin glycosylation gene according to any one of claims 4 to 5: 1) Application in the synthesis of phloretin 2'-O-xylosyl glucoside; 2) Application in the separation and extraction of phloretin 2'-O-xylose glucoside.

9. A method for biosynthesizing phloretin 2'-O-xylose glucoside, characterized in that: The method comprises the step of overexpressing the phlorizin glycosylation gene according to any one of claims 4 to 5.

10. A method for separating and extracting phloretin 2'-O-xylose glucoside, characterized in that: The method comprises the steps of claim 9, and further comprises the step of separating and extracting phloretin 2'-O-xylose glucoside from plant leaves.

Images