Tobacco polyphenol oxidase gene NtPPO15 and application thereof in inhibiting browning of tobacco and improving ripening resistance and baking resistance of tobacco

Abstract

The invention provides a tobacco polyphenol oxidase gene NtPPO15 and application of the tobacco polyphenol oxidase gene NtPPO15 in inhibiting browning of tobacco and improving ripening resistance and baking resistance of the tobacco. According to the invention, a key gene NtPPO15 related to tobacco browning and baking resistance is screened through experiments, the activity of an NtPPO15 promoter and a gene expression site are further explored by constructing a GUS dyeing vector, and the function of the gene is deeply studied through gene editing and overexpression. Experiments prove that the NtPPO15 gene provided by the invention is a key gene related to browning in a tobacco maturing and baking process, and by regulating and controlling the expression quantity of the NtPPO15 gene, the browning of the tobacco can be controlled, the maturing resistance and baking resistance of the tobacco can be improved, the quality of a tobacco product can be improved, the harvesting frequency can be reduced, and the economic benefit can be greatly improved; and the method can also be used for screening tobacco varieties with excellent quality, so that the method has a good and wide market application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of tobacco genes, and specifically relates to tobacco polyphenol oxidase genes. NtPPO15 And its application in inhibiting tobacco browning and improving tobacco's resistance to ripening and baking. Background Art

[0002] The baking characteristics of tobacco leaves are an inevitable manifestation of the quality differences of fresh tobacco. The baking characteristics of tobacco leaves can be summarized into two aspects: "easy to bake" and "baking resistance". "Easy to bake" mainly reflects the yellowing characteristics of tobacco leaves and the ease of coloring after yellowing. Tobacco leaves that are more likely to turn yellow and fix color are considered easy to bake, while the opposite is considered difficult to bake. "Baking resistance" mainly refers to the sensitivity or tolerance of tobacco leaves to the baking environment during the coloring stage. Tobacco leaves that are not sensitive to the coloring environment and are not easy to turn brown are considered to have good baking resistance, otherwise they are considered to be not baking resistance. The baking ease and baking resistance of tobacco leaves are significantly affected by genetic factors. Due to different genetic bases, some varieties are easy to bake, tobacco leaves with good baking resistance have lower PPO activity, and tobacco leaves with poor baking resistance have higher PPO activity.

[0003] During the baking process, the color of tobacco leaves gradually changes from yellow to brown, or even brown. This is because the substances contained in the tobacco leaves are converted into a class of dark substances under the action of oxidase. This complex process is called tobacco enzymatic browning reaction. The occurrence of tobacco enzymatic browning reaction is closely related to the quality of tobacco. The color-fixing characteristics of tobacco leaves are usually measured based on whether the tobacco leaves are prone to browning after entering the color-fixing period after baking. Tobacco enzymatic browning reaction will cause a series of adverse effects on tobacco quality. In this process, the yellow color of tobacco leaves will gradually be lost, and different degrees of variegated colors will gradually appear. Tobacco leaves will be ash-covered, steamed, and black dregs will follow one after another; at the same time, it will also cause the tobacco leaves to become thinner, lighter, and much worse in elasticity, increase in crushing degree, and weaken in combustion power, which will seriously reduce the quality of tobacco leaves.

[0004] At the same time, improving the maturity resistance of tobacco leaves in the mature stage can reduce the number of harvests, promote the integration of agricultural machinery and agronomy, cultivate varieties with relatively concentrated maturity, and solve the key difficulties that restrict mechanization.

[0005] At present, the regulation of tobacco enzymatic browning reaction is mainly carried out through two aspects. One is to regulate the oxygen concentration of the environment. The speed of the reaction can be effectively regulated by controlling the oxygen concentration in the curing room. The other is to regulate the activity of tobacco leaf polyphenol oxidase. The means of regulating tobacco leaf PPO activity are mainly concentrated on reducing the activity of polyphenol oxidase by adjusting the temperature and relative humidity in the environment, adjusting the pH value of the environment, or using some physical and chemical methods such as PPO inhibitors, and using genetic means to reduce the activity of polyphenol oxidase, thereby reducing the occurrence of enzymatic browning reaction. There are few reports on this research. Summary of the invention

[0006] In view of the above-mentioned status in the prior art, the purpose of the present invention is to provide a tobacco polyphenol oxidase gene NtPPO15 And its application in inhibiting tobacco browning and improving tobacco's resistance to ripening and baking.

[0007] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions: The invention provides tobacco polyphenol oxidase gene NtPPO15 , whose nucleotide sequence is shown in SEQ ID NO.1.

[0008] Further, the tobacco polyphenol oxidase gene is amplified NtPPO15 The primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.7.

[0009] The invention provides tobacco polyphenol oxidase NtPPO15 , and its amino acid sequence is shown in SEQ ID NO.2.

[0010] The invention provides a method for driving tobacco polyphenol oxidase gene NtPPO15 The promoter for expression has a nucleotide sequence as shown in SEQ ID NO.3.

[0011] Furthermore, the primer sequences for amplifying the promoter are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0012] The present invention also provides the tobacco polyphenol oxidase gene NtPPO15 Application in inhibiting tobacco browning and improving tobacco's resistance to ripening and baking.

[0013] Compared with the prior art, the advantages and technical effects of the present invention are as follows: the present invention first screens out the key genes related to tobacco browning during the maturity and baking periods. NtPPO15 ; We further explored the NtPPO15 Promoter activity and gene expression site; by constructing NtPPO15 The specific localization of NtPPO15 protein at the subcellular level was studied by fusing GFP protein; and the function of the gene was studied in depth by gene editing and overexpression. NtPPO15 The gene is a key gene related to the browning of tobacco during ripening and baking. NtPPO15 The expression level of the gene can control the browning of tobacco, improve its resistance to ripening and baking, improve the quality of tobacco products, greatly improve economic benefits, and can also be used to screen tobacco varieties with excellent quality, so it has good and broad market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0015] Figure 1 It is the color change of tobacco leaves during the dark treatment in the dark box experiment; Figure 2 It is the expression result of 12 tobacco PPO genes in the present invention; Figure 3 It is the dark box processing time of 0h, 24h, 48h, 72h and 96h NtPPO15 The expression level of the gene; Figure 4 yes NtPPO15 Promoter amplification map; Figure 5 This is the GUS staining of leaf tissue of T0 generation of promoter transgenic tobacco; Figure 6 yes NtPPO15 Subcellular localization results of genes; Figure 7 Identification of overexpression positive strains (7A) and NtPPO15 Gene expression results (7B) (WT: Nicotiana tabacum K326); Figure 8 yes NtPPO15 Appearance comparison between the overexpression strain and common tobacco K326; Fig. 9 is the control (WT) and NtPPO15 Color changes of the middle leaves of the overexpressing materials; Fig.10 yes NtPPO15 Results of PPO activity in the middle leaves of the overexpression strain and the control (WT) strain; Fig.11 is the control (WT) and NtPPO15 Color changes of leaves in the middle of the gene-edited material; Fig.12 yes NtPPO15 PPO activity results in the middle leaves of gene-edited lines and controls (WT). DETAILED DESCRIPTION

[0016] In order to improve the understanding of the present invention, the present invention is further described below through preferred embodiments. Those skilled in the art should understand that the content described below is illustrative rather than restrictive, and should not be used to limit the scope of protection of the present invention.

[0017] Example 1: Transcriptome changes in tobacco leaves in response to dark stress 1. Dark box test

[0018] The dark box test reflects the baking ease and baking resistance of flue-cured tobacco based on the yellowing and browning rate of tobacco leaves in a dark box environment. The present invention uses common tobacco K326 as the test material, designs a dark box test, and uses transcriptome sequencing technology to study the changes in gene expression during the browning process of tobacco leaves, explore the expression changes of key genes in the metabolic pathway related to the browning of tobacco leaves, and analyze the transcriptional regulation mechanism of tobacco leaf browning.

[0019] According to the requirements of the dark box test in tobacco industry standard YC / T 311-2009, a dark, sealed dark box was built. A 1.2m*0.75m rectangular carton was used, wrapped with black film, and placed in a dark room to keep it in a dark, airtight, room temperature environment; 3 fresh tobacco leaves of K326 with the same maturity in the middle (3 replicates) were placed in a dark box at room temperature. Every 12 hours in the early stage and every 24 hours in the later stage, the tobacco leaves were taken out and placed in the same place with good lighting for observation and photography until the tobacco leaves turned 30% brown. Samples were taken every 24 hours and stored in a -80 °C refrigerator for use in transcriptome sequencing.

[0020] The phenotype of tobacco leaves was observed under dark box treatment conditions. The color changes of tobacco leaves during dark stress were as follows: Figure 1 As shown, Figure 1 The results showed that tobacco leaves began to turn brown at 60-72 hours.

[0021] 2. Analysis of transcription level of polyphenol oxidase gene in tobacco leaves under dark box treatment In order to clarify which polyphenol oxidase genes in tobacco leaves are involved in the dark stress response, the present invention performed expression analysis on the 12 PPO genes identified in tobacco, and used HTSeq to statistically compare the Read Count value on each gene as the original expression of the gene. The Reads count is positively correlated with the actual expression level of the gene, as well as the length of the gene and the sequencing depth. In order to make the gene expression levels of different genes and different samples comparable, FPKM was used to standardize the expression level (Nosrmalization). FPKM (Fragments Per Kilo bases per Million fragments) is the number of fragments per kilobase length from a certain gene per million fragments, and a heat map was drawn according to the FPKM value. The results are as follows: Figure 2 As shown, from Figure 2 It can be seen that among the 12 NtPPO genes, NtPPO15 As darkness stress progresses, the expression level is significantly increased. NtPPO15 Genes specifically involved in the browning response of tobacco leaves.

[0022] 3. qRT-PCR validation of transcriptome data

[0023] To verify the differentially expressed key genes screened in transcriptome sequencing analysis, qRT-PCR technology was used to analyze the differentially expressed genes in samples treated with dark box for 0h, 24h, 48h, 72h and 96h. NtPPO15 Gene expression was verified. Figure 3 The experimental results show that after 72 hours of dark box treatment, NtPPO15 The expression level was significantly upregulated, and qRT-PCR analysis further showed that under dark stress NtPPO15 Genes associated with tobacco leaf browning and baking tolerance.

[0024] Embodiment 2: NtPPO15 Expression pattern analysis and gene function studies

[0025] 1. Amplification NtPPO15 Gene promoter For in-depth research NtPPO15 The expression characteristics and regulatory mechanisms of genes were first cloned NtPPO15 The promoter (such as Figure 4 ), and the cloned sequences were analyzed.

[0026] by NtPPO15 The 5′-upstream sequence of NtPPO15 -F / R: Pro NtPPO15 -F: AGGCACAGCAATGATGAG (SEQ ID NO.4); Pro NtPPO15 -R:AGGAATGACCACCAACAATA(SEQ ID NO.5); From the genome of Nicotiana tabacum K326, primers Pro NtPPO15 -F / R clones obtained fragments, clone sequencing analysis showed NtPPO15 The gene promoter fragment is 2145 bp long (as shown in SEQ ID NO.3). The sequence was imported into the PlantCARE database. NtPPO15 Analysis of the cis-acting elements in the promoter region revealed that in addition to a large number of TATA boxes and CAAT boxes found in general promoters, and a large number of light-responsive elements (I-box, LTR, G-Box, GA-motif, GATA-motif, GT1-motif, etc.), the sequence also had many specific response elements.

[0027] 2. Promoter function analysis and construction of plant expression vector Will NtPPO15 The promoter amplification product was purified and connected to the TA cloning vector to obtain pro NtPPO15-TA, using primer 1301- with linker NtPPO15 -pro_F / R, with pro NtPPO15 -TA was used as template for PCR amplification, and the product was recovered by gel cutting. The PCAMBIA1301 vector was cut with BamHI and NcoI, the 35S promoter on the vector was removed, and gel recovery was performed. NtPPO15 The promoter sequence was connected to PCAMBIA1301, transformed into DH5α competent cells by heat shock method, identified by colony PCR, expanded culture, extracted plasmids, and sequenced. NtPPO15 -PCAMBIA1301 for genetic transformation of tobacco.

[0028] 1301- NtPPO15 -pro_F: aattcgagctcggtacccggggatccAGGCACAGCAATGATGAG(BamHI) 1301- NtPPO15 -pro_r:ttaccctcagatctaccatggTATAACTTTTAATTGGTTTAGGGTGT(NcoI) The results are as follows Figure 5 As shown, NtPPO15 The promoters of GUS gene can regulate the expression of GUS gene in leaves and flowers. Further observation of leaves under microscope revealed that the vascular bundles and glandular hairs in the leaves were darker blue, so NtPPO15 The expression in leaves and vascular bundles is higher than that in surrounding tissues. NtPPO15 The promoter can drive the GUS gene to express in sepals, petals, stamens and pistils, among which the expression level is higher in sepals, partially expressed in petals, expressed in anthers in stamens, not expressed in filaments, and expressed in the top of the style and part of the stigma in the pistil.

[0029] Example 3: Subcellular localization In order to determine the specific localization of NtPPO15 protein at the subcellular level, green fluorescent protein GFP was used as a reporter protein. NtPPO15 The C-terminal fusion GFP fluorescent protein gene was used to cut the PCAMBIA35S-EGFP vector with KpnI, and the target gene was connected to the vector by seamless cloning method, and transformed into Escherichia coli DH5α. Positive colonies were obtained after colony PCR identification. The fusion expression plasmid obtained by sequencing verification was NtPPO15 -PCAMBia35S-EGFP was transformed into Agrobacterium GV3101 and transiently expressed in Nicotiana benthamiana. The GFP fluorescence signal was detected using a laser confocal microscope to verify the subcellular localization of the NtPPO15 protein. Figure 6 ,show NtPPO15 -PCAMBia35S-EGFP fusion protein is mainly localized in chloroplasts.

[0030] Example 4: Gene overexpression experiment

[0031] 1. Cloning of target gene and construction of vector The present invention provides NtPPO15 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the corresponding protein is shown in SEQ ID NO.2. The cDNA extracted from common tobacco K326 treated in a dark box experiment for 72 hours was used as a template to amplify NtPPO15 Gene coding sequence, amplification of the NtPPO15 The upstream and downstream primer sequences of the gene are shown in SEQ ID NO.6 and SEQ ID NO.7. NtPPO15 -KpnI-F / R construct contains the target fragment NtPPO15 Gene overexpression recombinant vector NtPPO15 -PCAMBIA35S-eGFP, and transformed into E. coli DH5α. After the positive strains were expanded and cultured, the plasmids were extracted and transformed into Agrobacterium, and then infected tobacco leaves.

[0032] NtPPO15 -F: ATGGCTTCTCTTCCACTCCCC (SEQ ID NO.6); NtPPO15 -R: TCAATCCTCAAGCACAATCTTGACTCC (SEQ ID NO.7); NtPPO15 -KpnI-F: ACGAACGATAGCCATGGTACCAATGGCTTCTCTTCCACTCCCC (SEQ IDNO.8); NtPPO15 -KpnI-R: ATGTTAACAAGGCCTGGTACCTCAATCCTCAAGCACAATCTTGACTCC (SEQ ID NO. 9).

[0033] 2. Screening of positive seedlings of T0 generation plants The primers were designed as follows, and the genomic DNA of the regenerated seedlings was extracted and used as a template for PCR amplification verification.

[0034] 35s-F: AGCAAGTGGATTGATGTGA; NtPPO15-OE-R: GGTGGAAAGGAAGGAAAAGC Agrobacterium-mediated genetic transformation of tobacco resulted in overexpression of NtPPO15 ( NtPPO15 -OE) 15 plants were selected, and DNA was extracted from young leaves of T0 plants for PCR reaction. Figure 7 As shown in A, 15 strains NtPPO15 -OE can amplify the band, while the negative control wild-type plant can not amplify the band, indicating that 15 strains NtPPO15 -OE transgenic seedlings were all positive seedlings.

[0035] Total RNA was extracted from leaves of transgenic positive seedlings and reverse transcribed into cDNA for fluorescence quantitative PCR analysis. The quantitative primers should be: RT NtPPO15 -F:TTCCTCCACCATCAACCA;RT NtPPO15 -R: CACCATCACAATAAGCACAA. The results showed that 13 strains NtPPO15 The expression levels of the overexpression strains were significantly higher than those of wild-type tobacco, and the strains NtPPO15 -OE-8 has the highest expression level ( Figure 7 B).

[0036] 3. Phenotypic analysis of overexpression strains under dark box treatment NtPPO15 There was no significant difference in plant type and appearance between the overexpression strain and the common tobacco K326, e.g. Figure 8 As shown. NtPPO15 The middle leaves of the -OE overexpression positive plants and the control K326 plants were treated with darkness to observe the leaf browning phenotype and evaluate the tobacco leaf baking resistance. Fig. 9 shown.

[0037] The results are shown in Table 1. During the dark box treatment for 0-72 h, the green area of ​​the middle leaves gradually decreased, while the yellow area gradually increased. At 72 h, the tobacco leaves turned completely yellow, and NtPPO15 -OE tobacco leaves turned yellow by 81.05%, higher than the control (71.95%). The browning of the middle tobacco leaves mainly occurred after yellowing (72 h), and the browning degree gradually stabilized from 168 to 192 h. NtPPO15 -OE overexpression strain tobacco leaves turned brown significantly more than the wild-type control. NtPPO15 The browning area of ​​tobacco leaves of -OE strain was 76.15%, while that of the control was 53.21%.

[0038] Table 1 The percentage of color change area in the middle leaves of overexpression materials and wild-type tobacco under dark box treatment

[0039] 4. Determination of polyphenol oxidase activity The polyphenol oxidase (PPO) kit (Suzhou Grace Biotechnology Co., Ltd., catalog number G0113W) was used to dark-box the NtPPO15 -OE overexpressing strain and wild-type strain were subjected to PPO activity assay.

[0040] Weigh 0.1 g of dried sample (the sample was inactivated at 105°C for 3 min, then dried at 60°C to constant weight, crushed, and passed through a 40-60 mesh sieve to obtain a dried sample), add 1 mL of the extract, homogenize in an ice bath, centrifuge at 4°C × 12000 rpm for 15 min, take the supernatant, and determine the polyphenol oxidase activity.

[0041] The results are as follows Fig.10 As shown, at each time point after dark box treatment, NtPPO15 The PPO activity in the middle leaves of the -OE overexpressing strain was higher than that of the WT, and the PPO activity was highest at 72h.

[0042] Example 6: Gene Editing

[0043] 1. Gene knockout According to tobacco NtPPO15 The gene sequence (shown in SEQ ID NO.1) was used to design the knockout target. NtPPO15 The target sequence design is shown in Table 2; the CRISPR / Cas expression vector backbone was linearized and connected to the annealing product, which was introduced into the downstream of the U6 promoter and the upstream region of the gRNA. The vector also enhanced the expression of the Cas9 protein through two tandem strong 35S promoters.

[0044] Table 2 Gene editing vector target site sequences

[0045] Constructed NtPPO15 -CRISPR / Cas9 recombinant plasmid was transformed into tobacco by Agrobacterium-mediated transformation. DNA was extracted from T0 plants and PCR amplified and then subjected to Sanger sequencing (Shenzhen BGI Co., Ltd.). The primers used are shown in Table 3; Table 3 Gene editing detection primers

[0046] The sequencing results showed that 6 strains were obtained. NtPPO15 Gene knockout plants, one of which is homozygous NtPPO15 -4-GE, the mutation type is the insertion of a base. As shown in Table 4: Table 4 Types of homozygous mutations after gene editing

[0047] 2.NtPPO15 -GE knockout plant phenotype analysis Select T0 generation at the bud stage NtPPO15 The middle leaves of the gene-edited strains and wild-type control plants were treated with darkness to observe the browning phenotype and evaluate the baking resistance of tobacco leaves. Fig.11 As shown in Table 5. Similarly, the proportion of green area, yellow area and brown area of ​​tobacco leaves was determined. The results showed that during the dark box treatment process, NtPPO15 Over time, the green area of ​​leaves of both the knockout strain and the WT gradually decreased, the yellow area increased, and the browning degree of tobacco leaves showed an overall upward trend. NtPPO15 The middle leaves of the knockout strain turned completely yellow, and then the leaves showed obvious browning after 120 h. At 192 h, the browning degree of WT was 60.5%. NtPPO15 -GE is 23.9%. Overall, the middle lobe NtPPO15 The degree of browning in the gene knockout strain was significantly reduced compared with the control WT, indicating that the baking resistance of tobacco leaves was significantly improved.

[0048] Table 5 The percentage of color change area of ​​the middle leaves of gene-edited materials and wild-type tobacco under dark box treatment

[0049] 4. Analysis of polyphenol oxidase activity in gene-edited materials The PPO activity of leaves treated in the dark box was further determined. Fig.12 As shown, it can be seen that during the entire dark processing process, NtPPO15 The PPO activity of the gene-edited strain was lower than that of the control group WT; at 96 h, NtPPO15 The PPO activity of -GE strain was significantly lower than that of the control.

[0050] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. Tobacco polyphenol oxidase gene NtPPO15 , characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The tobacco polyphenol oxidase gene according to claim 1 NtPPO15 , characterized in that, Amplification of the tobacco polyphenol oxidase gene NtPPO15 The primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.

7.

3. Tobacco polyphenol oxidase NtPPO15, characterized in that Its amino acid sequence is shown in SEQ ID NO.

2.

4. Driving tobacco polyphenol oxidase gene NtPPO15 The promoter for expression is characterized in that Its nucleotide sequence is shown in SEQ ID NO.

3.

5. The promoter according to claim 4, characterized in that The primer sequences for amplifying the promoter are shown in SEQ ID NO.4 and SEQ ID NO.

5.

6. The tobacco polyphenol oxidase gene according to claim 1 NtPPO15 Application in inhibiting tobacco browning and improving tobacco's resistance to ripening and baking.

7. The use according to claim 4, characterized in that: The application is to reduce the gene through gene editing NtPPO15 The expression level of the gene is increased, thereby inhibiting tobacco browning and improving the ripening and baking resistance of tobacco leaves.

8. The use according to claim 5, characterized in that: The gene editing includes gene knockout, gene design NtPPO15 Targeted knockout sites ， In the gene NtPPO15 Inserting a mutant base into the gene NtPPO15 Expression inactivation.

9. The use according to claim 8, characterized in that: Gene NtPPO15 The knockout target sequences are shown in SEQ ID NO.10 and SEQ ID NO.

11.

10. The tobacco polyphenol oxidase gene according to claim 1 NtPPO15 Application in screening tobacco varieties with low browning, ripening resistance and baking resistance.

Images