Recombinant oncolytic virus for expressing bispecific or trispecific single-chain antibody and application of recombinant oncolytic virus

Abstract

The invention relates to the technical field of biological medicines, in particular to a recombinant oncolytic virus for expressing a bispecific or trispecific single-chain antibody and application of the recombinant oncolytic virus. The recombinant oncolytic virus comprises an antibody gene integrated into a virus skeleton of the recombinant oncolytic virus; the antibody gene comprises a target antibody gene targeting tumor cells and at least one antibody gene targeting immune cells. When the antibody gene comprises a target antibody gene targeting tumor cells and an antibody gene targeting immune cells, the antibody gene is a bispecific antibody; when the antibody gene comprises a target antibody gene targeting tumor cells and two antibody genes targeting immune cells, the antibody gene is a trispecific antibody. According to the present invention, the coding gene having the bispecific single-chain antibody or the trispecific single-chain antibody is integrated in the modified oncolytic virus, such that the gene of the bispecific single-chain antibody or the trispecific single-chain antibody can be expressed in vivo so as to further improve the tumor cell treatment effect.

Description

Technical Field

[0001] The present application relates to the technical field of biomedicine, and in particular, to a recombinant oncolytic virus expressing a bispecific or trispecific single-chain antibody and its application. Background Art

[0002] Oncolytic viruses are a type of tumor-killing virus with replication ability, and are now accepted by the public as an important branch of tumor immunotherapy. Oncolytic viruses can specifically target and infect tumor cells, for example, by taking advantage of the inactivation or defects of oncolytic virus genes in tumor cells to selectively infect tumor cells; after oncolytic viruses infect tumor cells, they will replicate in large quantities in tumor cells and eventually destroy tumor cells, thereby killing tumor cells. At the same time, oncolytic viruses can also provide the immune stimulation signals necessary for the host's own anti-cancer response, thereby attracting more immune cells to continue to kill residual tumor cells.

[0003] Although oncolytic viruses have good application prospects in tumor immunotherapy, wild-type oncolytic viruses often cause damage and dysfunction of the body's tissues and organs. In the process of using wild-type viruses to infect tumor cells, there is still a great risk of pathogenicity.

[0004] Therefore, in order to further promote the clinical application of oncolytic viruses, it is necessary to transform the wild-type oncolytic viruses to obtain attenuated oncolytic viruses. The attenuated oncolytic viruses are used in clinical applications to reduce the pathogenic risk of oncolytic viruses and improve the safety of oncolytic viruses. However, in the process of oncolytic virus modification, if only the wild-type oncolytic viruses are randomly genetically modified, although their toxicity can be reduced, the modified oncolytic viruses may have a poor cure rate, and even the modified oncolytic viruses cannot be packaged, which is not conducive to promoting the clinical application of oncolytic viruses.

[0005] Therefore, it is necessary to conduct in-depth research on oncolytic viruses to further promote the clinical application of oncolytic viruses. Summary of the invention

[0006] In order to further improve the therapeutic effect of tumor cells, the present application provides a recombinant oncolytic virus expressing a bispecific or trispecific single-chain antibody and its application.

[0007] Oncolytic viruses are a type of tumor-killing virus with replication ability, and are currently accepted by the public as an important branch of tumor immunotherapy. Oncolytic viruses can specifically target and infect tumor cells, for example, by taking advantage of the inactivation or defects of oncolytic virus genes in tumor cells to selectively infect tumor cells; after oncolytic viruses infect tumor cells, they will replicate in large quantities in tumor cells and eventually destroy tumor cells, thereby killing tumor cells. At the same time, oncolytic viruses can also provide the immune stimulation signals necessary to enhance the host's own anti-cancer response, thereby attracting more immune cells to continue to kill residual tumor cells. Therefore, oncolytic viruses have the ability to break the tumor tissue microenvironment and turn "cold tumors" into "hot tumors."

[0008] Bispecific antibodies (BsAb) can specifically bind to two antigens or two different epitopes of the same antigen at the same time, so it can connect effector cells such as immune cells to tumor cells, thereby enhancing the killing effect on target cells; it can bind to different antigen epitopes on the same tumor cell to enhance its binding specificity while reducing adverse reactions caused by off-target toxicity; or it can bind to different immune checkpoints on the same immune cell, simultaneously blocking / activating downstream immune signaling pathways, activating or inhibiting immune cells.

[0009] Trispecific antibodies (TsAbs) can target three different target antigens or markers, and can also recruit immune cells to redirect tumors, thereby enhancing anti-tumor immunity. Compared with bispecific antibodies, trispecific antibodies can also bind to another target on the surface of tumor cells or immune cells, or bridge immune cells and block dual signaling pathways, which is more conducive to redirecting drugs or immune cells to tumor sites, enhancing binding specificity, improving targeting, and reducing off-target toxicity, thereby enhancing anti-tumor ability.

[0010] In addition, BiTEs (bispecific T cell engagers) are bispecific single-chain antibodies that use T cells as effector cells. They have two antigen-binding arms that can bind to T cells and target cells at the same time and activate T cells to kill diseased cells. Compared with other bispecific single-chain antibodies, BiTEs have better molecular flexibility and can better promote the connection between the CD3 complex and tumor targets. They are not constrained by T cell receptors and MHC class I molecules on target cells, and do not require the participation of co-stimulatory molecules. They are an antibody form with great application potential.

[0011] BiKEs (bi-specific killer cell engagers) are bispecific single-chain antibodies created by the fusion of anti-CD16 single-chain antibodies and anti-tumor-associated antigen single-chain antibodies, with NK cells as effector cells. These molecules directly activate and expand NK cells through CD16 to produce cytokines. Activated NK cells can eliminate tumor cells through three direct or indirect strategies: (a) release granules, such as secretory lysosomes, which contain perforins and granzymes, inducing cell membrane lysis or apoptosis; (b) activate target cell caspases through the interaction of tumor necrosis factor-related apoptosis-inducing ligand and Fas ligand on tumor cells; (c) secrete a variety of factors to regulate the functions of other immune cells and indirectly kill tumor cells.

[0012] BiME (bi-specific Macrophages engagers) can activate both M1 and M2 macrophages, targeting macrophages through optimized and screened SIRPα antibodies on the one hand, and targeting tumor-associated antigens on the other hand, taking a two-pronged approach. The bi-antibody drug molecules block the "anti-phagocytic" signal while activating the "phagocytic" signal by binding to Fc receptors, thereby transforming and activating the powerful phagocytic effect of tumor-associated myeloid cells.

[0013] The present application integrates a gene encoding a bispecific single-chain antibody or a trispecific single-chain antibody into a modified oncolytic virus, so that the gene of the bispecific single-chain antibody or the trispecific single-chain antibody can be expressed in vivo, thereby further improving the therapeutic effect on tumor cells.

[0014] The recombinant oncolytic virus expressing bispecific or trispecific single-chain antibodies and the application thereof provided in the present application adopt the following technical scheme:

[0015] A recombinant oncolytic virus expressing a bispecific or trispecific single-chain antibody and its application, wherein the recombinant oncolytic virus comprises an antibody gene integrated into its viral backbone; the antibody gene comprises a target antibody gene targeting tumor cells and at least one antibody gene targeting immune cells.

[0016] Furthermore, the immune cells are selected from any one or two of T cells, NK cells and macrophages.

[0017] Furthermore, when the immune cell is a T cell, the antibody gene targeting the immune cell is selected from any one or two of the following (a)-(b):

[0018] (a) CD3 antibody gene;

[0019] (b) T cell-related immune checkpoint antibody genes.

[0020] Furthermore, the T cell-related immune checkpoint antibody genes include inhibitor antibody genes and agonist antibody genes.

[0021] Furthermore, the inhibitor antibody gene is selected from any one or two of CTLA-4, PD-1, TIM3, BTLA, VISTA, and LAG3.

[0022] Furthermore, the agonist antibody gene is selected from any one or two of CD28, OX40, CD27, CD30, CD40, GITR, ICOS, 4-1BB, LIGHT, and CD28H.

[0023] Furthermore, when the immune cells are NK cells, the antibody genes targeting the immune cells are selected from any one or two of CD16a, NKG2D, CD94 / NKG2C, NKp30, NKp44, and NKp46.

[0024] Furthermore, when the immune cell is a macrophage, the antibody gene targeting the immune cell is an antibody gene of SIRPα.

[0025] Furthermore, the recombinant oncolytic virus includes any one or more of rhabdovirus, poxvirus, herpes simplex virus, measles virus, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus, echovirus, coxsackievirus, Newcastle disease virus and Maraba virus.

[0026] Furthermore, the recombinant oncolytic virus is obtained by site-directed mutagenesis based on the Vesicular Stomatitis Virμs (VSV).

[0027] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutagenesis based on VSV (Indiana Mudd Summer subtype).

[0028] Furthermore, the vesicular stomatitis virus includes M protein, G protein, N protein, P protein and L protein.

[0029] In the present application, the wild-type VSV virus Indiana MuddSummer subtype M protein comprises the amino acid sequence shown in SEQ ID NO 1.

[0030] Compared with the amino acid sequence shown in SEQ ID NO 1, 1) the amino acid substitutions of the M protein include G21E and N32S;

[0031] 2) the amino acid substitutions of the M protein include G21E, N32S, and M33A;

[0032] 3) the amino acid substitutions of the M protein include G21E, N32S, M33A, and N49D;

[0033] 4) the amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, and H54Y;

[0034] 5) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, H54Y, and L111A;

[0035] 6) the amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, H54Y, L111A, and A133T;

[0036] 7) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, H54Y, L111A, A133T, and V225I;

[0037] 8) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, and V225I;

[0038] 9) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, and V225I;

[0039] 10) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R;

[0040] 11) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R;

[0041] 12) The amino acid substitutions of the M protein include M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R;

[0042] 13) The amino acid substitutions of the M protein include N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R;

[0043] 14) The amino acid substitutions of the M protein include M51R, H54Y, L111A, A133T, V221F, V225I, and S226R;

[0044] 15) The amino acid substitutions of the M protein include H54Y, L111A, A133T, V221F, V225I, and S226R;

[0045] 16) The amino acid substitutions of the M protein include L111A, A133T, V221F, V225I, and S226R;

[0046] 17) The amino acid substitutions of the M protein include A133T, V221F, V225I, and S226R;

[0047] 18) The amino acid substitutions of the M protein include V221F, V225I, and S226R;

[0048] 19) The amino acid substitutions of the M protein include V225I and S226R;

[0049] 20) the amino acid substitution of the M protein comprises S226R;

[0050] 21) The amino acid substitutions of the M protein include N32S, N49D, H54Y, and V225I;

[0051] 22) The amino acid substitutions of the M protein include N32S, N49D, H54Y, V225I, and S226G;

[0052] 23) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, V221F, V225I, and S226R;

[0053] 24) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R;

[0054] 25) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R;

[0055] 26) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R;

[0056] 27) The amino acid substitutions of the M protein include G21E, N32S, N49D, M51A, H54Y, L111A, V225I, and S226R;

[0057] 28) The amino acid substitutions of the M protein include M51R, V221F, and S226R;

[0058] 29) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, deletion of the leucine encoding base at position 111, V221F, V225I, and S226R;

[0059] 30) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, L111A, V221F, V225I, and S226R;

[0060] 31) The amino acid substitutions of the M protein include G21E, N32S, N49D, M51R, H54Y, V221F, V225I, and S226R;

[0061] 32) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R;

[0062] 33) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R;

[0063] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 2.

[0064] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO 3.

[0065] In the present application, the wild-type VSV virus Indiana MuddSummer subtype G protein comprises the amino acid sequence shown in SEQ ID NO 4.

[0066] Compared with the amino acid sequence shown in SEQ ID NO 4, the site mutations of the G protein include any one or more of H38Y, V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0067] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 5.

[0068] In a specific embodiment, the G protein has an amino acid sequence as shown in SEQ ID NO 6.

[0069] In the present application, the wild-type VSV virus Indiana MuddSummer subtype N protein comprises the amino acid sequence shown in SEQ ID NO 7.

[0070] Compared with the amino acid sequence shown in SEQ ID NO 7, the site mutation of the N protein includes any one or more of I14V, R155K, and S353N.

[0071] In a specific embodiment, the N protein comprises the amino acid sequence shown in SEQ ID NO 8.

[0072] In the present application, the wild-type VSV virus Indiana MuddSummer subtype P protein comprises the amino acid sequence shown in SEQ ID NO 9.

[0073] Compared with the amino acid sequence shown in SEQ ID NO 9, the site mutations of the P protein include any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0074] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO 10.

[0075] In the present application, the wild-type VSV virus Indiana MuddSummer subtype L protein comprises the amino acid sequence shown in SEQ ID NO 11.

[0076] Compared with the amino acid sequence shown in SEQ ID NO 11, the site mutation of the L protein includes any one or more of S87P, I397T, I487T, and F873L.

[0077] In a specific embodiment, the L protein comprises the amino acid sequence shown in SEQ ID NO 12.

[0078] In a specific embodiment, the L protein comprises the amino acid sequence shown in SEQ ID NO 13.

[0079] In a specific embodiment, the L protein comprises the amino acid sequence shown in SEQ ID NO 14.

[0080] Further, the M protein comprises the amino acid sequence shown in any one of SEQ ID NOs 2-3; the G protein comprises the amino acid sequence shown in any one of SEQ ID NOs 5-6; the N protein comprises the amino acid sequence shown in SEQ ID NO 8; the P protein comprises the amino acid sequence shown in SEQ ID NO 10; and the L protein comprises the amino acid sequence shown in any one of SEQID NOs 12-14.

[0081] Furthermore, the injection method of the recombinant oncolytic virus includes, but is not limited to, any one or more of intratumoral injection, intravenous injection, intraperitoneal injection, thoracic injection, pelvic injection, subcutaneous injection, intrathecal injection, intramuscular injection, and intranasal administration.

[0082] Furthermore, the antibody expressed by the target antibody gene is the entire sequence or a partial sequence of the antibody.

[0083] Furthermore, the target antibody genes include genes for anti-hematological tumor antigen antibodies and genes for anti-solid tumor antigen antibodies.

[0084] Further, the solid tumor antigens include but are not limited to 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, CD24, CD28, CD137, CTLA-4, HER2, HER3, FAS, LGR5, C5aR1, A2AR, FGFR1, FGFR2, FGFR3, FGFR4, GITR, LTβR, TRAIL receptor 1, TRAIL receptor 2, PSMA, PSCA, CAIX, EGFR1, EGFRvIII, folate receptor, ephrin receptor, PDGFRa, ErbB2, ErbB3, CD2, CD40, CD74, CCAM5, CCAM6, p53, cMET, HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAG E-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp- B, hTERT, hTRT, iCE, MΜC2, P-cadherin, GDF8, Cripto, MΜC5AC, PRAME, P15, RΜ1, RΜ2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MΜM-1, MΜM-2, MΜM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FΜT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, DR5, PD-1, PD-L1, IGF-1R, CXCR4, NRP-1, GPC2, GPC3, EphA2, B7-H3, B7-H4, gpA33, SSTR 2. GD2, VEGF-A, VEGFR-2, PDGFR-a, RANKL, MSLNTROP2, FOLR1, AXL, CLDN18.2, MMC1, TPBG, CEA, EpCAM, Nectin-4, CD39, CD73, CD44, DLL3, CLDN18.1, KAT6A / B, PI3K, c-Kit, TRBCI; CLDN6, TYRP1, Ras, MOSPD2, HLA-A, HLA-G, HLA classII, CDH3, CDH17, CDH19, ENPP3, LILRB4, STEAP1, TrkB, oxMIF, P95HER2, CD133, LRRC15, TMEFF2, Sμrvivin, KLK2, Siglec-6, heme oxygenase, DLK1, CACNA1G-AS1, TSPAN8, GC-C, ETA, LY6G6D, P53 R175H, NCR3LG1, ADAM17, DLL1, GCP2, CEACAM5, mesothelin;.

[0085] Furthermore, the hematological tumor antigens include but are not limited to BCMA, CD5, CD7, CD10, FcγRIIIa, FcγRIIIb, CD19, CD20, CD22, CD30, CD33, CD34, CD37, CD38, CD47, CD56, CD70, CD123, CD138, CLL-1, ROR1, NKG2DL1 / 2, FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, SLAMF7, TCR B-chain, ITGB7, TACI, CD79b, and EBV.

[0086] Furthermore, the immune checkpoint antibody genes include but are not limited to SHP2, SLAMF3, PD-1, PD-L1, PD-L2, CTLA4, CD80, CD86, TIM-3, GAL9, HVEM, BTLA, CD160, KIR, TIGIT, NKG2A, B7-H3, VISTA, LAG3, 2B4, NECL, CD28, OX40, 4-1BB, CD27, ICOS, GITR, CD30, CD40, CD28H, CD4, LMTK3, IDO1, DNAM-1, CD226, PTA1, TLISA1, CD96, Vstm3, CD200R, KIRs, and CD94.

[0087] Further, when the antibody gene includes a target antibody gene targeting tumor cells and an antibody gene targeting immune cells, the antibody gene is a bispecific antibody;

[0088] The target antibody gene targeting tumor cells and the antibody gene targeting immune cells are arranged as follows:

[0089] N-target antibody gene-C+Linker+N-target immune cell antibody gene-C;

[0090] Or, N-antibody gene targeting immune cells-C+Linker+N-target antibody gene-C.

[0091] In a specific embodiment, the antibody gene is aPD-L1-aCD3, the gene sequence of the aPD-L1-aCD3 includes the nucleotide sequence shown in SEQ ID NO 15, and the amino acid sequence of the aPD-L1-aCD3 is the amino acid sequence shown in SEQ ID NO16.

[0092] In a specific embodiment, the antibody gene is aPD-L1-aCD16, the gene sequence of the aPD-L1-aCD16 includes the nucleotide sequence shown in SEQ ID NO 17, and the amino acid sequence of the aPD-L1-aCD16 is the amino acid sequence shown in SEQ ID NO 18.

[0093] Further, when the antibody gene includes a target antibody gene targeting tumor cells and two antibody genes targeting immune cells, the antibody gene is a trispecific antibody;

[0094] The arrangement of the target antibody gene targeting tumor cells and the antibody gene targeting immune cells is selected from any of the following:

[0095] (1) N-target antibody gene-C+Linker+N-target T cell antibody gene-C+Linker+N-target NK cell antibody gene-C;

[0096] (2) N-target antibody gene-C+Linker+N-target NK cell antibody gene-C+Linker+N-target T cell antibody gene-C;

[0097] (3) N-antibody gene targeting T cells-C+Linker+N-antibody gene targeting NK cells-C+Linker+N-target antibody gene-C;

[0098] (4) N-targeted T cell antibody gene-C+Linker+N-targeted antibody gene-C+Linker+N-targeted NK cell antibody gene-C;

[0099] (5) N-targeting NK cell antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting T cell antibody gene-C;

[0100] (6) N-NK cell-targeted antibody gene-C+Linker+N-T cell-targeted antibody gene-C+Linker+N-target antibody gene-C;

[0101] (7) N-target antibody gene-C+Linker+N-target T cell antibody gene-C+Linker+N-target macrophage antibody gene-C;

[0102] (8) N-target antibody gene-C+Linker+N-target antibody gene-C for macrophages+Linker+N-target antibody gene-C for T cells;

[0103] (9) N-antibody gene targeting T cells-C+Linker+N-antibody gene targeting macrophages-C+Linker+N-target antibody gene-C;

[0104] (10) N-targeted T cell antibody gene-C+Linker+N-targeted antibody gene-C+Linker+N-targeted macrophage antibody gene-C;

[0105] (11) N-targeting macrophage antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting T cell antibody gene-C;

[0106] (12) N-antibody gene targeting macrophages-C+Linker+N-antibody gene targeting T cells-C+Linker+N-target antibody gene-C;

[0107] (13) N-target antibody gene-C+Linker+N-target macrophage antibody gene-C+Linker+N-target NK cell antibody gene-C;

[0108] (14) N-target antibody gene-C+Linker+N-target NK cell antibody gene-C+Linker+N-target macrophage antibody gene-C;

[0109] (15) N-antibody gene targeting macrophages-C+Linker+N-antibody gene targeting NK cells-C+Linker+N-target antibody gene-C;

[0110] (16) N-targeting macrophage antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting NK cell antibody gene-C;

[0111] (17) N-targeted NK cell antibody gene-C+Linker+N-targeted antibody gene-C+Linker+N-targeted macrophage antibody gene-C;

[0112] (18) N-NK cell targeting antibody gene-C+Linker+N-macrophage targeting antibody gene-C+Linker+N-target antibody gene-C.

[0113] In a specific embodiment, the antibody gene is aPD-L1-aCD3-aCD16, the gene sequence of the aPD-L1-aCD3-aCD16 includes the nucleotide sequence shown in SEQ ID NO 19, and the amino acid sequence of the aPD-L1-aCD3-aCD16 is the amino acid sequence shown in SEQ ID NO 20.

[0114] In some specific embodiments, the recombinant oncolytic virus is used to continuously kill abnormally proliferative cells.

[0115] In some specific embodiments, the abnormally proliferative cells are selected from tumor cells or cells associated with tumor tissue.

[0116] In some specific embodiments, the tumor comprises a solid tumor or a hematological tumor.

[0117] In some specific embodiments, the tumor includes but is not limited to acute lymphoblastic leukemia, acute B-lymphocytic leukemia, chronic non-lymphocytic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, breast cancer, breast cancer, cervical cancer, chronic myeloproliferative tumors, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensorineuroblastoma, Ewing's sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, Gastrointestinal carcinoid tumors, hepatocellular carcinoma, hypopharyngeal cancer, Kaposi sarcoma, kidney cancer, Langerhans cell hyperplasia, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumors, pharyngeal cancer, pituitary tumors, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer and vascular tumors.

[0118] The present application also provides a composition, which comprises the above-mentioned oncolytic virus vaccine and a macromolecular antibody anticancer drug.

[0119] In summary, this application has the following beneficial effects:

[0120] BiKEs are created by fusing a single-chain antibody against CD16 and a single-chain antibody against a tumor-associated antigen. These molecules directly activate and expand NK cells through CD16 to produce cytokines. Activated NK cells can eliminate tumor cells through three direct or indirect strategies: (a) release granules, such as secretory lysosomes, which contain perforins and granzymes, inducing cell membrane lysis or apoptosis; (b) activate target cell caspases through the interaction of tumor necrosis factor-related apoptosis-inducing ligand and Fas ligand on tumor cells; (c) secrete a variety of factors to regulate the functions of other immune cells and indirectly kill tumor cells.

[0121] The present application integrates a gene encoding a bispecific single-chain antibody or a trispecific single-chain antibody into a modified oncolytic virus, so that the gene of the bispecific single-chain antibody or the trispecific single-chain antibody can be expressed in vivo, thereby further improving the therapeutic effect on tumor cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0122] Figure 1 This is the JBS-M(3)-aPD-L1-aCD3 recombinant plasmid of Preparation Example 3.

[0123] Figure 2 This is the JBS-M(42)-aPD-L1-aCD16 recombinant plasmid of Preparation Example 4.

[0124] Figure 3 To prepare the JBS-M(42)-aPD-L1-aCD3-aCD16 recombinant plasmid of Example 5.

[0125] Figure 4 These are the test results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 against A549 in Example 1.

[0126] Figure 5 These are the test results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 against A673 in Example 1.

[0127] Figure 6 These are the test results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 against HT29 in Example 1.

[0128] Figure 7 These are the test results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 against MC-38 in Example 1.

[0129] Figure 8 These are the test results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 against Hepa1-6 in Example 1.

[0130] Fig. 9 These are the test results of the killing efficiency of VSV-M(3)-aPD-L1-aCD3 against LLC in Example 1.

[0131] Fig.10 These are the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD16 against A549 in Example 2.

[0132] Fig.11 These are the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD16 against A673 in Example 2.

[0133] Fig.12 These are the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD16 on HT29 in Example 2.

[0134] Fig.13 These are the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD16 against MC-38 in Example 2.

[0135] Fig.14 These are the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD16 against Hepa1-6 in Example 2.

[0136] Fig.15 These are the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD16 on LLC in Example 2.

[0137] Fig.16 These are the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD3-aCD16 against MC-38 in Example 3.

[0138] Fig.17 These are the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD3-aCD16 against Hepa1-6 in Example 3.

[0139] Fig.18 These are the test results of the killing efficiency of VSV-M(42)-aPD-L1-aCD3-aCD16 on LLC in Example 3.

[0140] Fig.19 These are the microscopic observation results of the tumor cell killing efficiency test of VSV-M(3)-aPD-L1-aCD3 combined with PBMC cells in Example 4.

[0141] Fig. 20 These are the test results of Example 4 on the killing efficiency of tumor cells by VSV-M(3)-aPD-L1-aCD3 combined with PBMC cells.

[0142] Fig.21 These are the test results of Example 5 on the killing efficiency of tumor cells by VSV-M(42)-aPD-L1-aCD16 combined with NK510 cells.

[0143] Those skilled in the art can easily perceive other aspects and advantages of the present application from the detailed description below. In the detailed description below, only exemplary embodiments of the present application are shown and described. As will be appreciated by those skilled in the art, the content of the present application enables those skilled in the art to modify the disclosed specific embodiments without departing from the spirit and scope of the invention to which the present application relates. Accordingly, the description in the drawings and specification of the present application is merely exemplary and not restrictive. DETAILED DESCRIPTION

[0144] The following is an explanation of the implementation of the present invention by means of specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0145] Definition of terms

[0146] In this application, the term "oncolytic virus" (oncolytic virμs) generally refers to a virus that can replicate in tumor cells and kill tumor cells. Oncolytic viruses include, but are not limited to: Vesicular Stomatitis Virμs (Vesicμlar Stomatitis Virμs, referred to as "VSV virus"), poxvirus, herpes simplex virus (HSV), measles virus, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus (SVV), Echovirus, Coxsackievirus, Newcastle disease virus (NDV) and Maraba virus. In certain embodiments, the oncolytic virus is modified to improve the selectivity of tumor cells. In certain embodiments, the oncolytic virus is modified to reduce its immunogenicity.

[0147] In some embodiments, the VSV virus is a mutant of the Indiana Mudd Summer subtype of the VSV virus, which can be used to treat tumors. This virus does not interact with endogenous IFN-β in normal cells and can only selectively amplify and grow in tumor cells.

[0148] VSV virus can express a variety of cell surface molecules, including low-density lipoprotein receptors, phosphatidylserine, sialolipids, and heparan sulfate, and can attach to the cell surface through these molecules. Compared with other oncolytic virus platforms currently under development, VSV virus has the following advantages: (1) small genome, short replication time, and fast transsynaptic speed; (2) extremely high expression of exogenous genes, so it can have high titers, allowing large-scale production; (3) independent cell cycle, and no risk of transformation in the cytoplasm of host cells. This oncolytic virus will not integrate into DNA, and after attenuation, it can avoid the nervous system inflammation caused by wild-type viruses. In view of the above characteristics, VSV has great potential in tumor immunotherapy.

[0149] In some embodiments, site-directed gene mutations may be performed on the M protein, and / or the G protein, and / or the N protein, and / or the P protein, and / or the L protein of the VSV virus.

[0150] In certain embodiments, the recombinant oncolytic virus described herein may be an oncolytic virus modified at the gene level, such as modified by modification of one or more genes, so as to improve its tumor selectivity and / or preferentially replicate in dividing cells. The modification of the gene level may be a modification of genes involved in DNA / RNA replication, nucleic acid metabolism, host tropism, surface attachment, toxicity, lysis and diffusion processes, or may be a modification of integrated exogenous genes. The exogenous genes may include exogenous immunomodulatory genes, exogenous screening genes, exogenous reporter genes, etc. The modified oncolytic virus may also be an oncolytic virus modified at the amino acid level, such as insertion, deletion, or substitution of one or more amino acids.

[0151] In the present application, the term "M protein" generally refers to VSV viral matrix protein. M protein is an important virulence factor of VSV virus and a protein in VSV virus known to interfere with the natural immune response of mice. The term "M protein" also includes homologs, orthologs, variants, functionally active fragments, etc. thereof. In the present application, the wild-type VSV virus Indiana MuddSummer subtype M protein may include an amino acid sequence as shown in SEQ ID NO 1. In the present application, the M protein of the oncolytic virus may include an amino acid sequence as shown in SEQ ID NO 2-3.

[0152] In the present application, the term "G protein" generally refers to the glycoprotein of the VSV virus, also known as the envelope protein. The term "G protein" also includes homologs, orthologs, variants, functionally active fragments, etc. thereof. In the present application, the wild-type VSV virus IndianaMuddSummer subtype G protein may comprise an amino acid sequence as shown in SEQ ID NO 4. In the present application, the G protein of the oncolytic virus may comprise an amino acid sequence as shown in any one of SEQ ID NOs 5-6.

[0153] In the present application, the term "N protein" generally refers to the nucleocapsid protein of the VSV virus. The term "N protein" also includes homologs, orthologs, variants, functionally active fragments, etc. thereof. In the present application, the wild-type VSV virus IndianaMuddSummer subtype N protein may comprise an amino acid sequence as shown in SEQ ID NO 7. In the present application, the N protein of the oncolytic virus may comprise an amino acid sequence as shown in SEQ ID NO 8.

[0154] In the present application, the term "P protein" generally refers to the phosphoprotein of the VSV virus. The term "P protein" also includes its homologs, orthologs, variants, functionally active fragments, etc. In the present application, the wild-type VSV virus Indiana MuddSummer subtype P protein may include an amino acid sequence as shown in SEQ ID NO 9. In the present application, the P protein of the oncolytic virus may include an amino acid sequence as shown in SEQ ID NO 10.

[0155] In the present application, the term "L protein" generally refers to the VSV viral RNA polymerase protein. The L gene of the VSV virus encodes the RNA poly E protein. The term "L protein" also includes homologs, orthologs, variants, functionally active fragments, etc. thereof. In the present application, the wild-type VSV virus Indiana MuddSummer subtype L protein may comprise an amino acid sequence as shown in SEQ ID NO 11. In the present application, the L protein of the oncolytic virus may comprise an amino acid sequence as shown in any one of SEQ ID NOs 12-14.

[0156] In this application, the expression of protein mutation sites is usually expressed as "amino acid + amino acid position + amino acid after mutation". In this application, the mutation may include but is not limited to the addition, replacement, deletion and / or deletion of amino acids. For example, the term "M51R" usually refers to the mutation of methionine M at position 51 to arginine R.

[0157] In the present application, the term "amino acid substitution" generally refers to replacing an amino acid residue present in the parent sequence with another amino acid residue. The amino acid in the parent sequence can be replaced, for example, via chemical synthesis or by recombinant methods known in the art. Therefore, "replacing at position xx" generally refers to replacing the amino acid present at position xx with an alternative amino acid residue. In the present application, the amino acid substitution may include amino acid mutations.

[0158] In this application, the term "mutation" generally refers to a change in the nucleotide or amino acid sequence of a wild-type molecule. Amino acid changes may include substitution, deletion, lack, insertion, addition, truncation, or protein processing or cleavage of amino acids.

[0159] In the present application, the recombinant oncolytic virus is to integrate exogenous genes while performing site-directed gene mutation on the M protein, and / or G protein, and / or N protein, and / or P protein, and / or L protein of the VSV virus. The exogenous genes are specifically CD3 antibody genes and / or CD16 antibody genes and target antibody genes.

[0160] In some specific embodiments, the bispecific antibodies may include but are not limited to: BCMA-CD3, CD3-GPRC5D, CD20-CD3, CD19-CD3, CD3-DLL3, CD3-EpCAM, CD16a-CD30, CD123-CD3, CD3-MΜC16, CD3-PSMA, CD3-MΜC17, CD3-FAP, CD3-PDL1.

[0161] In the present application, the term "prevention" generally refers to preventing the generation and onset, recurrence, and / or spread of a disease or one or more symptoms thereof by taking certain measures in advance. In the present application, the term "treatment" generally refers to eliminating or improving a disease, or one or more symptoms associated with a disease. In certain embodiments, treatment generally refers to applying one or more drugs to a patient suffering from the disease so that the disease is eliminated or alleviated. In certain embodiments, "treatment" can be after the onset of symptoms of a particular disease, in the presence or absence of other drugs, the drug combination and / or drug product is applied. For example, drug combinations and / or drug products described in the present application are used to prevent the generation, development, recurrence and / or metastasis of a tumor.

[0162] In this application, the term "tumor" generally refers to any new pathological tissue proliferation. Tumors may be benign or malignant. In this application, the tumor may be a solid tumor and / or a hematological tumor. For research, these tissues can be isolated from readily available resources by methods well known to those skilled in the art.

[0163] In some specific embodiments, the tumor includes but is not limited to acute lymphoblastic leukemia, acute B-lymphocytic leukemia, chronic non-lymphocytic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, breast cancer, breast cancer (BRCA), cervical cancer, chronic myeloproliferative neoplasms, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensorineuroblastoma, Ewing's sarcoma, fallopian tube cancer, gallbladder cancer, Gastric cancer, gastrointestinal carcinoid tumors, hepatocellular carcinoma, hypopharyngeal cancer, Kaposi sarcoma, kidney cancer, Langerhans cell hyperplasia, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumors, pharyngeal cancer, pituitary tumors, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer and vascular tumors. DETAILED DESCRIPTION OF THE INVENTION

[0165] A wild-type VSV virus, specifically VSV virus Indiana strain, VSV virus Indiana MuddSummer subtype strain. The amino acid sequence of its M protein is shown in SEQ ID NO 1; the amino acid sequence of its G protein is shown in SEQ ID NO 4; the amino acid sequence of its N protein is shown in SEQ ID NO 7; the amino acid sequence of its P protein is shown in SEQ ID NO 9; and the amino acid sequence of its L protein is shown in SEQ ID NO 11. In the present application, the M protein, G protein, N protein, P protein, and L protein can all be modified.

[0166] A recombinant oncolytic virus is obtained based on the above-mentioned wild-type VSV virus by mutating sites on the amino acid sequences of its M protein, G protein, N protein, P protein, and L protein.

[0167] The present application provides a recombinant oncolytic virus, specifically comprising: the recombinant oncolytic virus comprises an M protein, a G protein, an N protein, a P protein, an L protein, and a bispecific single-chain antibody gene or a trispecific single-chain antibody gene integrated into the recombinant oncolytic virus backbone; the bispecific single-chain antibody gene comprises a CD3 antibody gene or a CD16 antibody gene obtained by recombination with a target antibody gene; the trispecific single-chain antibody gene comprises a CD3 antibody gene and a CD16 antibody gene obtained by recombination with a target antibody gene;

[0168] Compared with the amino acid sequence shown in SEQ ID NO 1, the site mutation of the M protein includes any one or more of M51R, V221F, and S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; or the site mutation of the M protein includes N32S, N49D, M51R, H54Y, knockout of the 111th leucine encoding base, V221F, V225I, and S226R. 25I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21 E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54 Y, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R.

[0169] Compared with the amino acid sequence shown in SEQ ID NO 4, the site mutations of the G protein include any one or more of H38Y, V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.

[0170] Compared with the amino acid sequence shown in SEQ ID NO 7, the site mutation of the N protein includes any one or more of I14V, R155K, and S353N.

[0171] Compared with the amino acid sequence shown in SEQ ID NO 9, the site mutations of the P protein include any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.

[0172] Compared with the amino acid sequence shown in SEQ ID NO 11, the site mutation of the L protein includes any one or more of S87P, I397T, I487T, and F873L.

[0173] Furthermore, the recombinant oncolytic virus is obtained by introducing exogenous genes encoding CD3 antibodies and / or CD16 antibodies and target antibodies on the basis of the above-mentioned recombinant oncolytic virus.

[0174] In the present application, the recombinant oncolytic virus described in the present application can be obtained by a virus packaging process and a virus rescue process. The specific process may include inoculating BSR-T7 cells with a poxvirus vTF7-3 expressing T7 RNA polymerase, and performing lipofectamine transfection using expression plasmids and backbone plasmids that clone VSV N, VSV P, and VSV L genes, respectively, to obtain the target oncolytic virus.

[0175] The present application provides a composition comprising the above-mentioned recombinant oncolytic virus.

[0176] In certain embodiments, the composition may include one or more (pharmaceutically effective) adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers and / or suitable formulations of preservatives. The acceptable ingredients of the composition are preferably non-toxic to the recipient at the dosage and concentration used. The composition of the present application includes but is not limited to liquid, frozen and lyophilized compositions.

[0177] In certain embodiments, the pharmaceutically acceptable carrier may include any and all solvents, dispersion media, coatings, isotonic agents and absorption delaying agents that are compatible with pharmaceutical administration and are generally safe and non-toxic.

[0178] In certain embodiments, the composition can include parenteral, subcutaneous, intracavitary, intra-arterial, intravenous, intrathecal and / or intranasal administration or direct injection into tissue. For example, the composition can be administered to a patient or subject by infusion or injection. In certain embodiments, the administration of the composition can be carried out in different ways, such as intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal or intra-tissue administration. In certain embodiments, the composition can be administered uninterruptedly. The uninterrupted (or continuous) administration can be achieved by a small pump system worn by the patient to measure the therapeutic agent flowing into the patient, as described in WO2015 / 036583.

[0179] The present application is further described in detail below in conjunction with preparation examples and embodiments.

[0180] Preparation Example

[0181] Preparation Example 1

[0182] This preparation example provides a recombinant oncolytic virus.

[0183] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein and L protein. Wherein, M protein, G protein, N protein, P protein and L protein are obtained by point mutation on the basis of wild-type VSV virus (Indiana MuddSummer subtype). Wherein, M protein includes the amino acid sequence shown in SEQ ID NO 2, G protein includes the amino acid sequence shown in SEQ ID NO 5, N protein includes the amino acid sequence shown in SEQ ID NO 8, P protein includes the amino acid sequence shown in SEQ ID NO 10, and L protein includes the amino acid sequence shown in SEQ ID NO 12. Specific as shown in Table 1.

[0184] The construction method of the above-mentioned recombinant oncolytic virus is as follows:

[0185] (1) The protein mutation was performed based on the genome of the Indiana MuddSummer subtype of VSV virus.

[0186] The core plasmid JBS-M(3) and auxiliary plasmids pN, pP, pL, and pG of the artificially synthesized VSV-M(3) attenuated strain packaging system respectively include the mutation combinations shown in Table 1. The reverse genetics technique is then used to rescue the VSV-M(3) attenuated strain with the required mutation sites. The virus rescue process is as follows.

[0187] Table 1 Recombinant oncolytic virus of Preparation Example 1

[0188]

[0189] (2) Virus rescue

[0190] 1) BSR-T7 cells were plated in 6-well plates to make the cell volume reach 7×10 5 / well, and culture in the incubator for about 16-20 hours.

[0191] 2) Discard the supernatant in the six-well plate, add 1 ml of Opti-MEM, add 10 μl / well of poxvirus (MOI about 1), and incubate for 4 hours.

[0192] 3) Preparation of transfection complex: core plasmid: JBS-M (3) 3 μg; auxiliary plasmids: pP 1.5 μg, pN 1.2 μg, pL 0.3 μg, pG 0.2 μg.

[0193] pN, pP, pL, and pG refer to plasmids cloned with genes corresponding to N protein, P protein, L protein, and G protein in Table 1, respectively, and express mutant N protein, P protein, L protein, and G protein required for virus rescue, respectively. Plasmid transfection was performed according to the method described in the instruction manual of Lipofectamine LTX.

[0194] Take two 1.5ml tubes, mark them as A and B, and add 200μl of Opti-MEM to each tube. In tube A, add 1.5μg pP, 1.2μg pN, 0.3μg pL, 0.2μg pG plasmid, and 3μg JBS-M(3) plasmid in sequence, mix well, and then add 10μl / tube of transfection enhancement reagent. Add 12μl of transfection reagent (LTX) to tube B and mix well. Add the mixture in tube B to tube A, mix gently, and let stand at room temperature for 10 minutes.

[0195] 4) After incubating the poxvirus for 4 hours, discard the virus supernatant, add 600 μl of Opti-MEM medium to each well, add the plasmid transfection reagent mixture in 3) dropwise into the 6-well plate containing the cultured cells, gently shake the 6-well plate to evenly distribute the plasmids in the 6-well plate, and then place it in an incubator for culture.

[0196] 5) 6 hours after transfection, add 2 ml of 3% FBSDMEM culture medium to each well.

[0197] 6) 48 h after transfection, the virus solution and cells were collected for cytopathic effect, centrifuged at 2500 x g, the supernatant was collected, and 200 μl of the supernatant was used to resuspend the cell pellet. The pellet was frozen and thawed three times at -80°C, centrifuged at 2500 x g, the supernatant was collected, and mixed with the unfrozen and thawed supernatant. The pellet was filtered twice with a 0.22 μm filter to remove the poxvirus and named VSV-M(3)P1.

[0198] 7) Take 1.5×10 6 The cells were diluted to 2 ml with 10% FBSDMEM medium and plated in six-well plates.

[0199] 8) After 16-20 hours, 500 μl of VSV-M(3)P1 virus dilution was taken to infect 293 cells in a 6-well plate.

[0200] 9) After 24 hours, the virus solution and cells were collected and centrifuged at 2500 x g. The supernatant was collected and 200 μl of the supernatant was used to resuspend the cell pellet. The pellet was frozen and thawed three times at -80°C and centrifuged at 2500 x g. The supernatant was collected and mixed with the unfrozen and thawed supernatant and filtered once with a 0.22 μm filter to remove the poxvirus. The pellet was named VSV-M(3)P2.

[0201] 10) Virus single plaque screening and amplification

[0202] Take 1.5×10 6 The cells were diluted to 2 ml with 10% FBSDMEM medium and plated in six-well plates.

[0203] After 16-20 hours, the virus was serially diluted E6, E7, E8, E9, and E10, and 1 ml of the virus dilution was taken to infect 293 cells in a 6-well plate.

[0204] After 2 hours of infection, the virus solution was discarded, and after washing once with incomplete culture medium, 2.5 ml of covering layer (mixed with 2% soft agar and 4% FBS in 2XDMEM 1 and kept warm at 40°C) was added. After the agar layer solidified, the cells were inverted for culture.

[0205] On the second day after virus infection, 1.5×10 6 The cells were plated into six-well culture plates.

[0206] 72 hours after infection, 4 single plaques were picked up with a 1 ml pipette tip, resuspended in 2.5 ml of 2% FBSDMEM, and infected HEK293 cells. Single plaque screening was performed for all lesions of cells 48 hours after infection, and the virus solution and cells were collected, centrifuged at 2500 x g, and the supernatant was collected. 200 μl of the supernatant was used to resuspend the cell pellet, frozen and thawed three times at -80 ° C, centrifuged at 2500 x g, and the supernatant was collected. It was mixed with the unfrozen supernatant and filtered with a 0.22 μm filter and named VSV-M (3) P3.

[0207] The above operation was repeated to perform a second single-spot screening, which was named VSV-M(3)P4.

[0208] 11) Take 1.5×10 7 The cells were diluted to a volume of 10 ml with 10% FBSDMEM medium and plated in a T75 culture flask.

[0209] 12) After 16-20 hours, 1 μl of VSV-MP4 dilution was taken to infect HEK 293 cells in a T75 culture flask.

[0210] 13) After 48 h, the virus solution and cells were collected and centrifuged at 2500 x g. The supernatant was collected and 200 μl of the supernatant was used to resuspend the cell pellet. The mixture was frozen and thawed three times at -80 °C and centrifuged at 2500 x g. The supernatant was collected and mixed with the unfrozen supernatant and filtered once with a 0.22 μm filter to remove the poxvirus. The mixture was named VSV-M(3)P5, thereby obtaining the desired recombinant oncolytic virus attenuated strain.

[0211] (3) Gene sequencing. Viral genomic RNA was extracted using a Trizol kit, and reverse transcription was performed using random primers. PCR was performed on the reverse transcribed cDNA using primers designed for the M protein gene sequence, primers designed for the G protein gene sequence, primers designed for the N protein gene sequence, primers designed for the P protein gene sequence, primers designed for the L protein gene sequence, and primers designed for the antigen encoding gene sequence;

[0212] The primer sequences designed for the M protein gene sequence are:

[0213] PF:ATGAGTTCCTTAAGAA;

[0214] PR:TCATTTGAAGTGG.

[0215] The primer sequences designed for the G protein gene sequence are:

[0216] PF:ATGAAGTGCCTTTTGTACTTAG;

[0217] PR:TTACTTTCCAAGTCGGTTCATCT.

[0218] The primer sequences designed for the N protein gene sequence are:

[0219] PF:ATGTCTGTTACAGTCAAGAG;

[0220] PR:TCATTTGTCAAATTCTGACTT.

[0221] The primer sequences designed for the P protein gene sequence are:

[0222] PF:ATGGATAATCTCACAAAAGTTCG;

[0223] PR:CTACAGAGAATATTTGACTCTCG.

[0224] The primer sequences designed for the L protein gene sequence are:

[0225] PF:ATGGAAGTCCACGATTTTGAGA;

[0226] PR:TTAATCTCTCCAAGAGTTTTCCT.

[0227] The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 1.

[0228] Preparation Example 2

[0229] This preparation example provides a recombinant oncolytic virus.

[0230] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein and L protein. Wherein, M protein, G protein, N protein, P protein and L protein are obtained by point mutation on the basis of wild-type VSV virus (Indiana MuddSummer subtype). Wherein, M protein includes the amino acid sequence shown in SEQ ID NO 3, G protein includes the amino acid sequence shown in SEQ ID NO 5, N protein includes the amino acid sequence shown in SEQ ID NO 8, P protein includes the amino acid sequence shown in SEQ ID NO 10, and L protein includes the amino acid sequence shown in SEQ ID NO 12. Specific as shown in Table 2.

[0231] The construction method of the above-mentioned recombinant oncolytic virus is as follows:

[0232] (1) The protein mutation was performed based on the genome of the Indiana MuddSummer subtype of VSV virus.

[0233] The core plasmid JBS-M (42) and auxiliary plasmids pN, pP, pL, and pG of the artificially synthesized VSV-M (42) attenuated strain packaging system respectively include the mutation combinations shown in Table 2. The VSV-M (42) attenuated strain with the required mutation sites is then rescued using reverse genetics technology. The virus rescue process is the same as that in Preparation Example 1 to obtain VSV-M (42) P5 virus.

[0234] Table 2 Recombinant oncolytic virus of Preparation Example 2

[0235]

[0236] Preparation Example 3

[0237] This preparation example provides a recombinant oncolytic virus carrying aPD-L1-aCD3 single-chain antibody.

[0238] That is, on the basis of the recombinant oncolytic virus provided in Preparation Example 1, the gene encoding the aPD-L1-aCD3 single-chain antibody is inserted. The preparation method of the gene encoding the aPD-L1-aCD3 single-chain antibody is a conventional technique in the art.

[0239] The preparation method of the gene encoding the aPD-L1-aCD3 single-chain antibody is as follows:

[0240] (1) Insertion of gene encoding aPD-L1-aCD3 single-chain antibody

[0241] 1) Insert the gene encoding aPD-L1-aCD3 single-chain antibody

[0242] The gene encoding the aPD-L1-aCD3 single-chain antibody was synthesized by a gene synthesis company using primers with homology arms to the JBS-M (3) plasmid insertion site. The primers used were:

[0243] F:ctaacagatatcacgctcgagATGAATTTCGGCCTGAGCCT;

[0244] R:aacatgaagaatctggctagcTCAGTGGTGATGATGATGATGTTTC.

[0245] The fragments were amplified by PCR instrument, and after 1% gel electrophoresis, the gel was cut and the fragments were recovered.

[0246] 2) The JBS-M(3) plasmid was double-digested with XhoI and NheI, and after 1% gel electrophoresis, the long fragments were recovered by cutting the gel.

[0247] 3) The gene fragment encoding the aPD-L1-aCD3 single-chain antibody and the linear plasmid were then recombined, transformed, plated, and cultured at 37° C. overnight.

[0248] 4) Select multiple monoclonal strains and send them to a sequencing company for sequencing. Select the strain with the correct insertion sequence to extract the plasmid, thereby obtaining a recombinant plasmid carrying the gene encoding the aPD-L1-aCD3 single-chain antibody, named JBS-M(3)-aPD-L1-aCD3. Figure 1 The sequence information involved is shown in Table 2.

[0249] (2) Virus rescue

[0250] 1) BSR-T7 cells were plated in 6-well plates to make the cell volume reach 7×10 5 / well, and culture in the incubator for about 16-20 hours.

[0251] 2) Discard the supernatant in the six-well plate, add 1 ml of Opti-MEM, add 10 μl / well of poxvirus (MOI about 1), and incubate for 4 hours.

[0252] 3) Preparation of transfection complex: core plasmid: JBS-M(3)-aPD-L1-aCD3 3 μg; auxiliary plasmids: pP 1.5 μg, pN 1.2 μg, pL 0.3 μg, pG 0.2 μg.

[0253] pN, pP, pL, and pG refer to plasmids cloned with genes corresponding to N protein, P protein, L protein, and G protein in Table 1, respectively, and express mutant N protein, P protein, L protein, and G protein required for virus rescue, respectively. Plasmid transfection was performed according to the method described in the instruction manual of Lipofectamine LTX.

[0254] Take two 1.5ml tubes, mark them as A and B tubes, and add 200μl of Opti-MEM to each tube. In tube A, add 1.5μg pP, 1.2μg pN, 0.3μg pL, 0.2μg pG plasmid, and 3μg JBS-M(3)-aPD-L1-aCD3 plasmid in sequence, mix well, and then add 10μl / tube of transfection enhancement reagent. Add 12μl of transfection reagent (LTX) to tube B and mix well. Add the mixture in tube B to tube A, mix gently, and let stand at room temperature for 10 minutes.

[0255] 4) After incubating the poxvirus for 4 hours, discard the virus supernatant, add 600 μl of Opti-MEM medium to each well, add the plasmid transfection reagent mixture in 3) dropwise into the 6-well plate containing the cultured cells, gently shake the 6-well plate to evenly distribute the plasmids in the 6-well plate, and then place it in an incubator for culture.

[0256] 5) 6 hours after transfection, add 2 ml of 3% FBSDMEM culture medium to each well.

[0257] 6) 48 h after transfection, the virus solution and cells were collected for cytopathic effect, centrifuged at 2500 x g, the supernatant was collected, 200 μl of the supernatant was used to resuspend the cell pellet, and the pellet was frozen and thawed three times at -80°C, centrifuged at 2500 x g, the supernatant was collected, and the supernatant was mixed with the unfrozen and thawed supernatant, filtered twice with a 0.22 μm filter to remove the poxvirus, and named VSV-M(3)-aPD-L1-aCD3 P1.

[0258] 7) Take 1.5×10 6 The cells were diluted to 2 ml with 10% FBSDMEM medium and plated in six-well plates.

[0259] 8) After 16-20 hours, 500 μl of VSV-MP1 virus dilution was taken to infect 293 cells in a 6-well plate.

[0260] 9) After 24 hours, the virus solution and cells were collected and centrifuged at 2500×g. The supernatant was collected and 200 μl of the supernatant was used to resuspend the cell pellet. The pellet was frozen and thawed three times at -80°C and centrifuged at 2500×g. The supernatant was collected and mixed with the unfrozen and thawed supernatant and filtered once with a 0.22 μm filter to remove the poxvirus. The pellet was named VSV-M(3)-aPD-L1-aCD3 P2.

[0261] 10) Virus single plaque screening and amplification

[0262] Take 1.5×10 6 The cells were diluted to 2 ml with 10% FBSDMEM medium and plated in six-well plates.

[0263] After 16-20 hours, the virus was serially diluted E6, E7, E8, E9, and E10, and 1 ml of the virus dilution was taken to infect 293 cells in a 6-well plate.

[0264] After 2 hours of infection, the virus solution was discarded, and after washing once with incomplete culture medium, 2.5 ml of covering layer (mixed with 2% soft agar and 4% FBS in 2XDMEM 1 and kept warm at 40°C) was added. After the agar layer solidified, the cells were inverted for culture.

[0265] On the second day after virus infection, 1.5×10 6 The cells were plated into six-well culture plates.

[0266] 72 hours after infection, 4 single plaques were picked up with a 1 ml pipette tip, resuspended in 2.5 ml of 2% FBSDMEM, and infected HEK293 cells. Single plaque screening was performed to screen all lesions of cells 48 hours after infection, and the virus solution and cells were collected, centrifuged at 2500 x g, and the supernatant was collected. 200 μl of the supernatant was used to resuspend the cell pellet, frozen and thawed three times at -80 ° C, centrifuged at 2500 x g, and the supernatant was collected. It was mixed with the unfrozen supernatant and filtered with a 0.22 μm filter and named VSV-M (3) -aPD-L1-aCD3 P3.

[0267] The above operation was repeated for the second single-plaque screening, which was named VSV-M(3)-aPD-L1-aCD3 P4.

[0268] 11) Take 1.5×10 7 The cells were diluted to a volume of 10 ml with 10% FBSDMEM medium and plated in a T75 culture flask.

[0269] 12) After 16-20 hours, 1 μl of VSV-MP4 dilution was taken to infect HEK 293 cells in a T75 culture flask.

[0270] 13) After 48 h, the virus solution and cells were collected and centrifuged at 2500 x g. The supernatant was collected and 200 μl of the supernatant was used to resuspend the cell pellet. The mixture was frozen and thawed three times at -80 °C and centrifuged at 2500 x g. The supernatant was collected and mixed with the unfrozen supernatant and filtered once with a 0.22 μm filter to remove the poxvirus. The mixture was named VSV-M(3)-aPD-L1-aCD3 P5, thereby obtaining the desired recombinant oncolytic virus attenuated strain.

[0271] (3) Gene sequencing. The viral genomic RNA was extracted using a Trizol kit and reverse transcribed using random primers. The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2.

[0272] Table 3 Recombinant oncolytic viruses of Preparation Examples 2-4

[0273]

[0274] Preparation Example 4

[0275] This preparation example provides a recombinant oncolytic virus carrying aPD-L1-aCD16 single-chain antibody.

[0276] That is, on the basis of the recombinant oncolytic virus provided in Preparation Example 2, the gene encoding the aPD-L1-aCD16 single-chain antibody is inserted. The preparation method of the gene encoding the aPD-L1-aCD16 single-chain antibody is a conventional technique in the art.

[0277] The preparation method of the gene encoding the aPD-L1-aCD16 single-chain antibody is as follows:

[0278] (1) Insertion of gene encoding aPD-L1-aCD16 single-chain antibody

[0279] 1) Insert the gene encoding aPD-L1-aCD16 single-chain antibody

[0280] The gene encoding the aPD-L1-aCD16 single-chain antibody was synthesized by a gene synthesis company using primers with homology arms to the JBS-M (42) plasmid insertion site. The primers used were:

[0281] F:ctaacagatatcacgctcgagATGAATTTCGGCCTGAGCCT;

[0282] R:aacatgaagaatctggctagcTCAGCTGCTCACGGTCACCA.

[0283] The fragments were amplified by PCR instrument, and after 1% gel electrophoresis, the gel was cut and the fragments were recovered.

[0284] 2) The JBS-M (42) plasmid was double-digested with XhoI and NheI, and after 1% gel electrophoresis, the long fragments were recovered by cutting the gel.

[0285] 3) The gene fragment encoding the aPD-L1-aCD16 single-chain antibody and the linear plasmid were then recombined, transformed, plated, and cultured at 37° C. overnight.

[0286] 4) Select multiple monoclonal strains and send them to a sequencing company for sequencing. Select the strain with the correct insertion sequence to extract the plasmid, thereby obtaining a recombinant plasmid carrying the gene encoding the aPD-L1-aCD16 single-chain antibody, named JBS-M(42)-aPD-L1-aCD16. Figure 2 The sequence information involved is shown in Table 2.

[0287] (2) Virus rescue

[0288] 1) BSR-T7 cells were plated in 6-well plates to make the cell volume reach 7×10 5 / well, and culture in the incubator for about 16-20 hours.

[0289] 2) Discard the supernatant in the six-well plate, add 1 ml of Opti-MEM, add 10 μl / well of poxvirus (MOI about 1), and incubate for 4 hours.

[0290] 3) Preparation of transfection complex: core plasmid: JBS-M(42)-aPD-L1-aCD16 3 μg; auxiliary plasmids: pP 1.5 μg, pN 1.2 μg, pL 0.3 μg, pG 0.2 μg.

[0291] pN, pP, pL, and pG refer to plasmids cloned with genes corresponding to N protein, P protein, L protein, and G protein in Table 1, respectively, and express mutant N protein, P protein, L protein, and G protein required for virus rescue, respectively. Plasmid transfection was performed according to the method described in the instruction manual of Lipofectamine LTX.

[0292] Take two 1.5ml tubes, mark them as A and B tubes, and add 200μl of Opti-MEM. In tube A, add 1.5μg pP, 1.2μg pN, 0.3μg pL, 0.2μg pG plasmid, 3μg JBS-M(42)-aPD-L1-aCD16 plasmid, mix well, and then add 10μl / tube of transfection enhancement reagent. Add 12μl of transfection reagent (LTX) to tube B and mix well. Add the mixture in tube B to tube A, mix gently, and let stand at room temperature for 10 minutes.

[0293] 4) After incubating the poxvirus for 4 hours, discard the virus supernatant, add 600 μl of Opti-MEM medium to each well, add the plasmid transfection reagent mixture in 3) dropwise into the 6-well plate containing the cultured cells, gently shake the 6-well plate to evenly distribute the plasmids in the 6-well plate, and then place it in an incubator for culture.

[0294] 5) 6 hours after transfection, add 2 ml of 3% FBSDMEM culture medium to each well.

[0295] 6) 48 h after transfection, the virus solution and cells were collected for cytopathic effect, centrifuged at 2500 x g, the supernatant was collected, and 200 μl of the supernatant was used to resuspend the cell pellet, which was frozen and thawed three times at -80°C and centrifuged at 2500 x g. The supernatant was collected and mixed with the unfrozen and thawed supernatant, and filtered twice with a 0.22 μm filter to remove the poxvirus. The cell pellet was named VSV-M(42)-aPD-L1-aCD16 P1.

[0296] 7) Take 1.5×10 6 The cells were diluted to 2 ml with 10% FBSDMEM medium and plated in six-well plates.

[0297] 8) After 16-20 hours, 500 μl of VSV-MP1 virus dilution was taken to infect 293 cells in a 6-well plate.

[0298] 9) After 24 hours, the virus solution and cells were collected and centrifuged at 2500×g. The supernatant was collected and 200 μl of the supernatant was used to resuspend the cell pellet. The pellet was frozen and thawed three times at -80°C and centrifuged at 2500×g. The supernatant was collected and mixed with the unfrozen and thawed supernatant. The pellet was filtered once with a 0.22 μm filter to remove the poxvirus and named VSV-M(42)-aPD-L1-aCD16 P2.

[0299] 10) Virus single plaque screening and amplification

[0300] Take 1.5×10 6 The cells were diluted to 2 ml with 10% FBSDMEM medium and plated in six-well plates.

[0301] After 16-20 hours, the virus was serially diluted E6, E7, E8, E9, and E10, and 1 ml of the virus dilution was taken to infect 293 cells in a 6-well plate.

[0302] After 2 hours of infection, the virus solution was discarded, and after washing once with incomplete culture medium, 2.5 ml of covering layer (mixed with 2% soft agar and 4% FBS in 2XDMEM 1 and kept warm at 40°C) was added. After the agar layer solidified, the cells were inverted for culture.

[0303] On the second day after virus infection, 1.5×10 6 The cells were plated into six-well culture plates.

[0304] 72 hours after infection, 4 single plaques were picked up with a 1 ml pipette tip, resuspended in 2.5 ml of 2% FBSDMEM, and infected HEK293 cells. Single plaque screening was performed to screen all lesions of cells 48 hours after infection, and the virus solution and cells were collected, centrifuged at 2500 x g, and the supernatant was collected. 200 μl of the supernatant was used to resuspend the cell pellet, frozen and thawed three times at -80 ° C, centrifuged at 2500 x g, and the supernatant was collected. It was mixed with the unfrozen supernatant and filtered with a 0.22 μm filter and named VSV-M (42) -aPD-L1-aCD16 P3.

[0305] The above operation was repeated for the second single-plaque screening, which was named VSV-M(42)-aPD-L1-aCD16 P4.

[0306] 11) Take 1.5×10 7 The cells were diluted to a volume of 10 ml with 10% FBSDMEM medium and plated in a T75 culture flask.

[0307] 12) After 16-20 hours, 1 μl of VSV-MP4 dilution was taken to infect HEK 293 cells in a T75 culture flask.

[0308] 13) After 48 h, the virus solution and cells were collected and centrifuged at 2500 x g. The supernatant was collected and 200 μl of the supernatant was used to resuspend the cell pellet. The mixture was frozen and thawed three times at -80 °C and centrifuged at 2500 x g. The supernatant was collected and mixed with the unfrozen supernatant and filtered once with a 0.22 μm filter to remove the poxvirus. The mixture was named VSV-M(42)-aPD-L1-aCD16 P5, thereby obtaining the desired recombinant oncolytic virus attenuated strain.

[0309] (3) Gene sequencing. The viral genomic RNA was extracted using a Trizol kit and reverse transcribed using random primers. The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2.

[0310] Preparation Example 5

[0311] This preparation example provides a recombinant oncolytic virus carrying aPD-L1-aCD3-aCD16 single-chain antibody.

[0312] That is, on the basis of the recombinant oncolytic virus provided in Preparation Example 2, the gene encoding the aPD-L1-aCD3-aCD16 single-chain antibody is inserted. The preparation method of the gene encoding the aPD-L1-aCD3-aCD16 single-chain antibody is a conventional technique in the art.

[0313] The preparation method of the gene encoding the aPD-L1-aCD3-aCD16 single-chain antibody is as follows:

[0314] (1) Insertion of gene encoding aPD-L1-aCD3-aCD16 single-chain antibody

[0315] 1) Insert the gene encoding aPD-L1-aCD3-aCD16 single-chain antibody

[0316] The gene encoding the aPD-L1-aCD3-aCD16 single-chain antibody was synthesized by a gene synthesis company using primers with homology arms to the JBS-M (42) plasmid insertion site. The primers used were:

[0317] F:ctaacagatatcacgctcgagATGAATTTCGGCCTGAGCCT;

[0318] R:aacatgaagaatctggctagcTCAGCTGCTCACGGTCACCA.

[0319] The fragments were amplified by PCR instrument, and after 1% gel electrophoresis, the gel was cut and the fragments were recovered.

[0320] 2) The JBS-M (42) plasmid was double-digested with XhoI and NheI, and after 1% gel electrophoresis, the long fragments were recovered by cutting the gel.

[0321] 3) The gene fragment encoding the aPD-L1-aCD3-aCD16 single-chain antibody and the linear plasmid were then recombined, transformed, plated, and cultured at 37° C. overnight.

[0322] 4) Select multiple monoclonal strains and send them to a sequencing company for sequencing. Select the strain with the correct insertion sequence to extract the plasmid, thereby obtaining a recombinant plasmid carrying the gene encoding the aPD-L1-aCD3-aCD16 single-chain antibody, named JBS-M(42)-aPD-L1-aCD3-aCD16. Figure 3 The sequence information involved is shown in Table 2.

[0323] (2) Virus rescue

[0324] 1) BSR-T7 cells were plated in 6-well plates to make the cell volume reach 7×10 5 / well, and culture in the incubator for about 16-20 hours.

[0325] 2) Discard the supernatant in the six-well plate, add 1 ml of Opti-MEM, add 10 μl / well of poxvirus (MOI about 1), and incubate for 4 hours.

[0326] 3) Preparation of transfection complex: core plasmid: JBS-M(42)-aPD-L1-aCD3-aCD16 3 μg; auxiliary plasmids: pP 1.5 μg, pN 1.2 μg, pL 0.3 μg, pG 0.2 μg.

[0327] pN, pP, pL, and pG refer to plasmids cloned with genes corresponding to N protein, P protein, L protein, and G protein in Table 1, respectively, and express mutant N protein, P protein, L protein, and G protein required for virus rescue, respectively. Plasmid transfection was performed according to the method described in the instruction manual of Lipofectamine LTX.

[0328] Take two 1.5ml tubes, mark them as A and B tubes, and add 200μl of Opti-MEM respectively. In tube A, add 1.5μg pP, 1.2μg pN, 0.3μg pL, 0.2μg pG plasmid, 3μg JBS-M(42)-aPD-L1-aCD3-aCD16 plasmid in sequence, mix well, and then add 10μl / tube of transfection enhancement reagent. Add 12μl of transfection reagent (LTX) to tube B and mix well. Add the mixture in tube B to tube A, mix gently, and let stand at room temperature for 10 minutes.

[0329] 4) After incubating the poxvirus for 4 hours, discard the virus supernatant, add 600 μl of Opti-MEM medium to each well, add the plasmid transfection reagent mixture in 3) dropwise into the 6-well plate containing the cultured cells, gently shake the 6-well plate to evenly distribute the plasmids in the 6-well plate, and then place it in an incubator for culture.

[0330] 5) 6 hours after transfection, add 2 ml of 3% FBSDMEM culture medium to each well.

[0331] 6) 48 h after transfection, the virus solution and cells were collected for cytopathic effect, centrifuged at 2500 x g, the supernatant was collected, and 200 μl of the supernatant was used to resuspend the cell pellet, which was frozen and thawed three times at -80°C and centrifuged at 2500 x g. The supernatant was collected and mixed with the unfrozen and thawed supernatant, and filtered twice with a 0.22 μm filter to remove the poxvirus. The cell pellet was named VSV-M(42)-aPD-L1-aCD3-aCD16 P1.

[0332] 7) Take 1.5×10 6 The cells were diluted to 2 ml with 10% FBSDMEM medium and plated in six-well plates.

[0333] 8) After 16-20 hours, 500 μl of VSV-MP1 virus dilution was taken to infect 293 cells in a 6-well plate.

[0334] 9) After 24 hours, the virus solution and cells were collected and centrifuged at 2500×g. The supernatant was collected and 200 μl of the supernatant was used to resuspend the cell pellet. The pellet was frozen and thawed three times at -80°C and centrifuged at 2500×g. The supernatant was collected and mixed with the unfrozen and thawed supernatant. The pellet was filtered once with a 0.22 μm filter to remove the poxvirus and named VSV-M(42)-aPD-L1-aCD3-aCD16 P2.

[0335] 10) Virus single plaque screening and amplification

[0336] Take 1.5×10 6 The cells were diluted to 2 ml with 10% FBSDMEM medium and plated in six-well plates.

[0337] After 16-20 hours, the virus was serially diluted E6, E7, E8, E9, and E10, and 1 ml of the virus dilution was taken to infect 293 cells in a 6-well plate.

[0338] After 2 hours of infection, the virus solution was discarded, and after washing once with incomplete culture medium, 2.5 ml of covering layer (mixed with 2% soft agar and 4% FBS in 2XDMEM 1 and kept warm at 40°C) was added. After the agar layer solidified, the cells were inverted for culture.

[0339] On the second day after virus infection, 1.5×10 6 The cells were plated into six-well culture plates.

[0340] 72 hours after infection, 4 single plaques were picked up with a 1 ml pipette tip, resuspended in 2.5 ml of 2% FBSDMEM, and infected HEK293 cells. Single plaque screening was performed to screen all lesions of cells 48 hours after infection, and the virus solution and cells were collected, centrifuged at 2500 x g, and the supernatant was collected. 200 μl of the supernatant was used to resuspend the cell pellet, frozen and thawed three times at -80 ° C, centrifuged at 2500 x g, and the supernatant was collected. It was mixed with the unfrozen supernatant and filtered with a 0.22 μm filter and named VSV-M (42) -aPD-L1-aCD3-aCD16 P3.

[0341] The above operation was repeated for the second single-plaque screening, which was named VSV-M(42)-aPD-L1-aCD3-aCD16 P4.

[0342] 11) Take 1.5×10 7 The cells were diluted to a volume of 10 ml with 10% FBSDMEM medium and plated in a T75 culture flask.

[0343] 12) After 16-20 hours, 1 μl of VSV-MP4 dilution was taken to infect HEK 293 cells in a T75 culture flask.

[0344] 13) After 48 h, the virus solution and cells were collected and centrifuged at 2500 x g. The supernatant was collected and 200 μl of the supernatant was used to resuspend the cell pellet. The mixture was frozen and thawed three times at -80 °C and centrifuged at 2500 x g. The supernatant was collected and mixed with the unfrozen supernatant. The mixture was filtered once with a 0.22 μm filter to remove the poxvirus. The mixture was named VSV-M(42)-aPD-L1-aCD3-aCD16 P5, and the desired recombinant oncolytic virus attenuated strain was obtained.

[0345] (3) Gene sequencing. The viral genomic RNA was extracted using a Trizol kit and reverse transcribed using random primers. The product was recovered after 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2.

[0346] Example 1

[0347] In this example, the recombinant oncolytic virus (VSV-M(3)-aPD-L1-aCD3 single-chain antibody) provided in Preparation Example 3 was used to test the killing efficiency of different types of tumor cells.

[0348] The detection method is CCK-8 detection method, that is, VSV-M(3)-aPD-L1-aCD3 recombinant oncolytic virus is added to the culture medium of different cells, and the cell activity is detected by CCK-8 detection method after 48 hours. The cells tested include: human cells - A549, A673, HT29; mouse cells - MC-38, Hepa1-6, LLC.

[0349] The specific detection method is:

[0350] 1. Cell plating: After digesting and counting the cells, adjust the concentration to 1×10 5 100 μL / well was used to inoculate a 96-well plate to a cell density of 1×10 4 Pieces / hole.

[0351] 2. Virus dilution: Calculate the virus to infect 1×10 with an MOI of 100 4 Then take ten times the required virus stock solution and mix it with 2% FBS culture medium to make the total volume of the dilution liquid 1 ml. Then take 100 μL of the dilution liquid and add it to 900 μL 2% FBS culture medium and mix well. Perform 10-fold gradient dilution in sequence, with a total of eight gradients, corresponding to 8 MOIs: 100, 10, 1, 0.1, 0.01, 0.001, 0.0001, 0.00001.

[0352] 3. Virus infection: Add 100 μL / well culture medium to the blank control wells and cell control wells, and add the virus dilution to the corresponding experimental wells, 100 μL / well, for a total of 6 replicates. Add 200 μL / well PBS to the edge wells of the plate.

[0353] 4. CCK8 detection: After the above cell plates were cultured for 48 h, 10 μl of CCK8 reagent (from YEASEN40203ES80) was added to each well, the 96-well plate was gently shaken to mix, and incubated in a 37°C incubator for 1 h.

[0354] 5. Plate reading: Use an ELISA reader to detect the absorbance of each well at 450nm, and record and analyze the test results.

[0355] 6. The test was repeated twice. The results are shown in Table 4 and Figure 4-9 shown.

[0356] Table 4 Experimental results of the killing efficiency of the recombinant oncolytic virus provided in this application on different types of tumor cells

[0357]

[0358] From the experimental results in Table 4, it can be seen that when the above-mentioned recombinant oncolytic virus infects tumor cells with an MOI greater than 0.1, the killing efficiency of tumor cells can reach more than 50%. When the tumor cells are infected with MOI = 0.01, except for A549 cells, the killing efficiency of the virus on other tumor cells can still reach more than 50%. It can be seen that the above-mentioned recombinant oncolytic virus alone has a good killing effect on most tumor cells.

[0359] Example 2

[0360] In this example, the recombinant oncolytic virus (VSV-M(42)-aPD-L1-aCD16 single-chain antibody) provided in Preparation Example 4 was used to test the killing efficiency of different types of tumor cells.

[0361] The detection method is CCK-8 detection method, that is, VSV-M(42)-aPD-L1-aCD16 recombinant oncolytic virus is added to the culture medium of different cells, and the cell activity is detected by CCK-8 detection method after 48 hours. The cells tested include: human cells - A549, A673, HT29; mouse cells - MC-38, Hepa1-6, LLC.

[0362] The specific detection method is the same as that in Example 1, and will not be repeated here. The results are shown in Table 4 and Figure 10-15 shown.

[0363] It can be seen from the experimental results in Table 4 that when the above-mentioned recombinant oncolytic virus infects tumor cells with an MOI greater than 0.1, the inhibitory effect on HT29 cells and Hepa1-6 cells is weak, and the killing efficiency of other tumor cells can reach more than 50%. It can be seen that the above-mentioned recombinant oncolytic virus alone has a good killing effect on most tumor cells.

[0364] Example 3

[0365] In this example, the recombinant oncolytic virus (VSV-M (42) -aPD-L1-aCD3-aCD16 single-chain antibody) provided in Preparation Example 5 was used to test the killing efficiency of different types of tumor cells.

[0366] The detection method is CCK-8 detection method, that is, VSV-M(42)-aPD-L1-aCD3-aCD16 recombinant oncolytic virus is added to the culture medium of different cells, and the cell activity is detected by CCK-8 detection method after 48 hours. The cells tested include: mouse cells - MC-38, Hepa1-6, LLC.

[0367] The specific detection method is the same as that in Example 1, and will not be repeated here. The results are shown in Table 4 and Figure 16-18 shown.

[0368] It can be seen from the experimental results in Table 4 that when the above-mentioned recombinant oncolytic virus infects tumor cells with an MOI greater than 0.1, the inhibitory effect on Hepa1-6 cells is weak, and the killing efficiency of other tumor cells can reach more than 50%. It can be seen that the above-mentioned recombinant oncolytic virus alone has a good killing effect on most tumor cells.

[0369] Example 4

[0370] In this example, the recombinant oncolytic virus carrying the aPD-L1-aCD3 single-chain antibody provided in Preparation Example 3 (VSV-M(3)-aPD-L1-aCD3 single agent) was combined with PBMC cells to test the killing efficiency of tumor cells.

[0371] The specific method is as follows:

[0372] (1) 2×10 4 A549 cells were plated in 96-well plates and cultured overnight in a cell culture incubator at 37°C and 5% CO2.

[0373] (2) Infect and add PBMC cells according to the grouping in Table 5.

[0374] (3) The recombinant oncolytic virus was infected at an MOI of 0.1, and the PBMC cells were diluted in a final volume of 100 μl of 2% FBS F12K medium with a ratio of effector cells: target cells of 5:1. The corresponding recombinant oncolytic virus and PBMC cells were added to the corresponding 96-well plate A549 cells, and the remaining wells were supplemented with 100 μl of 2% FBS F12K medium. Starting from the 14th hour of infection, the cells were observed under a microscope every 4 hours.

[0375] (4) CCK-8 reagent was added 25 hours after infection to detect the tumor cell killing efficiency. The results are shown in Table 5 and Figure 19-20 shown.

[0376] Table 5 Experimental results of the killing efficiency of tumor cells by recombinant oncolytic viruses combined with other cells provided in this application

[0377]

[0378] Example 5

[0379] In this example, the recombinant oncolytic virus (VSV-M(42)-aPD-L1-aCD16 single-chain antibody) provided in Preparation Example 4 was combined with NK510 cells to test the killing efficiency of tumor cells.

[0380] The specific method is as follows:

[0381] (1) A549-EGFP and NK cells were revived and cultured for two generations before the experiment.

[0382] (2) Cell plating: When the confluence of A549-EGFP cells is 80-90% and the growth state is good, digest and count the cells and adjust the cell density to 1×10 5 The cell suspension was added into a 96-well plate at 100 μl / well using a dispenser and placed in a CO2 incubator for overnight culture at 37°C for 16-24 hours.

[0383] (3) Virus dilution: In a 1.5 ml EP tube, take 100 μl of the virus stock solution and add it to 900 μl of 2% FBSDMEM medium and mix well. Make 10-fold gradient dilutions in sequence, for a total of 6 gradients (the corresponding MOI for infected cells is 100, 10, 1, 0.1, 0.01, 0.001).

[0384] (4) The grouping experiment was carried out according to Table 4, with effector cells: target cells = 5:1, and NK cells and recombinant oncolytic viruses were added to incubate A549 cells.

[0385] (5) Virus inoculation: discard the cell supernatant in the 96-well plate, inoculate the virus dilution into a 96-well cell culture plate, inoculate one column of 8 wells for each dilution, inoculate 100 μl in each well, and set up a normal cell control group in one column.

[0386] (6) NK510 cell inoculation: resuspend ten times the required amount of NK510 cells into 1 ml of 2% FBSDMEM culture medium, and inoculate into the 96-well cell culture plate corresponding to the table, with 100 μl inoculated into each well. If NK cells are not needed, add 100 μl of culture medium.

[0387] (7) The cell fluorescence intensity was measured at 24h and 48h respectively. The cell growth inhibition rate was calculated as 1-(fluorescence intensity of the drug group ÷ fluorescence intensity of the control group). The results are shown in Table 5 and Fig.21 shown.

[0388] It can be seen from Table 5 and related figures that the killing effect of VSV-M(42)-aPD-L1-aCD16 on tumor cells is positively correlated with dose. At the same time, the combined effect of VSV-M(42)-aPD-L1-aCD16 and NK cells is much higher than the single-drug effect of VSV-M(42)-aPD-L1-aCD16 and the single-drug effect of NK cells, indicating that the bispecific antibody expressed by VSV-M(42)-aPD-L1-aCD16 can promote the bridging of tumor cells and NK cells and activate the tumor killing activity of NK cells.

[0389] It can be seen from the above results that the recombinant oncolytic virus carrying the bispecific single-chain antibody gene or the trispecific single-chain antibody gene provided in the present application has a significant inhibitory effect on tumor growth. And the recombinant oncolytic virus carrying the bispecific single-chain antibody gene or the trispecific single-chain antibody gene not only promotes the contact between tumor cells and effector cells by expressing bi-antibodies or tri-antibodies, but also stimulates the activity of effector cells, thereby enhancing the killing effect of immune cells on tumors, and its effect is much higher than the use of oncolytic viruses or immune cells alone.

[0390] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. A recombinant oncolytic virus expressing a bispecific or trispecific single-chain antibody and its use, characterized in that: The recombinant oncolytic virus includes an antibody gene integrated into its viral backbone; The antibody genes include a target antibody gene targeting tumor cells and at least one antibody gene targeting immune cells.

2. The recombinant oncolytic virus according to claim 1, characterized in that The immune cells are selected from any one or two of T cells, NK cells and macrophages.

3. The recombinant oncolytic virus according to claim 1, characterized in that When the immune cell is a T cell, the antibody gene targeting the immune cell is selected from any one or two of the following (a)-(b): (a) CD3 antibody gene; (b) T cell-related immune checkpoint antibody genes.

4. The recombinant oncolytic virus according to claim 3, characterized in that The T cell-related immune checkpoint antibody genes include inhibitor antibody genes and agonist antibody genes; Optionally, the inhibitor antibody gene is selected from any one or two of CTLA-4, PD-1, TIM3, BTLA, VISTA, and LAG3; Optionally, the agonist antibody gene is selected from any one or two of CD28, OX40, CD27, CD30, CD40, GITR, ICOS, 4-1BB, LIGHT, and CD28H.

5. The recombinant oncolytic virus according to claim 1, characterized in that When the immune cells are NK cells, the antibody genes targeting the immune cells are selected from any one or two of CD16a, NKG2D, CD94 / NKG2C, NKp30, NKp44, and NKp46.

6. The recombinant oncolytic virus according to claim 1, characterized in that When the immune cell is a macrophage, the antibody gene targeting the immune cell is an antibody gene of SIRPα.

7. The recombinant oncolytic virus according to claim 1, characterized in that The recombinant oncolytic virus includes any one or more of rhabdovirus, poxvirus, herpes simplex virus, measles virus, Semliki Forest virus, poliovirus, reovirus, Seneca Valley virus, echovirus, coxsackievirus, Newcastle disease virus and Maraba virus.

8. The recombinant oncolytic virus according to claim 1, characterized in that The recombinant oncolytic virus is vesicular stomatitis virus.

9. The recombinant oncolytic virus according to claim 8, characterized in that The vesicular stomatitis virus comprises M protein, G protein, N protein, P protein and L protein; Compared with the amino acid sequence shown in SEQ ID NO 1, 1) The amino acid substitutions of the M protein include G21E and N32S; 2) the amino acid substitutions of the M protein include G21E, N32S, and M33A; 3) The amino acid substitutions of the M protein include G21E, N32S, M33A, and N49D; 4) the amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, and H54Y; 5) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, H54Y, and L111A; 6) the amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, H54Y, L111A, and A133T; 7) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, H54Y, L111A, A133T, and V225I; 8) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, and V225I; 9) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, and V225I; 10) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 11) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 12) The amino acid substitutions of the M protein include M33A, N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 13) The amino acid substitutions of the M protein include N49D, M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 14) The amino acid substitutions of the M protein include M51R, H54Y, L111A, A133T, V221F, V225I, and S226R; 15) The amino acid substitutions of the M protein include H54Y, L111A, A133T, V221F, V225I, and S226R; 16) The amino acid substitutions of the M protein include L111A, A133T, V221F, V225I, and S226R; 17) The amino acid substitutions of the M protein include A133T, V221F, V225I, and S226R; 18) The amino acid substitutions of the M protein include V221F, V225I, and S226R; 19) The amino acid substitutions of the M protein include V225I and S226R; 20) the amino acid substitution of the M protein comprises S226R; 21) The amino acid substitutions of the M protein include N32S, N49D, H54Y, and V225I; 22) The amino acid substitutions of the M protein include N32S, N49D, H54Y, V225I, and S226G; 23) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; 24) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; 25) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; 26) The amino acid substitutions of the M protein include N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; 27) The amino acid substitutions of the M protein include G21E, N32S, N49D, M51A, H54Y, L111A, V225I, and S226R; 28) The amino acid substitutions of the M protein include M51R, V221F, and S226R; 29) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, deletion of the leucine encoding base at position 111, V221F, V225I, and S226R; 30) The amino acid substitutions of the M protein include N32S, N49D, M51R, H54Y, L111A, V221F, V225I, and S226R; 31) The amino acid substitutions of the M protein include G21E, N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; 32) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; 33) The amino acid substitutions of the M protein include G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; Compared with the amino acid sequence shown in SEQ ID NO 4, the site mutations of the G protein include any one or more of H38Y, V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H; Compared with the amino acid sequence shown in SEQ ID NO 7, the site mutation of the N protein includes any one or more of I14V, R155K, and S353N; Compared with the amino acid sequence shown in SEQ ID NO 9, the site mutation of the P protein includes any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D; Compared with the amino acid sequence shown in SEQ ID NO 11, the site mutation of the L protein includes any one or more of S87P, I397T, I487T, and F873L.

10. The recombinant oncolytic virus according to claim 1, characterized in that The recombinant oncolytic virus includes M protein, G protein, N protein, P protein and L protein; The M protein comprises an amino acid sequence as shown in any one of SEQ ID NOs 2-3; The G protein comprises an amino acid sequence as shown in any one of SEQ ID NOs 5-6; The N protein comprises the amino acid sequence shown in SEQ ID NO 8; The P protein comprises the amino acid sequence shown in SEQ ID NO 10; The L protein comprises an amino acid sequence as shown in any one of SEQ ID NOs 12-14.

11. The recombinant oncolytic virus according to claim 1, characterized in that The injection method of the recombinant oncolytic virus includes, but is not limited to, any one or more of intratumoral injection, intravenous injection, intraperitoneal injection, thoracic injection, pelvic injection, subcutaneous injection, intrathecal injection, intramuscular injection, and intranasal administration.

12. The recombinant oncolytic virus according to claim 1, characterized in that The antibody expressed by the target antibody gene targeting tumor cells or the antibody gene targeting immune cells is the entire sequence or a partial sequence of the antibody.

13. The recombinant oncolytic virus according to claim 1, characterized in that The target antibody genes targeting tumor cells include genes of anti-hematological tumor antigen antibodies and genes of anti-solid tumor antigen antibodies.

14. The recombinant oncolytic virus according to claim 13, characterized in that The solid tumor antigens include but are not limited to 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, CD24, CD28, CD137, CTLA-4, HER2, HER3, FAS, LGR5, C5aR1, A2AR, FGFR1, FGFR2, FGFR3, FGFR4, GITR, LTβR, TRAIL receptor 1, TRAIL receptor 2, PSMA, PSCA, CAIX, EGFR1, EGFRvIII, folate receptor, ephrin receptor, PDGFRa, ErbB2, ErbB3, CD2, CD40, CD74, CCAM5, CCA M6, p53, cMET, HGFR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE- 3. GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MΜC2, P-cadherin, GDF8, Cripto, MΜC5AC, PRAME, P15, RΜ1, RΜ2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MΜM-1, MΜM-2, MΜM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / A ML, LDLR / FΜT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, DR5, PD-1, PD-L1, IGF-1R, CXCR4, NRP-1, GPC2, GPC3, EphA2, B7-H3, B7-H4, gpA33, SSTR 2. GD2, VEGF-A, VEGFR-2, PDGFR-a, RANKL, MSLNTROP2, FOLR1, AXL, CLDN18.2, MMC1, TPBG, CEA, EpCAM, Nectin-4, CD39, CD73, CD44, DLL3, CLDN18.1, KAT6A / B, PI3K, c-Kit, TRBCI; CLDN6, TYRP1, Ras, MOSPD2, HLA-A, HLA-G, HLA classII, CDH3, CDH17, CDH19, ENPP3, LILRB4, STEAP1, TrkB, oxMIF, P95HER2, CD133, LRRC15, TMEFF2, Sμrvivin, KLK2, Siglec-6, heme oxygenase, DLK1, CACNA1G-AS1, TSPAN8, GC-C, ETA, LY6G6D, P53 R175H, NCR3LG1, ADAM17, DLL1, GCP2, CEACAM5, mesothelin;. The blood tumor antigens include but are not limited to BCMA, CD5, CD7, CD10, FcγRIIIa, FcγRIIIb, CD19, CD20, CD22, CD30, CD33, CD34, CD37, CD38, CD47, CD56, CD70, CD123, CD138, CLL-1, ROR1, NKG2DL1 / 2, FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, SLAMF7, TCR B-chain, ITGB7, TACI, CD79b, EBV.

15. The recombinant oncolytic virus according to claim 1, characterized in that When the antibody gene includes a target antibody gene targeting tumor cells and an antibody gene targeting immune cells, the antibody gene is a bispecific antibody; The target antibody gene targeting tumor cells and the antibody gene targeting immune cells are arranged as follows: N-target antibody gene-C+Linker+N-target immune cell antibody gene-C; Or, N-antibody gene targeting immune cells-C+Linker+N-target antibody gene-C.

16. The recombinant oncolytic virus according to claim 15, characterized in that The antibody gene is aPD-L1-aCD3, the gene sequence of the aPD-L1-aCD3 includes the nucleotide sequence shown in SEQ ID NO 15, and the amino acid sequence of the aPD-L1-aCD3 is the amino acid sequence shown in SEQ ID NO 16.

17. The recombinant oncolytic virus according to claim 15, characterized in that The antibody gene is aPD-L1-aCD16, the gene sequence of the aPD-L1-aCD16 includes the nucleotide sequence shown in SEQ ID NO 17, and the amino acid sequence of the aPD-L1-aCD16 is the amino acid sequence shown in SEQ ID NO 18.

18. The recombinant oncolytic virus according to claim 1, characterized in that When the antibody gene includes a target antibody gene targeting tumor cells and two antibody genes targeting immune cells, the antibody gene is a trispecific antibody; The arrangement of the target antibody gene targeting tumor cells and the antibody gene targeting immune cells is selected from any of the following: (1) N-target antibody gene-C+Linker+N-target T cell antibody gene-C+Linker+N-target NK cell antibody gene-C; (2) N-target antibody gene-C+Linker+N-target NK cell antibody gene-C+Linker+N-target T cell antibody gene-C; (3) N-antibody gene targeting T cells-C+Linker+N-antibody gene targeting NK cells-C+Linker+N-target antibody gene-C; (4) N-targeted T cell antibody gene-C+Linker+N-targeted antibody gene-C+Linker+N-targeted NK cell antibody gene-C; (5) N-targeting NK cell antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting T cell antibody gene-C; (6) N-NK cell-targeted antibody gene-C+Linker+N-T cell-targeted antibody gene-C+Linker+N-target antibody gene-C; (7) N-target antibody gene-C+Linker+N-target T cell antibody gene-C+Linker+N-target macrophage antibody gene-C; (8) N-target antibody gene-C+Linker+N-target antibody gene-C for macrophages+Linker+N-target antibody gene-C for T cells; (9) N-antibody gene targeting T cells-C+Linker+N-antibody gene targeting macrophages-C+Linker+N-target antibody gene-C; (10) N-targeted T cell antibody gene-C+Linker+N-targeted antibody gene-C+Linker+N-targeted macrophage antibody gene-C; (11) N-targeting macrophage antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting T cell antibody gene-C; (12) N-antibody gene targeting macrophages-C+Linker+N-antibody gene targeting T cells-C+Linker+N-target antibody gene-C; (13) N-target antibody gene-C+Linker+N-target macrophage antibody gene-C+Linker+N-target NK cell antibody gene-C; (14) N-target antibody gene-C+Linker+N-target NK cell antibody gene-C+Linker+N-target macrophage antibody gene-C; (15) N-antibody gene targeting macrophages-C+Linker+N-antibody gene targeting NK cells-C+Linker+N-target antibody gene-C; (16) N-targeting macrophage antibody gene-C+Linker+N-targeting antibody gene-C+Linker+N-targeting NK cell antibody gene-C; (17) N-targeted NK cell antibody gene-C+Linker+N-targeted antibody gene-C+Linker+N-targeted macrophage antibody gene-C; (18) N-NK cell targeting antibody gene-C+Linker+N-macrophage targeting antibody gene-C+Linker+N-target antibody gene-C.

19. The recombinant oncolytic virus according to claim 18, characterized in that The antibody gene is aPD-L1-aCD3-aCD16, the gene sequence of the aPD-L1-aCD3-aCD16 includes the nucleotide sequence shown in SEQ ID NO 19, and the amino acid sequence of the aPD-L1-aCD3-aCD16 is the amino acid sequence shown in SEQ ID NO 20.

20. The recombinant oncolytic virus according to claim 1, characterized in that The recombinant oncolytic virus is used to continuously kill abnormally proliferative cells.

21. The recombinant oncolytic virus according to claim 20, characterized in that The abnormally proliferative cells are selected from tumor cells or cells related to tumor tissue.

22. The recombinant oncolytic virus according to claim 21, characterized in that The tumor includes a solid tumor or a hematological tumor.

23. The recombinant oncolytic virus according to claim 21, characterized in that The tumors include, but are not limited to, acute lymphoblastic leukemia, acute B-lymphocytic leukemia, chronic non-lymphocytic leukemia, non-Hodgkin's lymphoma, anal cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, breast cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasms, colorectal cancer, endometrial cancer, ependymoma, esophageal cancer, diffuse large B-cell lymphoma, sensorineuroblastoma, Ewing's sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, hepatocellular carcinoma carcinoma, hypopharyngeal cancer, Kaposi's sarcoma, kidney cancer, Langerhans cell hyperplasia, laryngeal cancer, liver cancer, lung cancer, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumors, pharyngeal cancer, pituitary tumors, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous neck cancer, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and vascular tumors.

24. A composition, characterized in that The composition comprises the recombinant oncolytic virus according to claim 1.

Images