Rice hot1 gene and its alleles, molecular markers and application
By cloning and overexpressing the rice Hot1 gene and its allele Hot1-Hap7, the limitation of high temperature on rice growth was resolved, the high temperature tolerance of rice was significantly improved, important genetic resources and molecular markers were provided for breeding, and the fruit set rate and yield under high temperature conditions were increased.
Patent Information
- Application Number
- CN202510016286.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-06
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2045-01-06
AI Technical Summary
In the existing technology, high temperature has a serious impact on the growth and development of rice, especially the heading and flowering period, resulting in reduced pollen fertility and yield. The lack of effective high-temperature-resistant gene resources and molecular markers makes it difficult to improve the high-temperature resistance of rice through breeding.
The rice Hot1 gene and its allele Hot1-Hap7 were cloned, and corresponding molecular markers were developed. By overexpressing the Hot1 gene and screening plants carrying the Hot1-Hap7 allele, the high temperature tolerance of rice was improved.
It has significantly improved the high temperature resistance of rice, provided important genetic resources and molecular markers, offered an effective way for high temperature resistance breeding, and increased the fruit set rate and yield of plants under high temperature conditions.
Smart Images

Figure CN119685346B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular biology technology, and in particular to a rice Hot1 Genes and their alleles, molecular markers and their applications. Background Art
[0002] Rice is a high-temperature, short-day crop with an average optimum growth temperature of around 28°C (daytime) and 22°C (nighttime). Both excessively high and low ambient temperatures can severely restrict rice growth and development. Research has shown that high temperatures significantly impact both vegetative and reproductive stages of rice, with the most significant impact occurring during the heading and flowering stages (Lin et al., 2008). Short-term extreme high temperature stress during heading and flowering can severely reduce pollen fertility and hinder anther dehiscence (Guan et al., 2012), significantly reducing rice yield or even completely eliminating the crop. High temperatures during the heading and flowering stages exhibit a transient effect, often affecting only a localized area of the plant, particularly damaging floral organs. Research by the International Rice Research Institute (IRRI) has shown that high temperatures during flowering primarily severely affect the development of male organs. When temperatures fall below 41°C, the pollination capacity of the stigma is largely unaffected. In contrast, the stamens are highly sensitive. Brief high temperatures during flowering can cause a rapid loss of water in the anthers, resulting in a sharp decrease in pollen shedding and restricted pollen germination, ultimately leading to fertilization failure and the formation of a large number of empty grains (Satake et al., 1978). To date, several QTLs associated with high temperature tolerance during heading and flowering have been identified in rice, but few loci have been functionally characterized and have potential applications in breeding.
[0003] High temperatures threaten rice production security in my country and around the world. Breeding heat-tolerant varieties is the most effective way to address climate change and ensure stable rice yields. However, high temperature is a complex quantitative trait, and the target phenotype is highly susceptible to environmental influences, making the selection of new varieties challenging. Molecular breeding, based on resources, with genes at the core and varieties as the vehicle, is the most effective approach to addressing this problem (Zhao et al., 2017). The identification and utilization of key heat-tolerant genes in breeding remains the greatest technical bottleneck. Therefore, cloning key heat-tolerant genes and identifying superior alleles within their natural variation can provide important genetic resources and material reserves for heat-tolerant breeding. Summary of the Invention
[0004] In order to solve the above-mentioned deficiencies in the prior art, the present invention aims to provide a rice Hot1 Genes and their alleles, molecular markers and their applications, to provide a new gene and its excellent alleles and molecular markers for regulating high temperature tolerance in rice.
[0005] The technical solution of the present invention to solve the above technical problems is as follows: a rice Hot1 Gene, Hot1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.
[0006] The present invention provides a rice Hot1 The application of genes in regulating high temperature tolerance in rice.
[0007] Furthermore, regulating the high temperature tolerance of rice is to overexpress rice Hot1 Genes can improve rice's tolerance to high temperatures.
[0008] The present invention provides a rice Hot1 Alleles of a gene, Hot1 The alleles of a gene are named Hot1-Hap7 The nucleotide sequence of its coding region is shown in SEQ ID NO.2.
[0009] The present invention provides an allele Hot1-Hap7 Application in breeding high temperature resistant rice varieties.
[0010] The present invention provides a rice Hot1 The molecular marker of the gene allele is a SNP site -326bp upstream of TG.
[0011] Furthermore, if the SNP site mutates from A to G, the rice will be resistant to high temperature.
[0012] The present invention provides a primer for identifying the above molecular marker, the primer comprising an inner primer and an outer primer; wherein the nucleotide sequence of the inner primer is shown as SEQ NO 14 and SEQ NO 15; the nucleotide sequence of the outer primer is shown as SEQ NO 16 and SEQ NO 17.
[0013] The present invention provides an application of the above-mentioned molecular marker in one or more of the following:
[0014] (1) Identification of high-temperature-tolerant rice varieties;
[0015] (2) Screening of high-temperature-resistant rice varieties;
[0016] (3) Improvement of high-temperature tolerant rice germplasm resources;
[0017] (4) Assisted breeding of high-temperature-resistant rice.
[0018] The present invention also provides a method for identifying high-temperature-resistant rice varieties, comprising the following steps: using the genomic DNA of the sample to be tested as the template DNA, performing PCR amplification using the above-mentioned inner primers and outer primers, and if the inner primer fragment is 162 bp and the outer primer fragment is 290 bp, it indicates that the sample to be tested is a high-temperature-resistant rice variety.
[0019] The present invention has the following beneficial effects:
[0020] (1) The present invention cloned a high temperature resistant gene in rice Hot1 Overexpression experiments have shown that this gene positively regulates the high temperature tolerance of rice. Subsequent haplotype analysis showed that the gene originated from the Indian rice Kasalath. Hot1 Allele Hot1- Hap7 The introduction of japonica rice Nip can significantly improve the plant's ability to withstand high temperatures.
[0021] (2) The present invention obtains a new high temperature resistant gene Hot1 The excellent haplotype of rice was identified, and molecular markers were used to screen out an excellent allele plant. Through high temperature treatment and agronomic trait analysis, it was proved that this allele had a significant contribution to the high temperature resistance of rice, providing an important genetic resource for the breeding of high temperature resistance rice. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 This is the carrier map of the carrier PC2300 used in Example 1 of the present invention;
[0023] Figure 2 This is a phenotype diagram of a plant overexpressing the rice Hot1 gene in Example 1 of the present invention;
[0024] Figure 3 This is the haplotype analysis diagram of the Hot1 gene in Example 2 of the present invention;
[0025] Figure 4 This is the molecular marker map of the Hot1-Hap7 alleles in Example 2 of the present invention;
[0026] Figure 5 This is a graph showing the high temperature resistance test of the Hot1-Hap7 type plant in Example 3 of the present invention;
[0027] Figure 6 This is a phenotype diagram of the Hot1-Hap7 type plants in Example 3 of the present invention under natural high temperature conditions in multiple fields;
[0028] Figure 7 This is a graph showing the natural high temperature test of Hot1-Hap7 plants in multiple fields in Example 3 of the present invention. DETAILED DESCRIPTION
[0029] The following examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. In the examples, where specific conditions are not specified, the experiments were performed under conventional conditions or those recommended by the manufacturer. Reagents or instruments used, where the manufacturer is not specified, are commercially available conventional products.
[0030] Example 1: Hot1Gene overexpression construction, transformation and plant phenotype observation
[0031] rice Hot1 The gene coding region sequence was obtained from Rice Resource Center ( http: / / ricerc.sicau.edu.cn ).
[0032] The vector used for overexpression was PC2300 (see Figure 1 The coding region sequence was amplified from Nip cDNA using specific primers (F1-primer and R1-primer). Sma1 and Xba1 restriction sites were selected, and the fragment was ligated into the vector using CEII single-fragment recombinase from Novizan. The constructed overexpression vector was transformed into Kasalath, and Agrobacterium transformation and transgenic experiments were performed by Wuhan Boyuan Biotechnology Co., Ltd.
[0033] After DNA was extracted from the T0 generation of overexpression plants, primers (F2-primer and R2-primer) were used to detect the insertion of the fragment. Then RNA was further extracted from the positive plants detected and used Hot1 Quantitative primers (F3-primer and R3-primer) detection Hot1 Gene expression level, internal reference primers UBQ5 (UBQ5-F1 and UBQ5-R1) were used to retain three high expression lines and propagate to the T1 generation stable lines (see Figure 2 A).
[0034] The T1 generation of stable positive high-expressing plants were planted in the field until the late tillering and jointing stage, and transferred to the greenhouse 10 days before heading. After 7 days of recovery at mild temperature (22-32°C temperature gradient, 12 / 12 hour light), high temperature treatment (32-42°C temperature gradient, 12 / 12 hour light) was started at the heading and flowering stage for 4 days. After the treatment, the wild-type plants and overexpressing plants were transferred to the field to resume growth until harvest, and the seed setting rate and yield per plant were evaluated (see Figure 2 B-2C).
[0035] The primer sequences are as follows:
[0036] F1-primer: ggagaggacagggtacccgggATGGCCGGGGGGAGGAGG (SEQ ID NO.3);
[0037] R1-primer: ggtactagtgtcgactctagaTCCCTGAACTTGTAATTCGGTTT (SEQ ID NO.4);
[0038] F2-primer: ATGGCCGGGGGGAGGAGG (SEQ ID NO.5);
[0039] R2-primer:TCCCTGAACTTGTAATTCGGTTT (SEQ ID NO.6);
[0040] F3-primer: GATTGGAGGAGGAAACATCAGGA (SEQ ID NO.7);
[0041] R3-primer: CAGAACCAAATCTGCAGGAAAGA (SEQ ID NO.8);
[0042] UBQ5-F1:ACCTTCATGGCCAACCACTT (SEQ ID NO.9);
[0043] UBQ5-R1: CTAAGCCTGCTGGTTGTAGA (SEQ ID NO. 10);
[0044] Example 2: Hot1 Gene haplotype analysis
[0045] Hot1 The gene promoter and coding region sequences were obtained from the second generation sequencing database RiceVarmap v2.0 databasee ( http: / / ricevarmap.ncpgr.cn / ) were obtained. To ensure data accuracy, we filtered out incompletely sequenced varieties. Hot1 The coding and promoter regions of Hot1 were sequenced differently and divided into 7 haplotypes. Sequence analysis showed that there were only 4 SNP variations in the coding region of Hot1, 2 of which were synonymous mutations. However, the promoter region within 1.2K upstream of ATG was very different in different varieties (see Figure 3 A-3B).
[0046] We then collected seven representative varieties of haplotypes and used qPCR primers (qPCR-F and qPCR-R) to detect Hot1 Gene expression levels, using UBQ5 (UBQ5-F2 and UBQ5-R2) as internal reference primers, showed that the expression level of haplotypes represented by Aus rice Kasalath was significantly higher than that of other varieties. In vitro promoter activity analysis demonstrated the strong promoter ability of this type of promoter (see Figure 3 C), indicating Hot1-Hap7 type may be a potential excellent haplotype.
[0047] The primer sequences are as follows:
[0048] qPCR-F: GATTGGAGGAGGAAACATCAGGA (SEQ ID NO. 11);
[0049] qPCR-R: CAGAACCAAATCTGCAGGAAAGA (SEQ ID NO. 12);
[0050] UBQ5-F2:ACCTTCATGGCCAACCACTT (SEQ ID NO.13);
[0051] UBQ5-R2: CTAAGCCTGCTGGTTGTAGA (SEQ ID NO. 14).
[0052] Example 3: Hot1-Hap7 Allelic molecular marker development
[0053] Sequence analysis showed that Hap7 Hot1 The promoter sequence (SEQ ID NO. 19) differs significantly from that of other types. To facilitate the screening of naturally occurring variants of the Hap7 genotype in substitution lines with Nip as the recipient and Kasalath as the donor, we developed a molecular marker targeting the SNP difference site at the -326 bp upstream position of the TG between the two haplotypes. Inner and outer primers were designed to distinguish the sequence differences between the two. The inner primer fragment for Nip type is 184 bp, the inner primer fragment for Kasalath type is 162 bp, and the outer primer fragment is 290 bp (see Figure 4 ).
[0054] The sequences of the inner and outer primers are as follows:
[0055] rF primer: GGTTTCCTTTGGGTAGGTGGGTGTGGGGGG (SEQ ID NO.15);
[0056] rR primer:CCCCTCCTGCCACCCAACTCCACGCT (SEQ ID NO.16);
[0057] wF primer: GCCTTGGTGGGATCTCCGAGGCGGTTTC (SEQ ID NO.17);
[0058] wR primer: TGGCACTGGGCTGTTCTTCCTCCGAGCA (SEQ ID NO. 18).
[0059] Test Example 1: Hot1-Hap7 High temperature resistance test analysis of type plants
[0060] The obtained Hot1-Hap7 Substitution line plants were tested for high temperature tolerance. Hap7 Plants were planted in the field until the late tillering and jointing stages, and then transferred to a greenhouse 10 days before heading. After 7 days of recovery at a mild temperature (22-32°C temperature gradient, 12 / 12 hour light intensity), high temperature treatment (32-42°C temperature gradient, 12 / 12 hour light intensity) was initiated at the heading and flowering stages for 2 days. After treatment, the plants were transferred to the field to resume growth until harvest, and the fruit set rate and yield per plant were evaluated. The treatment results showed that plants carrying the Hap7 haplotype had significantly improved heat tolerance (see Figure 5 ).
[0061] Test Example 2: Hot1-Hap7 Analysis of natural high temperature test on various fields of type plants
[0062] Summer 2024 will accept Nip and SSSL-Hot1 Hap7 Plants were planted in three locations, namely Wenjiang, Chengdu, Yongchuan, Chongqing, and Changsha. Field temperature changes during heading in July and August were recorded. Agronomic traits, including plant morphology, ear fruiting rate, and single plant yield, were then compared between the two materials at the three experimental sites. The results showed that the average temperature in July and August in the summer of 2024 at the three locations was Changsha > Chongqing > Wenjiang. The analysis of fruiting rate and yield data showed that there was a significant correlation between yield traits and temperature at the three locations, and SSSL-Hot1 Hap7 The plants were better than Nip (see Figure 6 and Figure 7 ).
[0063] In the present invention Hot1 Gene coding region sequence:
[0064]
[0065] Hot1-Hap7 Nucleotide sequence of the coding region:
[0066]
[0067] Hot1-Hap7 Nucleotide sequence of the promoter:
[0068] TTTTTAAAATATATTTATAGCTGGCTTATAATCTGCTATTGTACCTATTCTAATTACCACTTGTAAGAGTTACAAATACTAGTTAATTATTCCGGGAAAAACAATCACCACTAATCCACTACTATCCACCAGGGCAACCAACAAACCAAAACCCAAC CGGCCAGACAAGGCAGGAGGAGGCCAACGAGCCAACCCGCCCCACACGTCGTCGACTCGGCATCGCGACCTCACCCCGTCGC
[0069] CTACTCCATTCCAATTCCATTCACC CCCCCCCCCCCCCCCCCCTCAAAGCTTCGAATTTTTCCTTCCCAAAAATCATCACCACCACCACCATCACCACCTTCCTCCTCCTCCTCCTCTTCTTTCTTCTTGTTCGCGCGTAGCCGCACCACGCGTCCCCCGCGATTCGCCCCACGCCGCGCCTCGCACGGAACCTCCTCTCTCTCTGCTCG CCGCGCATTGCCGCCGCCGCCGCCGCCGCCGCCGCAACCAGATTCCATCCGTGCGCTGCGCTGCGCTGCGCGCGCTTTTTTTTTTTTGTTCTTTCCTTCCCGCGCCGCGCGCCAAGTTAAGTTGTTGGGAGGGAGGAGGAGGAGAGACGACGACGAGTCGCCCCCGCGCGCCGCATGGATCAGGGTCTCCGGTGCTTCAGCCACCGCCGCCGCCGCCGCCTCGAGCTGCGCTTCTTGGGGTTCTGGGACCCGTGCGCCGCCGCCGCCGCCTTGGTGGGATCTCCGAGGCGGTTTCTCTAGGATTTCTCCCTCTCTCTCTCTCCCTTCCTTCCTCTTCTTAGCTGCGAGTTCACTTGCAGCTCCCAGCTTGTTGCGCAGCTGTGCGTGCGTGCGTGCGGTTTCCTTTGGGTAGGTGGGTGTGGGTGGGAGTGGAGTTGGGTGGCAGGAGGGGCTCGCAATTTATTGCGAGGTGTCTCCTCCTGGCCCAAAGGAGGGGGGATTTCTTTTCTCCCTGAATCTGAGCTGTTCTTGCTCGGAGGAAGAACAGCCCAGTGCCAGTTTGAGGACTGATTAATCAGCTGCTGATTTCGTTGGGTTCTTGTTTTGCTCCCAACAAATTCAATAATCTTGGAGCGATTTGAGGTCTCAGTGGTGGTGGTGGCCAAAGGCCCTGTTTCTGTTCCTGTTGCCCTCTTTGTCCTCCTGGGTTGTGGAGAGCTGCTCACTGATTTGGCTGTCAGTTTTGGGGCA(SEQ ID NO.19)。
[0070] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. Overexpression in Rice Hot1 The application of the gene in improving the high temperature tolerance of rice is characterized in that: described Hot1 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. Rice Hot1 Alleles of a gene Hot1-Hap7 The application in breeding high temperature resistant rice varieties is characterized in that: The allele Hot1-Hap7 The nucleotide sequence of the coding region is shown in SEQ ID NO.2.