Method for detecting miRNA-21 based on CHA circuit and CpAgo protein catalytic combination

Abstract

The invention provides a method for detecting miRNA-21 based on CHA circuit and CpAgo protein catalytic combination, two DNA hairpins H1 and H2 are included, the 5'end of H1 is modified with an FAM fluorophore, and the middle is modified with a BHQ1 quenching group. The target microRNA specifically triggers CHA based on DNA, triggers a DNA circulation circuit and outputs a large amount of dsDNA, the microRNA is released to be used for a next circulation circuit, the dsDNA formed by H1 and H2 is recognized by two guide chains and CpAgo protein, a CpAgo-guide-dsDNA ternary complex is formed, the dsDNA is cut, a fluorophore and a quenching group are separated, and high-sensitivity detection of the microRNA is achieved. Finally, one-step rapid detection of microRNA is realized, and the problems of high detection cost, long time, low sensitivity and the like in the prior art are improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and specifically provides a method for detecting miRNA-21 based on CHA circuit and CpAgo protein catalytic combination. Background Art

[0002] miRNA-21 is upregulated in many cancers and is associated with the etiology, progression and prognosis of tumors, including brain cancer, liver cancer, prostate cancer and lung cancer. During cancer treatment, detecting the expression level of miRNA-21 helps to assess the prognosis of cancer patients and promptly detect recurrence or drug resistance. It provides a basis for formulating personalized treatment plans and promotes the development of cancer treatment.

[0003] miRNA is a type of short non-coding RNA, usually only about 22 nucleotides long, which makes them easy to lose during extraction and detection. And because of their small fragments, they are easily affected by various internal and external factors and degraded. Low-abundance miRNA samples may not provide enough information for tumor diagnosis, resulting in reduced accuracy of diagnostic results. The problem of low abundance of tumor miRNA samples poses a challenge to tumor research and clinical diagnosis.

[0004] Traditional standard methods such as real-time quantitative PCR (qRT-PCR) have limitations in detecting miRNA-21, such as the difficulty in designing primers and probes, which affects the sensitivity of the detection results. The specificity depends on the design of primers and probes, and there may be non-specific amplification and false positive results.

[0005] Microarray technology fixes a large number of DNA probes on a microchip, which are complementary to specific miRNA sequences. The RNA in the sample is hybridized with the chip, and the expression level of miRNA-21 is quantified by detecting the hybridization signal. This method has limited quantitative accuracy and is difficult to achieve absolute quantification. It is costly and requires professional equipment and technicians.

[0006] Northern blot hybridization separates RNA from the sample and transfers it to a nylon membrane, which is then hybridized with a labeled DNA probe. The expression level of miRNA-21 is qualitatively or quantitatively determined by detecting the hybridization signal. This method is cumbersome and time-consuming. It has low sensitivity and may not be accurate for low-abundance miRNA-21 detection.

[0007] Photoelectrochemical (PEC) detection technology builds a biosensor with photoelectric response and uses the hybridization reaction between miRNA-21 and specific probes to trigger the change of photoelectric signal, thereby quantifying the expression level of miRNA-21. Although it has the advantages of low price, wide detection range and low detection limit, the technology is still in the development stage and may have problems with stability and repeatability. And professional equipment and technicians are required to build and operate biosensors.

[0008] RNA sequencing is a high-throughput sequencing of RNA in samples, and the expression level of miRNA-21 is quantified by comparing the sequencing results with a known miRNA sequence database. This method is costly and requires professional sequencing equipment and technicians. Data processing and analysis are complex, and the detection of low-abundance miRNA-21 may be inaccurate, and may be affected by sequencing depth and coverage.

[0009] Therefore, it is very important to develop a method for detecting miRNA-21 with high accuracy, strong sensitivity, low cost, simple operation and rapidity. Summary of the invention

[0010] The present invention provides a method for detecting miRNA-21 based on CHA circuit and CpAgo protein catalysis. The detection method provided by the present invention reaches the femtomolar detection limit, and solves the problems of complex operation, high cost, long time, low sensitivity and the like existing in the existing technology.

[0011] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0012] A method for detecting miRNA-21 based on CHA circuit and CpAgo protein catalytic binding, comprising the following steps:

[0013] S1. Extraction of miRNA nucleic acid from the sample to be tested;

[0014] S2. Preparation of CHA-CpAgo reaction system: Mix H1, H2, gDNA1, gDNA2, CpAgo protein and 10×reaction buffer to prepare CHA-CpAgo reaction mixture:

[0015] S3. Detection of target miRNA-21 by CHA-CpAgo system: Add the miRNA extracted in step S1 to the mixed solution of CHA-CpAgo reaction system prepared in step S2, and carry out constant temperature reaction to obtain.

[0016] Preferably, the miRNA in step S1 includes miRNA-21, and the nucleotide sequence of the miRNA-21 is shown as SEQ ID NO.1.

[0017] 5'-UAGCUUAUCAGACUGAUGUUGA-3' (SEQ ID NO. 1);

[0018] Preferably, in step S2, the nucleotide sequence of H1 is shown as SEQ ID NO.2, the nucleotide sequence of H2 is shown as SEQ ID NO.3, the nucleotide sequence of gDNA1 is shown as SEQ ID NO.4, and the nucleotide sequence of gDNA2 is shown as SEQ ID NO.5.

[0019] H1: (SEQ ID NO.2);

[0020] H2: (SEQ ID NO.3);

[0021] gDNA1:5'-P-TCAGTCTACGGACTTAG-3' (SEQ ID NO.4);

[0022] gDNA2: 5'-P-AAGCTAAGTCCGTAGAC-3' (SEQ ID NO. 5).

[0023] The method provided by the present invention comprises the nucleotide sequences of two DNA hairpins H1 and H2 in the catalytic hairpin assembly (CHA) for detecting miRNA-21, and the nucleotide sequences of two guide chains gDNA1 and gDNA2 in the CpAgo protein recognition system.

[0024] In the above sequence, " TCAACATCAGTCTGATAAGCTA " is the complementary pairing part between miRNA-21 and H1, is the annular part of H1, is the loop part of H2. "*" is the CpAgo protease cleavage site.

[0025] The first base at the 5' end of H1 is modified with the fluorescent reporter group FAM, and the 30th base at the 5' end is modified with the fluorescent quencher group BHQ1. The first base at the 3' end of H2 is modified with the fluorescent reporter group FAM, and the 28th base at the 5' end is modified with the fluorescent quencher group BHQ1. At this time, the luminescent group at the 5' end is close to the quencher group, and its emitted fluorescence is quenched, presenting a fluorescent quenching state.

[0026] At the same time, the first bases of the 5' end of gDNA1 and the 5' end of gDNA2 of the present invention are both phosphorylated.

[0027] Preferably, the working concentration range of H1 is 250-500nM, the working concentration range of H2 is 250-500nM, the working concentration range of gDNA1 is 150-250nM, the working concentration range of gDNA2 is 150-250nM, and the working concentration range of CpAgo protein is 2-10nM.

[0028] Preferably, the preparation process of the 10× reaction buffer is: MgCl2, KCl, Tris-HCl, DTT and Tween 20 are mixed so that the final concentration of MgCl2 is 45-55mM, the final concentration of KCl is 550-650mM, the final concentration of Tris-HCl is 500-600mM, the final concentration of DTT is 8-15mM, and the final concentration of Tween 20 is 0.01%.

[0029] Preferably, the isothermal reaction condition in step S3 is 37° C. to 40° C. for 30-40 min.

[0030] The present invention also provides a kit for detecting miRNA-21, comprising a CHA reaction mixture, CpAgo and DEPC (0.1%) water, wherein the CHA reaction mixture comprises H1, H2, gDNA1, gDNA2 and 10×reaction buffer.

[0031] Preferably, the nucleotide sequence of H1 is shown as SEQ ID NO.2, the nucleotide sequence of H2 is shown as SEQ ID NO.3, the nucleotide sequence of gDNA1 is shown as SEQ ID NO.4, and the nucleotide sequence of gDNA2 is shown as SEQ ID NO.5.

[0032] Preferably, the preparation process of the 10× reaction buffer is: MgCl2, KCl, Tris-HCl, DTT and Tween 20 are mixed so that the final concentration of MgCl2 is 45-55mM, the final concentration of KCl is 550-650mM, the final concentration of Tris-HCl is 500-600mM, the final concentration of DTT is 8-15mM, and the final concentration of Tween 20 is 0.01%.

[0033] The technical principle of the present invention is (such as Figure 1As shown): When the target miRNA-21 is present, due to the complementary pairing of the miRNA-21 sequence with the 5' end sequence of H1, the strand displacement reaction will trigger the unwinding of the H1 stem, and miRNA-21 will bind to the 5' end of the hairpin H1 to form a miRNA-21-H1 structure. Subsequently, due to the complementary pairing of the 5' end sequence of H2 with H1, miRNA-21 can be displaced by the strand displacement reaction and bind to H1 to form a stable H1-H2 double-stranded structure. The released miRNA-21 enters the next CHA cycle. When there is a guide chain gDNA that is completely base-paired with the H1-H2 double-stranded in the system, gDNA1 matches H1 and gDNA2 matches H2 to form a CpAgo-gDNA-dsDNA ternary complex, which then induces the endonuclease activity of the CpAgo protein, and the H1-H2 double-stranded is cut between the 10th and 11th bases of the guide chain gDNA, separating the luminescent group from the quenching group, so that the luminescent group emits a detectable fluorescent signal. As the number of amplification cycles increases, the released fluorescent groups continue to accumulate, so the fluorescence intensity is directly proportional to the amount of amplified products.

[0034] The present invention combines a DNA-based catalytic hairpin assembly (CHA) circuit with a CpAgo protein recognition system to achieve one-step, rapid detection of microRNA under isothermal conditions of 40°C. In this method, two DNA hairpins (H1 and H2), wherein the 5' end of H1 is modified with a FAM fluorescent group, and the middle is modified with a BHQ1 quenching group. The target microRNA can specifically trigger the DNA-based CHA, triggering a DNA loop circuit and outputting a large amount of dsDNA, while the released microRNA can proceed to the next loop circuit. The dsDNA formed by H1 and H2 is further recognized by two guide chains and CpAgo protein to form a CpAgo-guide-dsDNA ternary complex, inducing the endonuclease activity of the CpAgo protein, dsDNA is cut, and the fluorescent group and the quenching group are separated to produce a fluorescent signal, thereby achieving highly sensitive detection of microRNA. In this way, the developed method reaches a femtomolar detection limit. It improves the problems of complex operation, high cost, long time, and low sensitivity of the existing technology.

[0035] In summary, compared with the prior art, the technical advantages of the present invention are as follows:

[0036] (1) Strong specificity: The present invention forms a stable hairpin structure based on the design of H1 and H2 sequences. When there is no target, gDNA1 and gDNA2 will not bind to H1 and H2, so no non-specific fluorescent signal will be generated. In addition, CpAgo protein can only recognize double-stranded DNA and perform enzyme cleavage. Only when the target is present can the hairpin assembly be catalyzed to form H1-H2 double-stranded DNA, which can be cleaved by CpAgo protein to generate fluorescent signal.

[0037] (2) Wide detection range: It can detect the expression level of miRNA-21 in patients with various cancers, including brain cancer, liver cancer, prostate cancer and lung cancer;

[0038] (3) High sensitivity: In the CHA process of the catalytic hairpin assembly of the present invention, each time a molecule of H1-H2 double-stranded DNA is formed, a molecule of miRNA-21 is released as a template for the next CHA cycle. In addition, hairpins H1 and H2 are both labeled with fluorescent groups. When cut by CpAgo protein, a stronger fluorescence amplification signal is generated, reaching a detection limit of 5 fM.

[0039] (4) Short detection time: The present invention is a constant temperature reaction, which does not require a complicated procedure of heating and cooling, so the detection time is short, and 96 samples can be detected at the same time, with a large detection volume;

[0040] (5) Simple operation: One-step operation, only one tube of CHA-CpAgo reaction system is needed, and after adding the sample to be tested, the test can be carried out on the machine. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 It is a principle diagram of the technical solution of the present invention;

[0042] Figure 2 The evaluation group tested the results of miRNA-21 in serum samples of healthy subjects and lung cancer patients;

[0043] Figure 3 To compare the results of miRNA-21 in serum samples of healthy subjects and lung cancer patients in group 1;

[0044] Figure 4 To compare the results of miRNA-21 in serum samples of healthy subjects and lung cancer patients in group 2;

[0045] Figure 5 The test results of the evaluation group at different miRNA-21 sample concentrations;

[0046] Figure 6 To compare the test results of group 1 at different miRNA-21 sample concentrations;

[0047] Figure 7 To compare the detection results of group 2 at different miRNA-21 sample concentrations. DETAILED DESCRIPTION

[0048] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments. It should be noted that, under the premise of no conflict, the various embodiments or technical features described below can be arbitrarily combined to form new embodiments. The raw materials, equipment, etc. used in the following embodiments can be purchased through conventional channels unless otherwise specified.

[0049] Example 1 Detection of miRNA-21 expression level in serum samples of lung cancer patients

[0050] When the present invention is used for detection, the sequence of the miRNA in the selected serum sample is: 5'-UAGCUUAUCAGACUGAUGUUGA-3' (SEQ ID NO. 1);

[0051] 1. First, the sequences of hairpins H1, H2 and guide chains gDNA1 and gDNA2 were designed. The sequence design was divided into an evaluation group and a comparison group. The sequence information of each group was as follows:

[0052] Evaluation Team:

[0053] H1: (SEQ ID NO.2);

[0054] H2: (SEQ ID NO.3);

[0055] gDNA1:5'-P-TCAGTCTACGGACTTAG-3' (SEQ ID NO.4);

[0056] gDNA2:5'-P-AAGCTAAGTCCGTAGAC-3' (SEQ ID NO.5);

[0057] Comparison Group 1:

[0058] H1b: (SEQ ID NO.6);

[0059] H2b: (SEQ ID NO.7);

[0060] gDNA1c:5'-P-TCAGTCTATTTACTTAG-3' (SEQ ID NO.8);

[0061] gDNA2c:5'-P-AAGCTAAGTAAATAGAC-3' (SEQ ID NO.9);

[0062] In the above sequence, " TCAACATCAGTCTGATAAGCTA " is the complementary pairing part between miRNA-21 and H1, is the annular part of H1, is the loop part of H2. "*" is the CpAgo protease cleavage site.

[0063] Comparison Group 2:

[0064] H1: (SEQ ID NO.2);

[0065] H2: (SEQ ID NO.3);

[0066] gDNA1b:5'-P-ACATCAGTCTACGGACT-3' (SEQ ID NO. 10);

[0067] gDNA2b:5'-P-GATAAGCTAAGTCCGT-3' (SEQ ID NO.11);

[0068] In the above sequence, " TCAACATCAGTCTGATAAGCTA " is the complementary pairing part between miRNA-21 and H1, is the annular part of H1, is the loop part of H2. "*" is the CpAgo protease cleavage site.

[0069] Hairpins H1, H2 and guide strands gDNA1 and gDNA2 were synthesized by Beijing Qingke Biotechnology Co., Ltd. and purified by HPLC.

[0070] 2. Sample processing: Serum samples from 5 lung cancer patients and 5 healthy subjects were selected and extracted with a miRNA extraction kit (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd. Nucleic acids were extracted using Serum / Plasma miRNA Kit (http: / / miRNA.nlpl.eu / serum / plasma miRNAKit). The operation was performed in a biosafety cabinet.

[0071] 3. Preparation of reaction system:

[0072] (1) Prepare 10× reaction buffer according to the formula and concentration in Table 1:

[0073] Table 1 10× reaction buffer formula

[0074]

[0075] (2) Prepare CHA-CpAgo mixed solution according to the formula and concentration in Table 2 below:

[0076] Table 2 CHA-CpAgo mixed solution formula

[0077]

[0078]

[0079] On-machine detection: add 10 μL of the extracted nucleic acid sample to be tested into the prepared CHA-CpAgo mixed solution (dispense the CHA-CpAgo mixed solution into 200 μL eight-tube strips at 30 μL / tube, and then add the extracted nucleic acid sample to be tested at 10 μL / tube), and perform constant temperature reaction on the Hongshi SLAN-96S fully automatic medical PCR analysis system. The operating conditions are: constant temperature reaction temperature range of 37°C, reaction time of 30 minutes. Collect fluorescence once every minute, observe the changes in the fluorescence curve and analyze the results.

[0080] 4. Experimental results: The fluorescence intensity results obtained from different blood sources and different sequences of the present invention are shown in Table 3. Figure 2-Figure 4 The results of miRNA21 detection in serum samples of healthy subjects and lung cancer patients were respectively for the evaluation group, comparison group 1 and comparison group 2.

[0081] Table 3 Results of miRNA21 detection in serum samples of healthy subjects and lung cancer patients

[0082]

[0083] From Table 3, Figure 2-Figure 4 The results show that the evaluation group detected the serum samples of healthy people, and the fluorescence signal was low; the serum samples of lung cancer patients were detected, and the fluorescence was high. There was a clear distinction between healthy people and lung cancer patients, and the expression of miRNA-21 in the serum samples of lung cancer patients was higher than that in healthy people; in comparison group 1, the sequences of hairpin DNA and gDNA were adjusted, and the serum samples of healthy people and lung cancer patients were detected. The fluorescence signals were all low, indicating that the efficiency of catalytic hairpin assembly was low. In comparison group 2, the sequence of the guide chain gDNA was adjusted, and the restriction site of the cpAgo protein was changed. When detecting the serum samples of healthy people, there was a normal fluorescence signal; when detecting the serum samples of lung cancer patients, the fluorescence intensity was not as high as that of the evaluation group, and the fluorescence signal was not clearly distinguished from that of healthy people. It is proved that the hairpin DNA and guide chain gDNA sequences designed by the present invention can accurately detect the expression of miRNA-21 in the serum samples of lung cancer patients.

[0084] 5. Further test the miRNA-21 samples with different concentrations. The miRNA-21 samples were diluted to 0fM, 1fM, 5fM, 50fM, 1pM, 10pM, 500pM, 1nM, and 10nM, respectively. The rest of the operation process was the same as above. The fluorescence intensity of the evaluation group, comparison group 1, and comparison group 2 was tested.

[0085] 6. Test results: The test results are shown in Table 4, and Figure 5 to Figure 7 These are the fluorescence signals of the evaluation group, comparison group 1, and comparison group 2 at different sample concentrations.

[0086] Table 4 Detection results of samples with different concentrations of miRNA21

[0087]

[0088] from Figure 5-Figure 7 As shown in the results of Table 4, the samples of miRNA-21 with a detection concentration of 0fM in the evaluation group had a low fluorescence background; the samples of miRNA-21 with a detection concentration of 1fM had a low fluorescence and no obvious distinction from negative samples; the samples of miRNA-21 with a detection concentration of 5fM to 10nM had a fluorescence intensity ranging from 389.24 to 1977.68, and the fluorescence signal was positive, which was clearly distinguished from the negative samples. Therefore, the evaluation group of the present invention can reach a detection limit of 5fM. In contrast, in comparison group 1, the samples of miRNA-21 with a detection concentration of 0fM had a low fluorescence background; the samples of miRNA-21 with a detection concentration of 1fM to 5fM had a low fluorescence and no obvious distinction from negative samples; the samples of miRNA-21 with a detection concentration of 50fM to 10nM had a fluorescence intensity ranging from 273.77 to 1039.69, and the fluorescence signal intensity showed an increasing trend, but the intensity was not as good as that of the evaluation group. Compared with group 2, the samples of miRNA-21 with a detection concentration of 0fM have a high fluorescence background and non-specific signals, and there is no obvious distinction in fluorescence intensity from the samples of miRNA-21 with a concentration of 1fM-1pM; the samples of miRNA-21 with a detection concentration of 10pM-10nM have a fluorescence intensity ranging from 506.27 to 1094.56, and the fluorescence signal intensity shows an increasing trend, but the intensity is not as good as the evaluation group. It can be seen that the detection results of the present invention are highly specific and can reach the femtomolar detection limit.

[0089] Finally, it should be noted that the above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those familiar with the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A method for detecting miRNA-21 based on CHA circuit and CpAgo protein catalytic binding, characterized in that: The steps include: S1. Extraction of miRNA nucleic acid from the sample to be tested; S2. Preparation of CHA-CpAgo reaction system: mix H1, H2, gDNA1, gDNA2, CpAgo protein and 10×reaction buffer to prepare CHA-CpAgo reaction mixture; S3. Detection of target miRNA-21 by CHA-CpAgo system: adding the miRNA nucleic acid extracted in step S1 to the CHA-CpAgo reaction mixture prepared in step S2, performing a constant temperature reaction, and detecting according to the fluorescence signal; the nucleotide sequence of H1 in step S2 is shown in SEQ ID NO.2, and the nucleotide sequence of H2 is shown in SEQ ID NO.

3.

2. The method according to claim 1, characterized in that The miRNA nucleic acid in step S1 includes miRNA-21, and the nucleotide sequence of the miRNA-21 is shown in SEQ ID NO.

1.

3. The method according to claim 1, characterized in that In step S2, the nucleotide sequence of the gDNA1 is shown as SEQ ID NO.4, and the nucleotide sequence of the gDNA2 is shown as SEQ ID NO.

5.

4. The method according to claim 3, characterized in that The working concentration range of H1 is 250-500nM, the working concentration range of H2 is 250-500nM, the working concentration range of gDNA1 is 150-250nM, the working concentration range of gDNA2 is 150-250nM, and the working concentration range of CpAgo protein is 2-10nM.

5. The method according to claim 1, characterized in that The preparation process of the 10× reaction buffer is as follows: MgCl2, KCl, Tris-HCl, DTT and Tween 20 are mixed, so that the final concentration of MgCl2 is 45-55mM, the final concentration of KCl is 550-650mM, the final concentration of Tris-HCl is 500-600mM, the final concentration of DTT is 8-15mM, and the final concentration of Tween 20 is 0.01%.

6. The method according to claim 1, characterized in that The isothermal reaction condition in step S3 is 37° C. to 40° C. for 30-40 min.

7. A kit for detecting miRNA-21, characterized in that: It includes CHA reaction mixture, CpAgo protein and DEPC water, wherein the CHA reaction mixture includes H1, H2, gDNA1, gDNA2 and 10×reaction buffer.

8. The kit according to claim 7, characterized in that The nucleotide sequence of H1 is shown in SEQ ID NO.2, the nucleotide sequence of H2 is shown in SEQ ID NO.3, the nucleotide sequence of gDNA1 is shown in SEQ ID NO.4, and the nucleotide sequence of gDNA2 is shown in SEQ ID NO.

5.

9. The kit according to claim 7, characterized in that The preparation process of the 10× reaction buffer is as follows: MgCl2, KCl, Tris-HCl, DTT and Tween 20 are mixed, so that the final concentration of MgCl2 is 45-55mM, the final concentration of KCl is 550-650mM, the final concentration of Tris-HCl is 500-600mM, the final concentration of DTT is 8-15mM, and the final concentration of Tween 20 is 0.01%.

Images