Primer group, method and kit for detecting vibrio parahaemolyticus

Abstract

The invention relates to a primer group, a method and a kit for detecting vibrio parahaemolyticus. The multiplex fluorescent quantitative PCR kit for detecting the vibrio parahaemolyticus comprises a primer group, a probe group and a PCR amplification premix solution. Wherein the primer group comprises at least one of specific genes gyrB and DAADH of vibrio parahaemolyticus and at least one of virulence genes TDH, T3SS1-VopS and T3SS2-VopT of vibrio parahaemolyticus, and the proportion of primers to probes in a PCR (Polymerase Chain Reaction) system is optimized. When the kit disclosed by the invention is used for detecting vibrio parahaemolyticus, microbial isolated culture and identification are not needed, so that the detection time is shortened, the detection efficiency is improved, meanwhile, the accuracy, sensitivity, stability and specificity of detection are greatly improved, and the kit has huge advantages in clinical specimen detection and epidemiological research.

Description

Technical Field

[0001] The present invention relates to the field of detection technology, and in particular to a primer set, method and kit for detecting Vibrio parahaemolyticus. Background Art

[0002] Vibrio parahaemolyticus is a Gram-negative polymorphic bacillus or slightly curved Vibrio of the genus Vibrio of the family Vibrio. It is widely distributed in seawater, seabed sediment, plankton, and fish and shellfish. It is a halophilic marine bacterium. In coastal areas in summer and autumn, explosive food poisoning often occurs due to the consumption of seafood containing a large amount of Vibrio parahaemolyticus. Clinically, the main symptoms are acute onset, abdominal pain, vomiting, diarrhea, and watery stools. The main pathological changes are mild erosion of the jejunum and ileum, gastric mucositis, and congestion of internal organs (liver, spleen, and lungs).

[0003] Clinically, the detection of Vibrio parahaemolyticus mainly includes isolation culture, smear microscopy, biochemical experiments and serological experiments, all of which require overnight bacterial culture, which greatly prolongs the detection time.

[0004] PCR detection technology is simple, fast and highly specific, and is widely used in the detection of pathogenic microorganisms and gene detection. Multiplex fluorescence PCR technology can simultaneously amplify two or more pairs of target gene sequences in the same reaction system, which has great advantages in the joint detection of pathogens. At present, PCR detection of Vibrio parahaemolyticus is mostly targeted at its virulence genes TLH, TDH, TRH and TOXR.

[0005] Therefore, finding a multiplex fluorescent probe PCR detection method that can simultaneously detect the specific genes and virulence genes of Vibrio parahaemolyticus has become a research hotspot. Summary of the invention

[0006] In order to solve at least one of the above technical problems, the present invention provides a primer set, method and kit for detecting Vibrio parahaemolyticus, which can simultaneously realize the specific detection and virulence detection of Vibrio parahaemolyticus.

[0007] As one aspect, the present invention provides a primer set for Vibrio parahaemolyticus, the primer set comprising at least one of gyrB-F, gyrB-R, DAADH-F, DAADH-R, TDH-F, TDH-R, T3SS1-VopS-F, T3SS1-VopS-R, T3SS2-VopT-F and T3SS2-VopT-R; wherein the nucleotide sequences of gyrB-F, gyrB-R, DAADH-F, DAADH-R, TDH-F, TDH-R, T3SS1-VopS-F, T3SS1-VopS-R, T3SS2-VopT-F and T3SS2-VopT-R are as shown in SEQ ID NOs: 1-10, respectively.

[0008] In some embodiments of the present invention, the primer set also includes an internal reference gene 16S; wherein the upstream primer and the downstream primer of the internal reference gene 16S are 16S-F and 16S-R, respectively; and their corresponding nucleotide sequences are shown in SEQ NO:11 and SEQ NO:12, respectively.

[0009] As another aspect, the present invention provides a method for detecting Vibrio parahaemolyticus, which comprises using the above-mentioned primer set.

[0010] In some embodiments of the present invention, the detection method includes the following steps: extracting genomic DNA containing the target gene; mixing the target genomic DNA, the above-mentioned primer set, and the probe set, performing a fluorescent quantitative PCR amplification reaction to obtain a PCR reaction product; and performing an electrophoresis reaction on the PCR reaction product.

[0011] In some embodiments of the present invention, the target genes include virulence genes and specific genes; wherein the specific genes include at least one of gyrB and DAADH, and the virulence genes include at least one of TDH, T3SS1-VopS, and T3SS2-VopT.

[0012] In some embodiments of the present invention, the probe group includes at least one of the fluorescent probes gyrB-probe, DAADH-probe, TDH-probe, T3SS1-VopS-probe, and T3SS2-VopT-probe; wherein the nucleotide sequences of the gyrB-probe, DAADH-probe, TDH-probe, T3SS1-VopS-probe, and T3SS2-VopT-probe are shown in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17, respectively.

[0013] In some embodiments of the present invention, the 5' end of the fluorescent probe is labeled with a fluorescent group, and the 3' end is labeled with a fluorescent quenching group; wherein the fluorescent group includes at least one of FAM, cy5, ROX, and VIC; and / or the fluorescent quenching group is BHQ2.

[0014] In some embodiments of the present invention, it also includes: performing a fluorescent quantitative PCR amplification reaction on a positive control and one or more fluorescent probes in the above-mentioned primer set and probe set; and / or performing a fluorescent quantitative PCR amplification reaction on a negative control and one or more fluorescent probes in the above-mentioned primer set and probe set.

[0015] As another aspect, the present invention provides a kit, comprising the above-mentioned primer set.

[0016] As still another aspect, the present invention provides a use of the above primer set or the above kit in detecting Vibrio parahaemolyticus.

[0017] The technical solution provided by the embodiment of the present invention has the following advantages:

[0018] The multiplex fluorescent probe PCR detection method of the embodiment of the present invention improves the specificity of PCR detection of Vibrio parahaemolyticus by using primers and probes for the species-specific genes gyrB and DAADH of Vibrio parahaemolyticus, as well as primers and probes for the virulence genes TDH, T3SS1-VopS and T3SS2-VopT. The multiplex fluorescent probe PCR detection method of the embodiment of the present invention does not require bacterial culture. The primers and probes for the specific genes and virulence genes of Vibrio parahaemolyticus can directly detect Vibrio parahaemolyticus in clinical specimens, and distinguish between virulent strains and non-virulent strains, thereby shortening the detection time and improving the detection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0021] Figure 1 The single-plex PCR amplification curve of primers 16S, gyrB, DAADH, TDH, T3SS1-VopS and T3SS2-VopT in the primer set of Example 2 of the present invention in Vibrio parahaemolyticus (SDUM002255);

[0022] Figure 2 This is a single-plex PCR amplification curve of primers 16S, gyrB, DAADH, TDH, T3SS1-VopS and T3SS2-VopT in the primer set of Example 2 of the present invention in Vibrio parahaemolyticus (SDUM002208);

[0023] Figure 3 The single-plex PCR amplification curve of primers 16S, gyrB, DAADH, TDH, T3SS1-VopS and T3SS2-VopT in the primer set of Example 2 of the present invention in Vibrio parahaemolyticus (SDUM002293);

[0024] Figure 4It is a single-plex PCR amplification curve of primers 16S, gyrB, DAADH, TDH, T3SS1-VopS and T3SS2-VopT in the primer set of Example 2 of the present invention in Vibrio parahaemolyticus (clinical isolate);

[0025] Figure 5 This is an electrophoresis diagram of single-plex PCR products of primers 16S, gyrB, DAADH, TDH, T3SS1-VopS and T3SS2-VopT in the primer set of Example 2 of the present invention;

[0026] Figure 6 The sequencing results of the PCR amplification products of the primers gyrB, DAADH, TDH, T3SS1-VopS and T3SS2-VopT in the primer set of Example 2 of the present invention;

[0027] Figure 7 The positive control of Example 3 of the present invention was constructed and verified by PCR;

[0028] Figure 8 The PCR amplification curve and product electrophoresis result of the positive control substance 1 in Example 3 of the present invention;

[0029] Fig. 9 The multiplex fluorescent probe PCR amplification curves of clinical isolated strains and laboratory standard strains after the optimization system in Example 5 of the present invention;

[0030] Fig.10 This is the cross-reactivity experimental result of Example 6 of the present invention. DETAILED DESCRIPTION

[0031] In order to more clearly understand the above-mentioned objectives, features and advantages of the present invention, the scheme of the present invention will be further described below. It should be noted that the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

[0032] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein; it is obvious that the embodiments in the specification are only part of the embodiments of the present invention, rather than all of the embodiments.

[0033] According to an embodiment of one aspect of the present invention, a primer set for Vibrio parahaemolyticus is provided, the primer set comprising at least one of gyrB-F, gyrB-R, DAADH-F, DAADH-R, TDH-F, TDH-R, T3SS1-VopS-F, T3SS1-VopS-R, T3SS2-VopT-F and T3SS2-VopT-R; wherein the nucleotide sequences of gyrB-F, gyrB-R, DAADH-F, DAADH-R, TDH-F, TDH-R, T3SS1-VopS-F, T3SS1-VopS-R, T3SS2-VopT-F and T3SS2-VopT-R are as shown in SEQ ID NOs: 1-10, respectively.

[0034] In some embodiments of the present invention, a method for detecting Vibrio parahaemolyticus using the above-mentioned primer set comprises the following steps: (1) extracting bacterial DNA according to the steps of the bacterial genomic DNA extraction kit of Tiangen Biochemical Technology Co., Ltd.; (2) diluting the bacterial DNA 100 times, and diluting the primer set and the probe set 10 times; (3) adding 10uL Taq Master Mix, 1uL primer combination, 1uL probe combination, 1.5uL bacterial DNA, and 6.5uL ddH2O according to a 20uL reaction system; (4) using a PCR amplification instrument (TIANLONG GENTIER 96 and Thermo Fisher Scientific 7500) for amplification; wherein the enzymatic amplification program is 95℃-5min, 95℃-15s, 60℃-34s, 35cycles; 95℃-15s, 60℃-1min, 95℃-15s, 60℃-15s; wherein the probe amplification program is 50℃-2min, 95℃-10min, 40cycles; 95℃-15s, 60℃-1min. (5) Prepare 2% agarose gel and electrophoresed the PCR reaction products.

[0035] In some embodiments of the present invention, the primers in the primer set in step (2) include at least one of gyrB-F, gyrB-R, DAADH-F, DAADH-R, TDH-F, TDH-R, T3SS1-VopS-F, T3SS1-VopS-R, T3SS2-VopT-F and T3SS2-VopT-R. Among them, the upstream primer and downstream primer of gyrB are gyrB-F and gyrB-R respectively; their corresponding nucleotide sequences are shown in SEQ NO:1 and SEQ NO:2 in Table 1 respectively. The upstream primer and downstream primer of DAADH are DAADH-F and DAADH-R respectively; their corresponding nucleotide sequences are shown in SEQ NO:3 and SEQ NO:4 in Table 1 respectively. The upstream primer and downstream primer of TDH are TDH-F and TDH-R respectively; their corresponding nucleotide sequences are shown in SEQ NO:5 and SEQ NO:6 in Table 1 respectively. The upstream primer and downstream primer of T3SS1-VopS are T3SS1-VopS-F and T3SS1-VopS-R respectively; their corresponding nucleotide sequences are shown in SEQ NO:7 and SEQ NO:8 in Table 1 respectively; the upstream primer and downstream primer of T3SS2-VopT are T3SS2-VopT-F and T3SS2-VopT-R respectively; their corresponding nucleotide sequences are shown in SEQ NO:9 and SEQ NO:10 in Table 1 respectively.

[0036] Table 1 Nucleotide sequences of each primer in the primer set

[0037]

[0038]

[0039] In some embodiments of the present invention, the fluorescent probe in the probe group in step (2) includes at least one of gyrB-probe (gyrB-probe), DAADH-probe (DAADH-probe), TDH-probe (TDH-probe), T3SS1-VopS-probe (T3SS1-VopS-probe), and T3SS2-VopT-probe (T3SS2-VopT-probe). Among them, the nucleotide sequence of the gyrB probe is shown in SEQ NO: 13 in Table 2; the nucleotide sequence of the DAADH probe is shown in SEQ NO: 14 in Table 2; the nucleotide sequence of the TDH probe is specifically shown in SEQ NO: 15 in Table 2; the nucleotide sequence of the T3SS1-VopS probe is specifically shown in SEQ NO: 16 in Table 2; and the nucleotide sequence of the T3SS2-VopT probe is specifically shown in SEQ NO: 17 in Table 2.

[0040] Table 2 Nucleotide sequences of each fluorescent probe in the probe set

[0041] Probe Name sequence serial number gyrB-probe ATCTTGCTTGTCCGCTTCGC SEQ ID NO:13 DAADH-probe TCTATCGCCAACCACAGCCG SEQ ID NO:14 TDH-probe TTACGAACACAGCAGAATGACCG SEQ ID NO:15 T3SS1-VopS-probe ATTCCTTACCACCAATGCTGAGTT SEQ ID NO:16 T3SS2-VopT-probe AGCCTCTACTGTATCACCATTCACT SEQ ID NO:17 16S-probe CACTGGAACTGAGACACGGTC SEQ ID NO:18

[0042] In some embodiments of the present invention, in the detection method of Vibrio parahaemolyticus using the above-mentioned primer set, the primer set also includes an internal reference gene 16S; wherein the upstream primer and downstream primer of the internal reference gene 16S are 16S-F and 16S-R, respectively; and their corresponding primer sequences are shown in SEQ NO:11 and SEQ NO:12 in Table 1, respectively.

[0043] In some embodiments of the present invention, in the detection method of Vibrio parahaemolyticus using the above primer set, the fluorescent probe in the probe set also includes a 16S-probe, wherein the nucleotide sequence of the 16S-probe is specifically shown in SEQ NO: 18 in Table 2.

[0044] In some embodiments of the present invention, the gyrB probe is labeled with a FAM fluorescent group at the 5' end and a BHQ2 fluorescent quencher group at the 3' end; the DAADH probe is labeled with a cy5 fluorescent group at the 5' end and a BHQ2 fluorescent quencher group at the 3' end; the TDH probe is labeled with a FAM fluorescent group at the 5' end and a BHQ2 fluorescent quencher group at the 3' end; the T3SS1-VopS and T3SS2-VopT probes are labeled with a ROX fluorescent group at the 5' end and a BHQ2 fluorescent quencher group at the 3' end; the 16S probe is labeled with a VIC fluorescent group at the 5' end and a BHQ2 fluorescent quencher group at the 3' end.

[0045] In some embodiments of the present invention, the method for detecting Vibrio parahaemolyticus using the above-mentioned primer set also includes a plasmid that can amplify gyrB, DAADH, TDH, T3SS1-VopS, T3SS2-VopT and 16S genes as a positive control, and ddH2O as a negative control.

[0046] In some embodiments of the present invention, a multiplex fluorescent probe PCR kit comprising the above-mentioned primer set specifically includes: a combination of primer sets and probe sets for detecting gyrB, DAADH, TDH, T3SS1-VopS and T3SS2-VopT genes, as well as a rapid PCR premix (Taq Master Mix), enzymes, negative controls and positive controls, etc.

[0047] The multiplex fluorescent probe PCR kit for Vibrio parahaemolyticus of the embodiment of the present invention can realize the specific detection and virulence detection of Vibrio parahaemolyticus in clinical specimens, filling the gap in the current Vibrio parahaemolyticus PCR detection kit.

[0048] In some embodiments of the present invention, the ratio of primers and probes of gyrB, DAADH, TDH, T3SS1-VopS, T3SS2-VopT and 16S is optimized, the PCR amplification reagent system is optimized, and a Taq enzyme with high fidelity is screened.

[0049] In order to further illustrate the effect of the present invention, specific embodiments are used for description below.

[0050] 1. Materials and methods

[0051] (1) Sample source

[0052] Vibrio parahaemolyticus strains and other Vibrio samples were donated by the College of Oceanography, Weihai Campus, Shandong University. Vibrio parahaemolyticus specimens and clinical specimen strains for cross-reactivity experiments were from the Microbiology Department of the Central Laboratory of Weihai Municipal Hospital Affiliated to Shandong University. Vibrio parahaemolyticus primers and probes were synthesized by Kunshan Pronopuhe Biotechnology Co., Ltd.

[0053] (2) Source of reagents

[0054] The present invention uses 2×Taq Master Mix amplification reagent produced by Suzhou Nearshore Protein Technology Co., Ltd. to perform PCR amplification experiments.

[0055] (3) Genomic DNA extraction

[0056] According to the instructions of the bacterial genomic DNA extraction kit of Tiangen Biochemical Technology Co., Ltd., bacterial genomic DNA was extracted and stored at -20°C.

[0057] (4) Preparation of positive control

[0058] Fusion primers such as TDH-DAADH-link-F DAADH, TDH-DAADH-link-RTDH, DAADH-gyrB-link-F, gyrB-VopT-link-F, VopT-VopS-link-F, and VopS-16S-link-F (Kunshan Pronopuhe Biotechnology Co., Ltd.) were designed and synthesized, and linked to the pUC19 vector to construct a positive control vector that can express 16S, DAADH, gyrB, TDH, T3SS1-VopS, and T3SS2-VopT.

[0059] Example 1

[0060] Primer design and synthesis

[0061] According to the literature search and ATCC Genome Portal database, the nucleotide sequences of the species-specific genes gyrB, DAADH and virulence genes TDH, T3SS1-VopS and T3SS2-VopT of Vibrio parahaemolyticus strains were determined, and primers and corresponding probes were designed using BeaconDesigner 8 software and synthesized by Kunshan Pronopuhe Biotechnology Co., Ltd. The nucleotide sequences of each primer in the primer set are shown in Table 1. The nucleotide sequences of each fluorescent probe in the probe set are shown in Table 2. The nucleotide sequences of each fusion primer in the fusion primer set are shown in Table 3. The nucleotide sequences of each cloning primer in the cloning primer set are shown in Table 4.

[0062] Table 3 Nucleotide sequences of each fusion primer in the fusion primer set

[0063]

[0064] Table 4 Nucleotide sequences of each cloning primer in the cloning primer set

[0065] Cloning primer name sequence serial number BamH I-TDH-F CGCGGATCCGCGCCTACATGACTGTGAACA SEQ ID NO:25 EcoR I-16S-R CCGGAATTCCGGCCATTGTGCAATATTCC SEQ ID NO:26

[0066] Example 2

[0067] Singleplex PCR amplification

[0068] Add the primer and probe of each gene to 20ul of PCR amplification system at a ratio of 1:1, and set the amplification program according to the kit instructions: 50℃-2min, 95℃-10min, 35cycles; 95℃-15s, 60℃-1min. Prepare 2% agarose gel for electrophoresis to observe the fragment homogeneity and fragment size of the PCR product. The test results are as follows Figures 1 to 6 As shown. Among them, Figures 1 to 4 The PCR results for three laboratory isolates of V. parahaemolyticus [i.e., V. parahaemolyticus (SDUM002255), V. parahaemolyticus (SDUM00220), and V. parahaemolyticus (SDUM002293)] and one isolate of V. parahaemolyticus from a clinical specimen; Figure 5 The electrophoresis results of PCR products of three laboratory-isolated Vibrio parahaemolyticus and one clinical specimen-isolated Vibrio parahaemolyticus; Figure 6 These are the sequencing results of the PCR amplification products of gyrB, DAADH, TDH, T3SS1-VopS and T3SS2-VopT.

[0069] according to Figures 1 to 6 The analysis of the data results can lead to the following conclusions:

[0070] (1) Based on Figures 1 to 5 From the data, we can see that all four genes were specifically amplified and the electrophoresis fragments were single, without any mixed bands, and the fragment sizes were correct.

[0071] (2) Based on Figure 6 From the data in, we can see that the amplified products were sequenced, and the sequencing results showed that the PCR amplified product sequence was consistent with the target sequence. Some genes were missing during the sequencing process, but the sequencing comparison results were all above 90%.

[0072] Example 3

[0073] Positive control plasmid construction and verification

[0074] The following six different fusion genes were designed respectively: TDH-DAADH-link-F DAADH, TDH-DAADH-link-RTDH, DAADH-gyrB-link-F, gyrB-VopT-link-F, VopT-VopS-link-F and VopS-16S-link-F. One cloning primer BamHI-TDH-F: CGCGGATCCGCGCCTACATGACTGTGAACA and another EcoRI-16S-R: CCGGAATTCCGGCCATTGTGCAATATTCC were designed and synthesized.

[0075] The fusion PCR method was used to fuse the six fusion primers to construct the Puc19-VP vector. Three white spot positive clones were selected through enzyme-linked transformation and blue-white spot screening, and then identified and screened by PCR.

[0076] The electrophoresis results showed that two of the three positive clones were successfully constructed, and the size of the digestion product was close to the theoretical size of ~631bp, and the size and position of the six gene fragments were correct. The digestion product of clone No. 3 was small, and the electrophoresis results showed that the gene was missing. Figure 7 .in, Figure 7 For positive control clone plasmid screening and identification.

[0077] The successfully constructed clones were subjected to PCR and electrophoresis, and the results showed that all six genes could be effectively amplified. The amplified product fragment size detected by agarose electrophoresis was correct. The positive clone plasmids were sequenced, and the results showed that the sequences of the amplified products of the six genes were correct. Some bases mutated during the sequencing process, but it did not affect the detection results. Figure 8 .in, Figure 8 The figure shows the PCR amplification results of the target gene of the positive control plasmid and the electrophoresis results of the amplified product.

[0078] Example 4

[0079] Optimization of PCR amplification system

[0080] The primers and probes of the four genes were added to the reaction system at a molar ratio of 1:1, 1:2, 1:3, 2:1, and 3:1, and the reaction was carried out according to the above amplification procedure. The ratio of primers and probes was adjusted and optimized according to the amplification results. PCR was carried out according to the ratio of primers and probes, and the CT values ​​were summarized in Table 5 below.

[0081] Table 5 PCR results (CT values) of primers and probes at different molar ratios

[0082] Primer:probe (molar ratio) 1:1 1:2 1:3 2:1 3:1 16S 18.996 16.958 19.411 14.329 13.362 ikB 24.113 17.272 17.622 16.159 16.255 D-AADH 17.082 16.612 16.584 16.246 15.046 TDH 19.770 17.608 18.015 16.397 16.711 T3SS1-VopS 19.504 18.274 16.444 13.806 15.918 T3SS2-VopT 18.098 21.068 21.691 15.946 15.621

[0083] According to the data analysis in Table 5, the following conclusions can be drawn: when the primer:probe ratio is 2:1 or 3:1, the amplification signals of the six genes are relatively stable, which has a slight advantage in PCR amplification. At the same time, 2:1 saves more reagents than 3:1.

[0084] Example 5

[0085] Multiplex PCR amplification system validation

[0086] The strains cultured from clinical Vibrio parahaemolyticus positive specimens and laboratory standard strains were collected, and the bacterial genomic DNA was extracted according to the instructions. The optimized system in Example 4 was used for amplification. The specific amplification system was: 4 μL primer and probe combination (primer: probe ratio was 2:1), 1.5 μL bacterial DNA, 4.5 μL water and 10 μL 2×Taq Master Mix. The PCR results are shown in Fig. 9 , Fig. 9 This is the sequencing result of the positive control plasmid.

[0087] according to Fig. 9 The data analysis in the article can draw the following conclusions: PCR results showed that the internal reference gene 16S, species-specific genes gyrB and DAADH, and virulence genes TDH, T3SS1-VopS, and T3SS2-VopT were significantly amplified in positive specimens and standard strains.

[0088] Example 6

[0089] Cross-reactivity assay

[0090] Clinical strains were collected for cross-reactivity experiments, including common clinical strains such as Klebsiella pneumoniae, Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. Other strains of Vibrio were also collected: Vibrio mimicus, Vibrio alginolyticus, Vibrio vulnificus, and Vibrio harveyi. The results of the amplification curve are shown in Figure 2. Fig.10 As shown, Fig.10 The figure below shows PCR detection of common clinical pathogens and Vibrio bacteria.

[0091] according to Fig.10The data analysis in , can draw the following conclusions: The amplification curve results show that 16S is amplified normally in the bacterial samples, but there is no specific amplification of gyrB, DAADH, TDH, T3SS1-VopS, and T3SS2-VopT.

[0092] In summary, the primer set, method and kit for detecting Vibrio parahaemolyticus in the embodiment of the present invention include primers and probe combinations for amplifying five genes of Vibrio parahaemolyticus species-specific genes gyrB and DAADH, virulence genes TDH, T3SS1-VopS and T3SS2-VopT; the primers include upstream and downstream primers of the five genes; the fluorescent probes include five fluorescent probes corresponding to the five gene primers. The method and kit for detecting Vibrio parahaemolyticus in the embodiment of the present invention do not require microbial isolation, culture and identification, greatly shorten the detection time, improve the detection efficiency, and the accuracy, sensitivity, stability and specificity of the PCR method are all high. It can be seen that the primer set, method and kit for detecting Vibrio parahaemolyticus in the embodiment of the present invention can quickly, accurately and specifically detect Vibrio parahaemolyticus nucleic acid, and distinguish between virulent strains and non-virulent strains, which has guiding significance for clinical treatment and medication, and is suitable for clinical promotion.

[0093] It should be noted that, in this article, relational terms such as "first" and "second" are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the sentence "comprise a ..." do not exclude the existence of other identical elements in the process, method, article or device including the elements.

[0094] The above description is only a specific embodiment of the present invention, so that those skilled in the art can understand or implement the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments described herein, but should conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer set for Vibrio parahaemolyticus, characterized in that: The primer set includes at least one of gyrB-F, gyrB-R, DAADH-F, DAADH-R, TDH-F, TDH-R, T3SS1-VopS-F, T3SS1-VopS-R, T3SS2-VopT-F and T3SS2-VopT-R; Among them, the nucleotide sequences of gyrB-F, gyrB-R, DAADH-F, DAADH-R, TDH-F, TDH-R, T3SS1-VopS-F, T3SS1-VopS-R, T3SS2-VopT-F, and T3SS2-VopT-R are shown in SEQ ID NOs: 1-10, respectively.

2. The primer set for Vibrio parahaemolyticus according to claim 1, characterized in that: The primer set also includes an internal reference gene 16S; Among them, the upstream primer and downstream primer of the internal reference gene 16S are 16S-F and 16S-R respectively; their corresponding nucleotide sequences are shown in SEQ NO: 11 and SEQ NO: 12 respectively.

3. A method for detecting Vibrio parahaemolyticus, characterized in that: The detection method comprises using the primer set according to claim 1 or 2.

4. The method for detecting Vibrio parahaemolyticus according to claim 3, characterized in that: The detection method comprises the following steps: Extract genomic DNA containing the target gene; Mixing the target genome DNA, the primer set and the probe set according to claim 1 or 2, and performing a fluorescent quantitative PCR amplification reaction to obtain a PCR reaction product; The PCR reaction products were subjected to electrophoresis.

5. The method for detecting Vibrio parahaemolyticus according to claim 4, characterized in that: The target genes include virulence genes and specificity genes; Among them, the specific genes include at least one of gyrB and DAADH, and the virulence genes include at least one of TDH, T3SS1-VopS, and T3SS2-VopT.

6. The method for detecting Vibrio parahaemolyticus according to claim 5, characterized in that: The probe group includes at least one of the fluorescent probes gyrB-probe, DAADH-probe, TDH-probe, T3SS1-VopS-probe, and T3SS2-VopT-probe; Among them, the nucleotide sequences of gyrB-probe, DAADH-probe, TDH-probe, T3SS1-VopS-probe and T3SS2-VopT-probe are shown in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17, respectively.

7. The method for detecting Vibrio parahaemolyticus according to claim 6, characterized in that: The 5' end of the fluorescent probe is labeled with a fluorescent group, and the 3' end is labeled with a fluorescent quenching group; Wherein, the fluorescent group includes at least one of FAM, cy5, ROX, and VIC; And / or, the fluorescence quenching group is BHQ2.

8. The method for detecting Vibrio parahaemolyticus according to any one of claims 2 to 7, characterized in that: Also includes: Performing a fluorescent quantitative PCR amplification reaction with the positive control and the primer set and one or more fluorescent probes in the probe set according to claim 1 or 2; And / or, a negative control is subjected to a fluorescent quantitative PCR amplification reaction with the primer set and one or more fluorescent probes in the probe set according to claim 1 or 2.

9. A kit, characterized in that: The kit comprises the primer set according to claim 1 or 2.

10. Use of the primer set according to claim 1 or 2 or the kit according to claim 9 in detecting Vibrio parahaemolyticus.

Images