Method for homozygous parthenogenesis through embryo hybridization

Abstract

The invention discloses a method for carrying out homozygous parthenogenesis through embryo hybridization, and relates to the field of parthenogenesis, and the method comprises the following steps: taking oocytes, dividing the oocytes into polar receptor oocytes and polar donor oocytes, replacing chromosome-spindle body compounds of the polar receptor oocytes with polar bodies in the polar donor oocytes, and carrying out homozygous parthenogenesis through embryo hybridization. The method comprises the following steps: obtaining a depolar oocyte and a recombinant oocyte, carrying out gene editing restriction on the depolar oocyte / preventing expression of an imprinting gene of the depolar oocyte to obtain a gene editing oocyte, and carrying out parthenogenetic activation on the gene editing oocyte and the recombinant oocyte to obtain a gene editing bicellular cleavage bulb and a recombinant bicellular cleavage bulb, the method comprises the following steps: respectively separating the gene editing two-cell cleavage globules and the recombinant two-cell cleavage globules along cleavage grooves, carrying out cross combination, fusing to obtain a hybrid embryo, culturing the hybrid embryo to a blastocyst stage, and transplanting the blastocyst stage into a mother body. The progeny gene cultured by the invention is homozygous, and the problem of premature senility caused by telomere shortening is avoided.

Description

Technical Field

[0001] The present application relates to the field of parthenogenesis, and in particular to a method for homozygous parthenogenesis through embryo hybridization. Background Art

[0002] Excellent livestock breeding is of great significance to the development of my country's agriculture. The existing assisted reproductive technologies include in vitro fertilization (IVF), live egg collection (OPU), intracytoplasmic sperm injection (ICSI), and oocyte vitrification. Somatic cell cloning technology is a technology that uses the fusion of oocytes and somatic cells produced by female animals to produce individuals. First, the nucleus of the oocyte is removed. At this time, the oocyte will serve as a "container", and then the nucleus of the somatic cell is transplanted into the enucleated oocyte to activate the recombinant cell and enable it to develop normally. Parthenogenesis is also called unisexual reproduction, that is, the egg can develop into a normal new individual without fertilization. Parthenogenesis is a reproductive phenomenon that is common in some more primitive animal species. No mammals that can reproduce parthenogenetically have been found in nature.

[0003] Currently, parthenogenesis uses haploid embryonic stem cells for parthenogenesis. Embryonic stem cells are first isolated and then stem cells from different embryonic sources are used to generate diploid embryos. Somatic cell cloning uses donor cells from adult or older animals to obtain offspring with the same genotype as the donor mother.

[0004] However, using stem cells from different embryonic sources to generate diploid embryos in parthenogenesis not only takes a long time, but the genotype also varies due to the different embryo sources. Although somatic cell cloning can maintain the genotype of the offspring, the offspring are prone to premature aging symptoms due to the shortening of chromosome telomeres. Summary of the invention

[0005] In view of the deficiencies of the above-mentioned related technologies, the present application provides a method for homozygous parthenogenesis through embryo hybridization. The present application uses the polar body in the polar body donor oocyte to replace the nucleus of the polar body recipient oocyte, separates the gene-edited two-cell blastomeres and the recombined two-cell blastomeres along the cleavage furrow and cross-combines them, and then fuses them to obtain a hybrid embryo whose genome originates from the same germ cell. The cultivated offspring are genetically homozygous and avoid the premature aging problem caused by shortened telomeres, and saves the time of culturing somatic cells.

[0006] The present application provides a method for homozygous parthenogenesis through embryo hybridization using the following technical solution: A method for homozygous parthenogenesis through embryo hybridization comprises the following steps: taking oocytes and dividing them into polar body recipient oocytes and polar body donor oocytes, using the polar body in the polar body donor oocyte to replace the chromosome-spindle complex of the polar body recipient oocyte to obtain depolarized oocytes and recombined oocytes, performing gene editing on the depolarized oocytes to restrict / block the expression of their imprinted genes to obtain gene-edited oocytes, performing parthenogenetic activation on the gene-edited oocytes and the recombined oocytes to obtain gene-edited two-cell blastomeres and recombined two-cell blastomeres, separating the gene-edited two-cell blastomeres and the recombined two-cell blastomeres along the cleavage furrows, cross-combining them, and then fusing them to obtain hybrid embryos, and culturing the hybrid embryos to the blastocyst stage and then transplanting them into the mother.

[0007] Preferably, the method of using the polar body in the polar body donor oocyte to replace the chromosome-spindle complex of the polar body recipient oocyte comprises the following steps: removing the chromosome-spindle complex of the polar body recipient oocyte, aspirating the polar body of the polar body donor oocyte to obtain a depolarized oocyte and polar body, and injecting the polar body into the polar body recipient oocyte without the chromosome-spindle complex to obtain a recombinant oocyte.

[0008] Preferably, the separation and cross-combination comprises the following steps: manually separating the gene-edited two-cell blastomere along the cleavage furrow to obtain the first blastomere, manually separating the recombinant two-cell blastomere along the cleavage furrow to obtain the second blastomere, and gluing the first blastomere and the second blastomere together in embryo adhesive fluid to obtain an adhesive body.

[0009] Preferably, the embryo adhesive solution comprises plant lectin and micromanipulation fluid, and the concentration of the plant lectin in the embryo adhesive solution is 150-250 µg / mL.

[0010] Preferably, the embryo adhesive solution comprises plant lectin and micromanipulation fluid, and the concentration of the plant lectin in the embryo adhesive solution is 200 µg / mL.

[0011] Preferably, the fusion comprises placing the bonded body in embryo electrofusion solution for electrofusion and then placing the bonded body in KSOM embryo culture solution for culture.

[0012] Preferably, the embryo electrofusion solution comprises mannitol, CaCl2, MgCl2, HEPES, and PVA.

[0013] Preferably, the electrofusion parameters are: 1000-1400 V / cm, duration 30-50 µs, one pulse.

[0014] Preferably, the electrofusion parameters are: 1200 V / cm, duration 40 µs, one pulse.

[0015] Preferably, the gene-edited oocyte is obtained by knocking out the imprinted gene of the depolarized oocyte.

[0016] Preferably, the gene-edited oocyte is obtained by knocking out the H19 imprinted gene of the depolarized oocyte.

[0017] Preferably, the specific steps of knocking out the H19 imprinted gene of the depolarized oocyte are as follows: the Cas9 protein, sg1RNA and sg2RNA for knocking out the H19 imprinted gene are evenly mixed and injected into the depolarized oocyte, the nucleotide sequence of the sg1RNA is: CGTGGCGGCTGGTCGGATAAAGG, and the nucleotide sequence of the sg2RNA is: TTGCACTAAGTCGATTGCACTGG.

[0018] Preferably, the parthenogenetic activation comprises the following steps: placing the gene-edited oocytes and the recombinant oocytes in embryo activation solution, and activating them for 5-7 hours at a temperature of 36.5-37.5°C and a carbon dioxide concentration of 4%-6%.

[0019] Preferably, the parthenogenetic activation comprises the following steps: placing the gene-edited oocytes and the recombinant oocytes in embryo activation solution, and activating them for 6 hours at a temperature of 37° C. and a carbon dioxide concentration of 5%.

[0020] Preferably, the polar body edge of the polar body donor oocyte is bright and smooth, and the cytoplasm is uniform.

[0021] In summary, the present application includes at least one of the following beneficial technical effects: 1. The present application uses the polar body in the polar body donor oocyte to replace the cell nucleus of the polar body recipient oocyte, separates the gene-edited two-cell blastomeres and the recombined two-cell blastomeres along the cleavage furrow and crosses them, and then fuses them to obtain a hybrid embryo whose genome originates from the same germ cell. The cultivated offspring are genetically homozygous and avoid the problem of premature aging caused by shortened telomeres, and saves the time of culturing somatic cells; 2. The present application uses parthenogenesis and hybridization of the same germ cell to retain the excellent traits of the mother, while improving the health of the offspring and extending the life cycle of the offspring compared to somatic cell cloning; 3. The total cell number of the hybrid embryo blastocyst obtained in the present application is equivalent to that of the in vitro fertilized blastocyst, that is, the hybrid embryo obtained in the present application can reach the same developmental level as the in vitro fertilized embryo, and there is no significant difference in the growth rate between the mice obtained by the method of the present application and the mice obtained by in vitro fertilization, and normal physiological activities are not affected. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1is a schematic flow chart of the method for homozygous parthenogenesis by embryo hybridization of the present application; Figure 2 This is a diagram of the operation process of sucking out the first polar body in the polar body donor oocyte in the method of homozygous parthenogenesis through embryo hybridization of the present application; Figure 3 This is a diagram of the operation process of injecting the first polar body into the polar body recipient oocyte from which the chromosome-spindle complex and the first polar body have been removed in the method of homozygous parthenogenesis by embryo hybridization of the present application; Figure 4 is a bright field image of a recombinant two-cell blastomere obtained in the method of homozygous parthenogenesis by embryo hybridization of the present application; Figure 5 is a bright field image of a bond obtained in the method of homozygous parthenogenesis by embryo hybridization of the present application; Figure 6 It is a diagram of the fusion process of the bonded body obtained in the method of homozygous parthenogenesis by embryo hybridization of the present application; Figure 7 It is a diagram of the stage changes of hybrid embryo culture to hybrid embryo blastocyst obtained by the method of homozygous parthenogenesis through embryo hybridization in the present application; Figure 8 This is a graph showing the growth changes of mice born from the recipient mother mice in Example 1 from birth to the second week; Fig. 9 is a comparison chart of the relative expression levels of H19 in the hybrid embryo blastocyst of Example 1, the in vitro fertilized blastocyst of Comparative Example 1, and the parthenogenetic blastocyst of Comparative Example 2; Fig.10 The immunofluorescence staining diagram of the hybrid embryo blastocyst of Example 1, the in vitro fertilized blastocyst of Comparative Example 1 and the parthenogenetic blastocyst of Comparative Example 2 with the same culture time and the statistically compared total cell number diagram; Fig.11 This is a comparison chart of the body weights of mice born from the recipient female mice of Example 1 and Comparative Example 1 at three weeks; DETAILED DESCRIPTION The present application is further described in detail below in conjunction with examples. The following examples are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. In the following examples, if specific conditions are not specified, they are carried out according to normal conditions or conditions recommended by the manufacturer. The methods used are conventional methods known in the art unless otherwise specified, and the consumables and reagents used are commercially available unless otherwise specified. Unless otherwise specified, the professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any method or material similar or equivalent to the recorded content may also be applied to the present invention.

[0023] The raw materials used in the examples and comparative examples can be obtained from commercial sources. The reagents used in this application and their formulas are as follows: Egg collection solution M2: NaCl 94.66 mmol / L, KCl 4.78 mmol / L, KH2PO41.19 mmol / L, MgSO4·7H2O 1.19 mmol / L, Glucose 5.56 mmol / L, Sodium lactate 23.28 mmol / L, NaHCO34.15mmol / L, Sodium pyruvate 0.33 mmol / L, CaCl2·2H2O 1.71 mmol / L, HEPES 20.85 mmol / L, BSA 4.0g / L, Gentamicin 0.025g / L.

[0024] KSOM embryo culture medium: NaCl 95.00 mmol / L, KCl 2.50 mmol / L, KH2PO40.35 mmol / L, MgSO4·7H2O 0.2 mmol / L, Glucose 0.2 mmol / L, Sodium lactate 10.00 mmol / L, NaHCO325.00 mmol / L, Sodium pyruvate 0.20 mmol / L, CaCl2·2H2O 1.71 mmol / L, Na2·EDTA·2H2O 0.01 mmol / L, L-Glutamine 1.00 mmol / L, BSA 1.0g / L, Gentamicin 0.025g / L.

[0025] Micromanipulation fluid: NaCl 82.00 mmol / L, KCl 4.90 mmol / L, KH2PO41.20 mmol / L, MgSO4·7H2O 1.20 mmol / L, Glucose 5.60 mmol / L, Sodium lactate 10.00 mmol / L, NaHCO315.00mmol / L, Sodium pyruvate 0.30 mmol / L, CaCl2·2H2O 1.70 mmol / L, Na2·EDTA·2H2O0.01 mmol / L, L-Glutamine 10.0 mmol / L, Sodium lactate (60% syrup) 20 mmol / L (370µl), PVA0.1mg / ml, HEPES 10 mmol / L.

[0026] Embryo activation solution: NaCl 82.00 mmol / L, KCl 4.90 mmol / L, KH2PO41.20 mmol / L, MgSO4·7H2O 1.20 mmol / L, Glucose 5.60 mmol / L, Sodium lactate 10.00 mmol / L, NaHCO325.00mmol / L, Sodium pyruvate 0.30 mmol / L, Na2·EDTA·2H2O 0.01 mmol / L, L-Glutamine10.0 mmol / L, BSA 5.0g / L, Sodium lactate (60% syrup) 20 mmol / L (370µl), PVA 0.1mg / ml, SrCl2·6H2O 10 mmol / L.

[0027] Embryo adhesive solution: Phytohemagglutinin (PHA) was dissolved in micromanipulation solution to a final concentration of 200 µg / ml.

[0028] Embryo electrofusion solution: 0.3mol / L mannitol, 0.1mmol / L CaCl2, 0.1mmol / L MgCl2, 0.5mmol / LHEPES, 0.1mg / ml PVA.

[0029] Protease solution: Use the finished H199 culture medium and add 0.01% PVA as a solvent to dissolve protease, with a working concentration of 0.5%.

[0030] Egg collection solution M2 with added hyaluronidase: Weigh hyaluronidase and dissolve it in egg collection solution M2 to make the final concentration of hyaluronidase 0.1%.

[0031] Example 1 Example 1 of the present application discloses a method for homozygous parthenogenesis by embryo hybridization, comprising the following steps: (1) Mouse superovulation and oocyte collection: Between 5pm and 6pm, PMSG (pregnant mare serum gonadotropin in saline solution, concentration 100UI / ml) was injected into the mouse intraperitoneally, 10UI / 0.1ml per mouse. 48h after PMSG injection, HCG (human chorionic gonadotropin in saline solution, concentration 100UI / ml) was injected into the mouse intraperitoneally. 12-16h after HCG injection, the mouse was killed by cervical dislocation. The mouse was opened from the left and right sides of the dorsal abdomen. The ovaries were located under the fat pad. Excess fat was cut off. The ovaries and oviducts were cut off and placed in the preheated egg collection solution M2. The oviduct dilatation was found under the stereomicroscope. The dilatation was cut open with a 1ml syringe needle to allow the cumulus-oocyte complex to flow out. The cumulus-oocyte complex was washed three times in the egg collection solution M2 to remove impurities and fat. Place the cumulus-oocyte complex in the preheated egg collection solution M2 supplemented with hyaluronidase, and incubate in a 37°C incubator for 3 minutes. Use a lighter to simply close the tip of the yellow gun, and gently blow the cumulus-oocyte complex to blow off the granulosa cells around the oocyte. Transfer the oocytes free of granulosa cells into the preheated egg collection solution M2 for later use.

[0032] (2) Oocyte enucleation and polar body injection: The oocytes are grouped. The oocytes with bright and smooth polar body edges and uniform cytoplasm are polar body donor oocytes. The remaining oocytes are polar body recipient oocytes. The chromosome-spindle complex of the polar body recipient oocytes is removed by micromanipulation and placed in a 37°C, 5% CO2 incubator in preheated KSOM culture medium to recover for 30 minutes for use. Using a piezoelectric membrane rupture instrument (Piezo), the first polar body in the polar body donor oocyte is carefully sucked out and sucked into the injection needle. The operation process is as follows: Figure 2 As shown in the figure (arranged in chronological order from top to bottom), a depolarized oocyte is obtained. A small pulse is applied to break the polar body plasma membrane, which is then transferred to the droplet of the polar body recipient oocyte from which the chromosome-spindle complex has been removed. Similarly, the polar body contents in the injection needle are injected into the polar body recipient oocyte from which the chromosome-spindle complex has been removed using Piezo. The operation process is as follows Figure 3 As shown (arranged in chronological order from left to right), recombinant oocytes were obtained. The depolarized oocytes and recombinant oocytes were placed in a 37°C, 5% CO2 incubator in pre-heated KSOM culture medium to recover for 30 minutes. The recombinant oocytes and the corresponding depolarized oocytes from the first polar body were marked as a "pair".

[0033] (3) Microinjection: Place the depolarized oocyte in a micromanipulation solution for later use, mix the Cas9 protein, sg1RNA and sg2RNA in advance to obtain a mixture, add the mixture to the microinjection needle using a micro-sample needle, and use a microinjection pump to microinject the mixture into the depolarized oocyte to knock out the H19 imprinted gene and obtain a gene-edited oocyte. The nucleotide sequence of sg1RNA is: CGTGGCGGCTGGTCGGATAAAGG, and the nucleotide sequence of sg2RNA is: TTGCACTAAGTCGATTGCACTGG.

[0034] (4) Parthenogenetic activation: Preheat the embryo activation solution in a 37°C, 5% CO2 incubator. Place the gene-edited oocytes and recombinant oocytes in droplets of embryo activation solution and wash them three times. Then place them in droplets of embryo activation solution and activate them in a 37°C, 5% CO2 incubator for 6 hours. After 6 hours, wash them three times with droplets of preheated KSOM culture solution, place them in KSOM culture solution, and continue to culture them in a 37°C, 5% CO2 incubator for 24 hours to obtain gene-edited two-cell blastomeres and recombinant two-cell blastomeres, respectively. Figure 4 shown.

[0035] (5) Separation and combination of two-cell blastomeres: Take the gene-edited two-cell blastomeres and the recombinant two-cell blastomeres that belong to the same "pair", use a protease solution to digest the two-cell zona pellucida, and then use a microdissection knife to manually separate the gene-edited two-cell blastomeres along the cleavage furrow to obtain the first blastomere, and manually separate the recombinant two-cell blastomere along the cleavage furrow to obtain the second blastomere. Combine the first blastomere and the second blastomere that belong to the same "pair" in embryo adhesive solution, and use a glass pin to stick the first blastomere and the second blastomere that belong to the same "pair" together along the cleavage furrow to obtain an adhesive body, such as Figure 5 shown.

[0036] (6) Two-cell hybridization electrofusion: The conjugate is gently washed once in preheated embryo electrofusion solution, and then placed in an electrode plate with embryo electrofusion solution. A glass needle is used to move the conjugate until the cleavage groove is perpendicular to the direction of the electric field. Electrofusion is performed under the electrofusion parameters of 1200V / cm, 40μs duration, and one pulse. The electrofusion process is as follows: Figure 6 As shown (arranged in chronological order from left to right), the embryos were then washed three times with KSOM culture medium and cultured in preheated KSOM culture medium for 30 minutes to obtain hybrid embryos.

[0037] (7) Hybrid embryo culture: The hybrid embryos were placed one by one in a droplet of 10 μL KSOM culture medium and covered with oil for culture to obtain hybrid embryo blastocysts. The stage changes of hybrid embryo culture to hybrid embryo blastocysts are shown in the figure. Figure 7Shown (in chronological order from left to right).

[0038] (8) Embryo transplantation: Anesthetize the male mouse and place it in supine position. Make a horizontal incision along the midline of the abdomen vertically. Use flat-blade forceps to clamp out the fat pad downwards, and then pull out the testicles. Heat the forceps over an alcohol lamp and clamp off the vas deferens. Perform the same operation on the left and right testicles, and suture the abdominal cavity and skin. Sterilized male mice must be prepared at least two months in advance before embryo transplantation. After one month of recovery after the operation, mate with the female mouse to see the plug. Wait for 2-3 weeks to make sure that the female mouse cannot become pregnant. Only then can this sterilized male mouse be used. Put the sterilized male mouse and the female mouse together in the cage, and then check the female mouse with the vaginal plug as a recipient. The hybrid embryonic blastocyst is transplanted into the recipient female mouse by non-surgical method. The recipient female mouse gives birth to mice, and the birth ( Figure 8 (up)) to the second week ( Figure 8 The change diagram of (below)) is as follows Figure 8 shown.

[0039] Comparative Example 1 Comparative Example 1: The oocytes of Example 1 were used for in vitro fertilization and culture to obtain in vitro fertilized blastocysts, which were then transplanted into recipient female mice according to the embryo transplantation steps in Example 1.

[0040] Comparative Example 2 Comparative Example 2: The oocytes of step (1) in Example 1 were used, and the oocytes with granulosa cells removed were transferred into the preheated egg-picking solution M2 for standby use. The oocytes were washed three times with the preheated embryo parthenogenetic activation solution, and then placed in the embryo parthenogenetic activation solution and activated in a 37°C, 5% CO2 incubator for 6 hours. Thereafter, the oocytes were washed three times with the preheated KSOM embryo culture solution, and then placed in the KSOM embryo culture solution and cultured in a 37°C, 5% CO2 incubator until the blastocyst stage, thereby obtaining a parthenogenetic blastocyst.

[0041] Test and Inspection (1) The hybrid embryo blastocysts of Example 1 (named as embryo hybrid group), the in vitro fertilized blastocysts of Comparative Example 1 (named as in vitro fertilization group) and the parthenogenetic blastocysts of Comparative Example 2 (named as parthenogenetic group) were tested by qPCR to detect the expression level of H19. The quantitative primers used were H19-F: CATGTCTGGGCCTTTGAA and H19-R: TTGGCTCCAGGATGATGT. A comparison chart of the relative expression level of H19 was obtained, as shown in FIG. Fig. 9 shown.

[0042] (2) The hybrid embryo blastocysts of Example 1, the in vitro fertilized blastocysts of Comparative Example 1, and the parthenogenetic blastocysts of Comparative Example 2 were cultured for the same time and immunofluorescence staining was performed to count the total cell number. Fig.10 shown.

[0043] (3) The weights of mice born from the recipient mothers of Example 1 and Comparative Example 1 were recorded for three weeks starting from birth, and a weight comparison chart was obtained as shown in FIG. Fig.11 Shown Results Analysis Reference Fig. 9 , H19 expression detection showed that the relative expression of H19 in the parthenogenetic group was significantly higher than that in the embryo hybridization group and the in vitro fertilization group, while there was no significant difference between the relative expression of H19 in the embryo hybridization group and the in vitro fertilization group. This may be due to the expression of two maternal alleles in the parthenogenetic embryos, while the expression of a single maternal gene in the embryo hybridization group and the in vitro fertilization group proves that the monoallelic knockout effect of the present application is significant.

[0044] Reference Fig.10 The total cell number in the parthenogenetic blastocyst of Comparative Example 2 was significantly lower than that in the hybrid embryo blastocyst and the in vitro fertilized blastocyst, while the total cell number in the hybrid embryo blastocyst and the in vitro fertilized blastocyst was equivalent, indicating that the hybrid embryos obtained by the method of homozygous parthenogenesis through embryo hybridization of the present application can reach the same developmental level as the in vitro fertilized embryos.

[0045] Reference Fig.11 The weight of the mice obtained by the method of Example 1 from birth to the third week was slightly lower than that of the mice obtained in Comparative Example 1, but there was no significant difference in the growth rate of the two mice, and normal physiological activities were not affected.

[0046] Unless otherwise defined, the technical terms or scientific terms used in this application should be understood by people with ordinary skills in the field to which this application belongs. The words "first", "second", "third" and similar words used in the specification and claims of this application do not indicate any order, quantity or importance, but are only used to distinguish different components. "One" or "one" and similar words do not indicate a quantitative limit, but indicate that there is at least one. "Include" or "comprise" and similar words mean that the elements or objects appearing before "include" or "comprise" include the elements or objects listed after "include" or "comprise" and their equivalents, and do not exclude other elements or objects. "Up", "down", "left", "right" and the like are only used to indicate relative positional relationships. When the absolute position of the described object changes, the relative positional relationship may also change accordingly.

[0047] The above are all optional embodiments of the present application, and are not intended to limit the protection scope of the present application. Therefore, any equivalent changes made based on the structure, shape, and principle of the present application should be included in the protection scope of the present application.

Claims

1. A method for homozygous parthenogenesis by embryo hybridization, characterized in that: The following steps are involved: Oocytes are obtained and divided into polar body recipient oocytes and polar body donor oocytes, the polar body in the polar body donor oocyte is used to replace the chromosome-spindle complex of the polar body recipient oocyte to obtain depolarized oocytes and recombinant oocytes, the depolarized oocytes are gene-edited to restrict / block the expression of their imprinted genes to obtain gene-edited oocytes, the gene-edited oocytes and recombinant oocytes are parthenogenetically activated to obtain gene-edited two-cell blastomeres and recombinant two-cell blastomeres, the gene-edited two-cell blastomeres and the recombinant two-cell blastomeres are separated along the cleavage furrow and cross-combined, and then fused to obtain hybrid embryos, and the hybrid embryos are cultured to the blastocyst stage and then transplanted into the mother.

2. A method for homozygous parthenogenesis by embryo hybridization according to claim 1, characterized in that: The method of using the polar body in the polar body donor oocyte to replace the chromosome-spindle complex of the polar body recipient oocyte comprises the following steps: removing the chromosome-spindle complex of the polar body recipient oocyte, sucking out the polar body of the polar body donor oocyte to obtain a depolarized oocyte and polar body, and injecting the polar body into the polar body recipient oocyte without the chromosome-spindle complex to obtain a recombinant oocyte.

3. A method for homozygous parthenogenesis by embryo hybridization according to claim 1, characterized in that: The separation and crossover combination comprises the following steps: manually separating the gene-edited two-cell blastomere along the cleavage furrow to obtain the first blastomere, manually separating the recombinant two-cell blastomere along the cleavage furrow to obtain the second blastomere, and gluing the first blastomere and the second blastomere together in embryo glue fluid to obtain a glue body.

4. A method for homozygous parthenogenesis by embryo hybridization according to claim 3, characterized in that: The embryo adhesive solution comprises plant lectin and micromanipulation fluid, and the concentration of the plant lectin in the embryo adhesive solution is 150-250 μg / mL.

5. A method for homozygous parthenogenesis by embryo hybridization according to claim 3, characterized in that: The fusion comprises placing the bonded body in embryo electrofusion solution for electrofusion and then placing the bonded body in KSOM embryo culture solution for culture.

6. A method for homozygous parthenogenesis by embryo hybridization according to claim 5, characterized in that: The embryo electrofusion solution includes mannitol, CaCl2, MgCl2, HEPES and PVA.

7. A method for homozygous parthenogenesis by embryo hybridization according to claim 5, characterized in that: The electrofusion parameters are: 1000-1400 V / cm, duration 30-50 µs, one pulse.

8. A method for homozygous parthenogenesis by embryo hybridization according to claim 1, characterized in that: The gene-edited oocyte is obtained by knocking out the imprinted gene of the depolarized oocyte.

9. A method for homozygous parthenogenesis by embryo hybridization according to claim 1, characterized in that: The parthenogenetic activation comprises the following steps: placing the gene-edited oocytes and the recombinant oocytes in embryo activation solution, and activating them for 5-7 hours at a temperature of 36.5-37.5° C. and a carbon dioxide concentration of 4%-6%.

10. A method for homozygous parthenogenesis by embryo hybridization according to claim 1, characterized in that: The polar body donor oocyte has bright and smooth polar body edges and uniform cytoplasm.

Images