High-sensitivity visual detection kit for activity of human structure-specific nuclease FEN1 and application of high-sensitivity visual detection kit

Abstract

The invention discloses a high-sensitivity visual detection kit for the activity of human structure-specific nuclease FEN1 and application of the high-sensitivity visual detection kit. A turnup flap structure in FDP is specifically cut by FEN1 to generate a dumbbell-shaped DNA probe with a notch, the notch of the probe is connected under enzyme catalysis to generate a closed annular dumbbell-shaped DNA probe, rolling circle amplification is carried out in the presence of an amplification primer and enzyme, a urease modified signal probe is added into an amplification product, and the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows that the detection result shows. An amplification product and a signal probe complement are separated by virtue of magnetic microspheres and are added into a urease substrate solution, urea in the solution is efficiently catalyzed by urease in the complement to cause change of a pH value, so that the color of a phenol red indicator is changed, and the FEN1 activity is detected. The kit is high in sensitivity, simple and convenient to operate, free of additional instruments and equipment, low in cost and large in application potential, results can be observed by naked eyes, and the kit is used for screening FEN1 inhibitor candidate drugs, and the drug discovery efficiency is remarkably improved.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a new scheme for detecting FEN1 activity. The present invention is a highly sensitive visualization and low-cost detection kit for FEN1 activity based on rolling circle amplification and enzyme catalytic reaction, which can be used for the activity detection of FEN1 tumor markers and the screening of candidate drugs for its inhibitors. Background Art

[0002] FEN1 is a nuclease that has three major enzymatic activities: 5'-3' Flap endonuclease, endonuclease, and exonuclease. During DNA replication, FEN1 recognizes and binds to the 5'-flap structure in the Okazaki fragment, creates a gap through precise cutting, and connects the gap with the help of DNA ligase, thereby completing the maturation of the Okazaki fragment. In addition, FEN1 is also involved in multiple DNA metabolic pathways such as DNA damage repair, telomere stability maintenance, and apoptosis DNA fragmentation.

[0003] Dysregulation of FEN1 function can lead to decreased genome stability and integrity, ultimately inducing a variety of chromosome-related diseases including tumors. According to research reports, FEN1 overexpression is associated with the risk of a variety of malignant tumors, including lung cancer, invasive breast cancer, epithelial ovarian cancer, gliomas, and digestive tract malignancies. In addition, inhibiting the activity of FEN1 can hinder the DNA repair mechanism in tumor cells, thereby achieving the purpose of anti-tumor. In summary, as a recognized cancer overexpressed enzyme, FEN1 has become a biomarker for cancer and a target for anticancer drugs. Therefore, the development of FEN1 activity analysis methods can provide a powerful tool for cancer diagnosis, prognosis prediction, exploration of cancer mechanisms, and screening of FEN1 inhibitor candidate anti-tumor drugs.

[0004] The main FEN1 detection methods currently in use are Western-blot (WB) and ELISA. However, these methods are expensive, cumbersome to operate, and can only quantify the total amount of FEN1 protein, but cannot measure its activity, let alone be applied to the screening of FEN1 inhibitors.

[0005] In the above detection methods, fluorescent nucleic acid dyes or CRISPR / Cas systems are used to convert nucleic acid signals into detectable fluorescent signals. Although the above signal mode sensing system has excellent sensitivity and specificity, it has the problem of relying on expensive equipment, which hinders the further transformation and application of the method. Summary of the invention

[0006] In order to solve the problems existing in the background technology, the purpose of the present invention is to provide a highly sensitive visualization and low-cost detection kit for the activity of the tumor marker FEN1, and to apply it to the screening of candidate tumor drugs for FEN1 inhibitors.

[0007] The technical solution of the present invention is as follows:

[0008] I. A highly sensitive visual detection kit for FEN1 activity:

[0009] The kit includes a DNA probe, an enzyme, a rolling circle amplification reaction solution, a biotin-modified primer (BP), a signal probe (Urease-DNA), streptavidin-modified magnetic microspheres (SA-MB), a blocking solution, a washing solution, an acetic acid solution, a urease substrate solution, a phenol red solution, and an FEN1 standard;

[0010] The DNA probe uses a dumbbell-shaped DNA probe FDP with a flap structure;

[0011] Among them, the signal probe uses a urease-modified signal probe Urease-DNA, which is a conjugate of an amino-modified signal probe (NH 2 -DNA) and urease.

[0012] The sequences of the above FDP, BP, and NH 2 -DNA are as follows:

[0013] The gene sequence of the flapped dumbbell DNA probe (FDP) with a flap structure

[0014] is SEQ ID No.1, that is, TTAACGACCATAGCTGCCCTATAGTGAGT CGTATTACAGCTATGGTTGCCGTCAGAATCTACACTTAGTAGAAATTATCT GACGGCAA; the gene sequence of the amino-modified signal probe NH 2 -DNA in the urease-modified signal probe Urease-DNA is SEQ ID No.2, that is, AmMC6T-TTTTTTTGACGGCAACCAT AGCTGCCCTATAGTGA, where AmMC6T represents an amino group; the gene sequence of the biotin-modified primer Biotin-DNA primer (BP) is SEQ ID No.3, that is, Biotin-TAATACGACTC, where Biotin represents biotin.

[0015] The rolling circle amplification reaction solution is a mixed solution of 1 mmol / L deoxynucleoside triphosphate (dNTP), 1×ThermoPol buffer solution, 1×T4 DNA ligase buffer solution, and 1×phi 29 DNA polymerase buffer solution; the enzyme is T4 DNA ligase and phi 29 DNA polymerase; the streptavidin-modified magnetic microspheres are formed by modifying the surface of magnetic microspheres with streptavidin (SA-MB), and the particle size is 1.5 μm.

[0016] The blocking solution is a mixed solution of a washing solution with pH 7.5 and skim milk powder with a final mass concentration of 5%; the washing solution is mainly composed of 10 mmol / L tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl), 3 mol / L sodium chloride (NaCl), 1 mmol / L magnesium chloride (MgCl 2 ), and 0.01% Tween 20, and is a mixed solution with pH 7.5; the concentration of the acetic acid solution is 0.1 mmol / L and the pH is 6.0; the urease substrate solution is mainly composed of 3 mol / L NaCl, 60 mmol / L MgCl 2 , 50 mmol / L urea, and 1 mmol / L HCl, and is a mixed solution with pH 6.0; the mass concentration of the phenol red solution is 0.04%. The standard product is human structure-specific nuclease FEN1.

[0017] In the kit provided by the present invention, the DNA (including FDP, BP, and NH 2 -DNA), enzyme, rolling circle amplification reaction solution, and FEN1 standard product are all stored in an environment of -20°C, and the blocking solution, washing solution, acetic acid solution, urease substrate solution, and phenol red solution are all stored in an environment of 4°C.

[0018] The urease-modified signal probe is prepared as follows:

[0019] (1) NH 2 -DNA activation: Weigh 3-maleimidobenzoic acid N-hydroxysuccinimide ester MBS powder and dissolve it in dimethyl sulfoxide DMSO solution to obtain a 6.4 mmol / L MBS solution. Then add 1 nmol of amino-modified signal probe NH 2 -DNA to 3.2 μL of the above MBS solution, and add 1×PBS solution to 100 μL, and then place it at room temperature for 2 h to activate the amino-modified signal probe NH 2 -DNA to obtain the activated NH 2 -DNA solution;

[0020] (2) Ultrafiltration concentration and purification of the activated NH 2 -DNA: Use a 3KD ultrafiltration tube to ultrafilter and concentrate the activated NH2 -DNA solution, remove excess 3-maleimidobenzoic acid succinimidyl ester MBS in the solution, wash it three times with 1×PBS solution and then resuspend it with 1×PBS solution to obtain purified activated NH 2 -DNA solution;

[0021] (3) Purification of activated NH 2 -DNA coupling with urease: Weigh 1.5 mg of urease powder and dissolve it in 1 mL of 1× PBS solution to obtain urease solution. 2 -DNA solution was added to the urease solution and allowed to stand at room temperature for 1 h to allow urease and activated NH 2 -DNA coupling reaction;

[0022] (4) Then, the solution after the coupling reaction was concentrated by ultrafiltration using a 300KD ultrafiltration tube to remove the amino-modified signal probe NH that was not coupled to urease in the solution. 2 -DNA, and then washed three times with 1×PBS solution and resuspended with 1×PBS solution to obtain purified NH 2 -DNA and urease-modified signal probe Urease-DNA coupled with urease.

[0023] The highly sensitive visual detection kit of the present invention is used in FEN1 activity detection and concentration detection, and in screening FEN1 candidate anti-tumor drugs.

[0024] The above application in FEN1 activity detection is capable of performing visual detection of FEN1 activity.

[0025] The above-mentioned screening of FEN1 candidate anti-tumor drugs is to screen the inhibition of drugs on FEN1, and then determine the FEN1 inhibitor to select the anti-tumor drug.

[0026] The method of using the kit of the present invention is as follows: when used for detecting FEN1 activity, a standard curve is fitted in each sample detection, and the A of the detection sample reaction solution is 570 / A 443 The value is substituted into the standard curve to calculate the FEN1 activity. When used to screen FEN1 inhibitors, no standard curve is required, and a FEN1 standard without the drug to be tested is used as a negative control group.

[0027] 2. A method for detecting FEN1 using a highly sensitive visual detection kit, the method specifically comprising:

[0028] The first application of the kit of the present invention is the highly sensitive visual detection of FEN1 activity.

[0029] S1. First, perform gradient dilution on the known-concentration FEN1 standard product to prepare a series of gradient solutions of the FEN1 standard product with concentrations ranging from 0.05 U / ml to 5000 U / ml. The aqueous solution without FEN1 is used as the negative control group. Then, use the high-sensitivity visualization detection kit to process the series of gradient solutions of the FEN1 standard product and the aqueous solution without FEN1 as the test solutions respectively for the reaction process of the FEN1 cleavage-DNA ligation-RCA amplification-urease catalytic reaction chain. After the reaction, measure the absorbance ratio parameter of the reaction solution. Then, establish a relationship working curve based on the relationship between the different concentrations of the series of gradient solutions of the FEN1 standard product and their corresponding absorbance ratio parameters;

[0030] S2. For the FEN1 solution with an unknown concentration to be tested, use the high-sensitivity visualization detection kit to process the FEN1 solution to be tested as the test solution for the reaction process of the FEN1 cleavage-DNA ligation-RCA amplification-urease catalytic reaction chain. After the reaction, measure the absorbance ratio parameter of the reaction solution, and substitute the absorbance ratio parameter into the relationship working curve for judgment to obtain the activity detection result and the concentration detection result.

[0031] If the current absorbance ratio parameter is greater than the minimum value of the absorbance ratio parameters in the relationship working curve, the FEN1 in the current FEN1 solution with an unknown concentration to be tested can be determined to have activity, and then use the concentration corresponding to the absorbance ratio parameter in the relationship working curve that is the same as the current absorbance ratio parameter as the concentration of the FEN1 in the current FEN1 solution with an unknown concentration to be tested.

[0032] The absorbance ratio parameter is the ratio of the absorbance A 443 and A 570 at 443 nm and 570 nm.

[0033] Among them, FEN1 cleaves the 5'-flap structure in FDP to generate a nicked dumbbell-shaped DNA probe, and then under the catalysis of T4 DNA ligase, the nick is ligated to generate a closed circular dumbbell-shaped DNA probe CDP. CDP binds to BP in the rolling circle amplification reaction system, and using dNTP as a raw material, it undergoes isothermal rolling circle amplification under the catalysis of phi 29 DNA polymerase to generate a 5'-biotin-modified long repetitive single-stranded DNA product. The Urease-DNA chain added to the system recognizes a repetitive sequence in the above amplification product and binds to it complementarily. The strong coupling effect between streptavidin on the magnetic microspheres and biotin on the amplification product can separate the amplification product and the signal probe complementary from the solution. Then, after adding the mixture of the urease substrate and the phenol red solution, the urease modified on the signal probe catalyzes urea in the urease substrate solution to produce NH 3It causes a change in the pH value of the solution, resulting in a change in the color of the phenol red indicator in the solution from yellow to pink. The level of FEN1 activity can be judged by visual observation. The absorbance can be measured using a microplate reader for precise quantification of FEN1 activity. The whole reaction is carried out in a 37 °C water bath, featuring high sensitivity, simple operation, no need for additional instrument equipment, low cost, and the results can be observed with the naked eye.

[0034] To achieve the purpose of highly sensitive visual detection of FEN1 activity, the specific technical solution adopted is as follows:

[0035] (1) Design a dumbbell-shaped DNA probe (FDP) with a 5'-flap structure that can be specifically cleaved by FEN1;

[0036] (2) Design a biotin-modified primer (BP) required for RCA amplification and an amino-modified signal probe (NH 2 -DNA) that recognizes the amplification product according to the sequence of the FDP probe;

[0037] (3) Optimize the reaction conditions for FEN1 to cleave the 5'-flap structure in FDP to generate a nicked dumbbell-shaped probe and for T4 DNA ligase to ligate the nick to generate a closed circular dumbbell-shaped DNA probe (CDP);

[0038] (4) Couple NH 2 -DNA with urease to obtain a urease-modified signal probe (Urease-DNA);

[0039] (5) Screen the optimal sequences of BP and Urease-DNA, and optimize the RCA amplification conditions to obtain higher amplification efficiency and lower background signals;

[0040] (6) Gradiently dilute the known concentration of FEN1 standard product to prepare a solution with a concentration of 0.05 U / ml to 5000 U / ml. The aqueous solution without FEN1 is used as the negative control group. Add it to the system to trigger the occurrence of the FEN1 cleavage-DNA ligation-RCA amplification-urease catalysis reaction chain. After the reaction, measure the absorbances A 443 and A 570 of the reaction solution at 443 nm and 570 nm respectively. A 443 and A 570 represent the absorbances at 443 nm and 570 nm respectively. Fit and establish a working curve showing the relationship between the ratio of A 570 / A 443 and the FEN1 concentration. Use the working curve to judge the activity and extract the concentration based on the ratio of A 570 / A 443 in the case to be measured.

[0041] More specifically, the process of highly sensitive visual detection of FEN1 activity is as follows:

[0042] The reaction volume for FEN1 to cleave the 5'-flap structure is 20 μL, including 4 μL of FEN1 standard or sample to be tested, 2 μL of 500 nmol / L FDP, 2 μL of 10× ThermoPol buffer solution, and 12 μL of DEPC-treated water. After pipetting and mixing evenly, it is heated in a water bath at 37°C for 1 h.

[0043] Subsequently, 20 μL of T4 DNA ligation reaction solution (containing 2 μL of 10× T4 DNA ligase buffer solution, 60 U of T4 DNA ligase, and DEPC-treated water) is added thereto. After pipetting and mixing evenly, it is heated in a water bath at 37°C for 45 min.

[0044] Then, 10 μL of RCA amplification reaction solution (containing 1 μL of 10× phi 29 DNA polymerase buffer solution, 1 μL of 10 mmol / L dNTP, 5 U of phi 29 DNA polymerase, 2 μL of BP, 2 μL of Urease-DNA, and DEPC-treated water) is added thereto. After pipetting and mixing evenly, it is heated in a water bath at 37°C for 1 h.

[0045] Meanwhile, 100 μL of blocking solution is added to 15 μL of 5 mg / mL SA-MB. After incubating at a constant temperature in a water bath at 37°C for 1 h, the centrifuge tube is placed on a magnetic stand and left to stand until all the magnetic beads are adsorbed to the tube wall, and then the supernatant solution is aspirated and discarded.

[0046] The FEN1 reaction solution and 50 μL of blocking solution are added to the blocked MB. After incubating at a constant temperature in a water bath for 15 min, the supernatant is discarded by magnetic separation, and then the MB surface is washed three times with 100 μL of washing solution to remove non-specific binders. Then, the MB is resuspended with 60 μL of 0.1 mM acetic acid solution at pH 6.0, 20 μL of 0.04% phenol red solution and 100 μL of urease substrate solution are added, and after reacting at room temperature for 1 h, the supernatant is aspirated by magnetic separation and the color change is observed with the naked eye and A 443 and A 570 .

[0047] The specific method is as follows:

[0048] The second application of the present invention is to investigate the inhibition of FEN1 by drugs by detecting the activity of FEN1 in the presence of drugs to be screened, and to screen out FEN1 inhibitors as candidate anti-tumor drugs. After primary screening to narrow the range of inhibitor candidates, the drug discovery efficiency is significantly improved.

[0049] To achieve the purpose of screening candidate anti-tumor drugs for FEN1 inhibitors, the specific method is as follows:

[0050] L1. Prepare a FEN1 standard solution with a specific concentration of 500 U / ml;

[0051] L2. Gradient dilute the standard sample of the drug to be tested with a known concentration to prepare a series of drug solutions with different drug concentrations. Add the series of drug solutions with different drug concentrations to the FEN1 standard solution in step 1) respectively to obtain a series of drug-FEN1 mixed solutions with different concentrations. Use the FEN1 standard solution without adding the drug to be tested as the negative control group. Use the high-sensitivity visualization detection kit to process the series of drug-FEN1 mixed solutions and the FEN1 standard solution without adding the drug to be tested as the test solutions respectively for the reaction process of the FEN1 cleavage-DNA ligation-RCA amplification-urease catalyzed reaction chain. After the reaction, measure the absorbance ratio parameter of the reaction solution and make a judgment:

[0052] If the absorbance ratio parameters corresponding to the series of drug-FEN1 mixed solutions are all less than the absorbance ratio parameter corresponding to the FEN1 standard solution without adding the drug to be tested, the current drug to be tested is a FEN1 inhibitor and is used as a candidate anti-tumor drug;

[0053] Then establish a FEN1 inhibition fitting curve according to the relationship between the different drug concentrations of the series of drug-FEN1 mixed solutions and their corresponding absorbance ratio parameters, and calculate the half-inhibitory concentration IC 50 , and compare the inhibitory effects of different drugs through the half-inhibitory concentration. (When comparing the inhibitory effects of several drugs, if the half-inhibitory concentration of drug A is less than the half-inhibitory concentration of drug B, it can be considered that the inhibitory effect of drug A is stronger.)

[0054] The half-inhibitory concentration IC 50 is calculated by the software according to the FEN1 inhibition fitting curve established using Graphpad Prism software.

[0055] More specifically, the process of screening for FEN1 inhibitors is as follows:

[0056] Gradient dilute the standard sample of the drug to be tested with a known concentration to prepare a series of concentration solutions. Take 4 μL of the drug solution to be tested and mix it with 4 μL of the FEN1 standard solution at 500 U / ml. Use FEN1 with 4 μL of DEPC-treated water added as the negative control group.

[0057] Take 8 μL of the mixed solution of FEN1 and the drug to be tested at different concentrations, 2 μL of 500 nmol / L FDP, 2 μL of 10× ThermoPol buffer solution, and 8 μL of DEPC-treated water. After pipetting and mixing evenly, heat in a water bath at 37°C for 1 h. Subsequently, add 20 μL of T4 DNA ligation reaction solution (containing 2 μL of 10× T4 DNA ligase buffer solution, 60 U of T4 DNA ligase, and DEPC-treated water). After pipetting and mixing evenly, heat in a water bath at 37°C for 45 min. Then add 10 μL of RCA amplification reaction solution (containing 1 μL of 10× phi 29 DNA polymerase buffer solution, 1 μL of 10 mmol / L dNTP, 5 U of phi 29 DNA polymerase, 2 μL of BP, 2 μL of Urease-DNA, and DEPC-treated water). After pipetting and mixing evenly, heat in a water bath at 37°C for 1 h. At the same time, add 100 μL of blocking solution to 15 μL of 5 mg / mL SA-MB, incubate in a water bath at 37°C for 1 h, then place the centrifuge tube on a magnetic rack and let it stand until all the magnetic beads are adsorbed to the tube wall, and pipette and discard the supernatant. Add the FEN1 reaction solution and 50 μL of blocking solution to the blocked MB, incubate in a water bath at a constant temperature for 15 min, and also perform magnetic separation to discard the supernatant, then wash three times with 100 μL of washing solution to remove non-specific binding substances on the surface of MB. Then resuspend MB with 60 μL of 0.1 mM acetic acid solution at pH 6.0, add 20 μL of 0.04% phenol red solution and 100 μL of urease substrate solution, react at room temperature for 1 h, perform magnetic separation, pipette the supernatant, and observe and measure A 443 and A 570 , establish a FEN1 inhibition fitting curve between the relative activity of FEN1 in the absence of the drug to be tested and the concentration of the drug to be tested, and calculate the half-inhibitory concentration (IC 50 ).

[0058] Activity detection result report: ① Establish a standard curve with the A 570 / A 443 values detected by different concentrations of FEN1 standard products in this kit and the FEN1 concentration as the standard for sample quantification.

[0059] ② Detect the A 570 / A 443 value of the sample, and calculate the concentration of FEN1 in the sample to be tested according to the above standard curve.

[0060] Inhibitor screening result report: Establish an inhibition fitting curve with the relative activity of FEN1 in the absence of the drug to be tested and the concentration of the drug to be tested in different concentration groups of the drug to be tested in this kit, and calculate the IC 50 value of the drug against FEN1.

[0061] The reaction process of the FEN1 cleavage-DNA ligation-RCA amplification-urease catalysis reaction chain is specifically as follows:

[0062] 1) Add the test solution to a mixed solution composed of 500 nmol / L dumbbell-shaped DNA probe FDP with a flap structure, 10× ThermoPol buffer solution, and DEPC-treated water. After pipetting and mixing evenly, heat it in a water bath at 37°C for a period of time, 1 h.

[0063] 2) Subsequently, add the T4 DNA ligation reaction solution to it. The T4 DNA ligation reaction solution contains 10× T4 DNA ligase buffer solution, T4 DNA ligase, and DEPC-treated water. After pipetting and mixing evenly, heat it in a water bath at 37°C for a period of time, 45 min.

[0064] 3) Then add the RCA amplification reaction solution to it. The RCA amplification reaction solution contains 10× phi 29 DNA polymerase buffer solution, 10 mmol / L deoxynucleoside triphosphate dNTP, phi 29 DNA polymerase, biotin-modified primer BP, urease-modified signal probe Urease-DNA, and DEPC-treated water. After pipetting and mixing evenly, heat it in a water bath at 37°C for a period of time, 1 h, to obtain the FEN1 sample solution.

[0065] 4) At the same time, add the blocking solution to the 5 mg / mL streptavidin-modified magnetic microsphere solution SA-MB in a centrifuge tube. Then place the centrifuge tube in a water bath at 37°C and incubate it for a period of time, 1 h. After that, place the centrifuge tube on a magnetic rack and let it stand until all the magnetic beads are adsorbed to the tube wall. Pipette and discard the supernatant solution to obtain the blocked MB solution.

[0066] 5) Add the FEN1 sample solution obtained in step 3) and the blocking solution to the blocked SA-MB solution, place it in a water bath and incubate it at a constant temperature for a period of time, 15 min. After magnetic separation to discard the supernatant, wash it three times with the washing solution to remove the non-specific binders on the surface of SA-MB.

[0067] 6) Finally, resuspend and treat SA-MB with 0.1 mM acetic acid solution at pH 6.0, then add the phenol red solution and the urease substrate solution and react at room temperature for a period of time, 1 h. After magnetic separation, pipette and take the supernatant as the reaction solution.

[0068] In the present invention, FEN1 specifically cleaves the protruding flap structure in FDP to generate a dumbbell-shaped DNA probe with a nick. At the nick of this probe, ligation occurs under the catalysis of T4 DNA ligase to produce a closed circular dumbbell-shaped DNA probe (CDP), which then undergoes rolling circle amplification in the presence of amplification primers and phi 29 DNA polymerase. To meet the requirements of highly sensitive visual detection, in the present invention, a signal probe modified with urease is added to the amplification product. The amplification product and the complement of the signal probe are separated by magnetic microspheres and added to the urease substrate solution. Taking advantage of the fact that urease in the complement efficiently catalyzes urea in the solution to produce NH3, leading to a change in pH value, and thus causing a color change in the phenol red indicator added to the solution, the detection of FEN1 activity is achieved.

[0069] In the present invention, a nucleic acid probe modified with urease is used as a signal probe to recognize the nucleic acid amplification product triggered by FEN1 activity, converting the FEN1 activity signal into a colorimetric signal of the urease-catalyzed reaction. It has the advantages of simplicity, rapidity, instant detection, and visible results to the naked eye, enabling rapid, highly sensitive visual detection of FEN1 activity, and can be applied to the screening of candidate drugs for FEN1 inhibitors.

[0070] The beneficial effects of the present invention are as follows:

[0071] In order to overcome the deficiencies of existing detection methods that can only quantify the protein content of FEN1, unable to measure the activity and thus unable to screen for FEN1 inhibitors, and the methods for measuring the activity are expensive in terms of instruments and equipment, the present invention provides a highly sensitive, visual, and low-cost FEN1 activity detection technology - a kit for FEN1 activity detection based on FEN1 cleavage of the 5'-flap structure triggering RCA amplification and the detection of amplification products by an enzyme-labeled nucleic acid signal probe. The whole reaction of the kit of the present invention is carried out in a 37°C water bath, and the detection limit is 0.05 U / mL, achieving highly sensitive detection. In addition, it has the characteristics of simple operation, no need for additional instruments and equipment, low cost, and visible results to the naked eye.

[0072] In addition, this method can be used for the screening of candidate drugs for FEN1 inhibitors. By preliminary screening, the range of inhibitor candidates is narrowed, significantly improving the drug discovery efficiency, and having great application potential in the discovery of FEN1 inhibitor anti-tumor drugs. Brief Description of the Drawings

[0073] Figure 1 is the schematic diagram of FEN1 activity detection in this kit;

[0074] Figure 2 is the standard curve and colorimetric diagram for detecting FEN1 activity in this kit (a: standard curve; b: colorimetric diagram);

[0075] Figure 3This kit is for the selective and colorimetric detection of FEN1 activity (a: A 570 / A 443 value comparison chart; b: colorimetric chart);

[0076] Figure 4 It is the fitting curve and colorimetric chart for detecting the inhibitory effect of the FEN1 classical inhibitor aurintricarboxylic acid (ATA) on FEN1 using this kit (a: inhibition fitting curve; b: colorimetric chart). Detailed implementation manners

[0077] The present invention will be further described below in conjunction with the accompanying drawings through specific embodiments, but these embodiments are only for illustrating the present invention and do not limit the scope of the present invention.

[0078] The present invention is a highly sensitive visual detection kit for FEN1 activity based on the FEN1 cleavage-triggered rolling circle amplification method and the enzyme-catalyzed reaction visual signal amplification technology. It uses the specific cleavage of the 5'-flap structure by FEN1 to trigger rolling circle amplification to convert the FEN1 activity signal into an amplified nucleic acid signal, and uses an enzyme-modified nucleic acid signal probe to recognize the amplification product, taking advantage of the visualization and high efficiency of the enzyme-catalyzed reaction to further convert the nucleic acid signal into an amplified colorimetric signal to detect the FEN1 activity.

[0079] As Figure 1 shown, based on the 5'-flap endonuclease activity of FEN1, a dumbbell-shaped DNA probe (FDP) with a 5'-flap structure is designed. When FEN1 exists in the system, it specifically cleaves the flap structure in FDP to generate a dumbbell-shaped DNA probe with a nick, and under the action of T4 DNA ligase, this nick is ligated to generate a closed circular dumbbell-shaped DNA probe (CDP).

[0080] Select a sequence in CDP, design a rolling circle amplification primer and modify it with biotin. In the presence of phi 29 DNA polymerase with strand displacement activity and the raw material dNTP, the biotin-modified primer (BP) binds to CDP to initiate rolling circle amplification to synthesize a DNA strand with a long repetitive sequence. Select a repetitive sequence of this amplification product as the recognition unit, design an NH 2 modified signal probe (NH 2 -DNA), and couple it with urease to obtain a urease-modified signal probe (Urease-DNA).

[0081] As the rolling circle amplification reaction continuously generates amplification products, the repetitive sequence recognition units in the amplification products base-pair with Urease-DNA, enabling Urease-DNA to bind to the amplification products. Since the 5' end of the amplification products initiated by BP still has biotin modification, streptavidin-modified magnetic microspheres (SA-MB) can be used to magnetically separate the rolling circle amplification products and Urease-DNA complementary substances from the solution. Adding a mixture of urea, the substrate of urease, and phenol red indicator to it triggers the reaction of urease catalyzing urea to produce NH 3 and causes the pH value of the solution to increase, resulting in the color of the phenol red indicator turning red.

[0082] When there is no FEN1 or the activity of FEN1 is inhibited by an inhibitor in the system, FDP cannot be cleaved to produce a nicked dumbbell-shaped probe, thus CDP cannot be generated. FDP is not circular, so it cannot undergo rolling circle amplification to produce DNA strands with repetitive sequences, resulting in Urease-DNA remaining free in the solution. SA-MB can only separate BP from the system and cannot capture Urease-DNA simultaneously, thus failing to trigger the subsequent reaction of urease catalyzing urea, and the color of the phenol red indicator does not change. By visually observing the color change of the solution (from yellow to pink), the activity of FEN1 in the system can be judged, and by measuring the absorbance A 443 and A 570 at 443 nm and 570 nm of the solution and calculating A 570 / A 443 , the activity of FEN1 can be accurately quantified.

[0083] The kit has high sensitivity, is easy to operate, requires no additional instrument equipment, has low cost, the results can be visually observed, and can be used for screening candidate drugs for FEN1 inhibitors. After primary screening to narrow the range of inhibitor candidates, it can significantly improve the drug discovery efficiency and has great application potential in the discovery of FEN1 inhibitor anti-tumor drugs.

[0084] The kit of this example can be applied to the screening of candidate anti-tumor drugs for FEN1 inhibitors.

[0085] Examples of the present invention are as follows:

[0086] Example 1

[0087] In a specific implementation, the kit includes: a dumbbell-shaped DNA probe (FDP) with a flap structure, enzymes (T4 DNA ligase and phi 29 DNA polymerase), a rolling circle amplification reaction solution (dNTP, ThermoPol buffer solution, T4 DNA ligase buffer solution, and phi 29 DNA polymerase buffer solution), a biotin-modified primer (BP), a urease-modified signal probe (Urease-DNA, obtained by coupling urease with an amino-modified DNA probe), streptavidin-modified magnetic microspheres (SA-MB) with a particle size of 1.5 μm, a washing solution (10 mmol / L Tris-HCl, 3 mol / L NaCl, 1 mmol / L MgCl 2 and 0.01% Tween 20, pH 7.5), a blocking solution (washing solution and 5% non-fat milk powder, pH 7.5), an acetic acid solution (0.1 mmol / L, pH 6.0), a urease substrate solution (3 mol / L NaCl, 60 mmol / L MgCl 2 2, 50 mmol / L urea, and 1 mmol / L HCl, pH 6.0), a 0.04% phenol red solution, and a standard product (FEN1).

[0088] 1. Materials and Methods

[0089] 1.1. Primers and Probes

[0090] The sequences of FDP, BP, and the amino-modified signal probe (NH 2 -DNA) in this kit are as follows:

[0091] Flapped dumbbell DNA probe (FDP): TTAACGACCATAGCTGCCCTATAGTGAGTCGTATTACAGCTATGGTTGCC GTCAGAATCTACACTTAGTAGAAATTATCTGACGGCAA;

[0092] Biotin-DNA primer (BP): Biotin-TAATACGACTC;

[0093] NH 2 -DNA: AmMC6T-TTTTTTTGACGGCAACCATAGCTGCCCTATAGTGA.

[0094] 1.2. Preparation of Urease-Modified Signal Probe (Coupling of Enzyme and Nucleic Acid)

[0095] (1) NH 2-DNA Activation: Weigh 2 mg (6.4 μmol) of N-hydroxysuccinimide ester of 3-maleimidobenzoic acid (MBS) powder and dissolve it in 1 mL of dimethyl sulfoxide (DMSO) solution to obtain a 6.4 mmol / L MBS solution. Add 3.2 μL of the 6.4 mol / L MBS solution to 1 nmol NH 2 -DNA, and add 1×PBS solution to make it up to 100 μL, then place it at room temperature for 2 h to activate NH 2 -DNA.

[0096] (2) Ultrafiltration Concentration and Purification of Activated NH 2 -DNA: Use an ultrafiltration tube with a molecular weight cut-off of 3 KD (NANOSEP OMEGA, Pall Incorporation) to ultrafilter and concentrate the activated NH2-DNA solution in the previous step, remove the excess MBS in the solution, wash it three times with 50 μL of 1×PBS solution, and then resuspend it with 100 μL of 1×PBS solution to obtain purified activated NH 2 -DNA.

[0097] (3) Coupling of Activated NH 2 -DNA with Urease: Weigh 1.5 mg (3.3 nmol) of urease powder and dissolve it in 1 mL of 1×PBS solution to obtain a urease solution. Add the NH 2 -DNA solution in the previous step to the urease solution and place it at room temperature for 1 h to couple urease and activated NH 2 -DNA. Use an ultrafiltration tube with a molecular weight cut-off of 300 KD (NANOSEP OMEGA, Pall Incorporation) to ultrafilter and concentrate the above solution, remove the uncoupled NH 2 -DNA in the solution, wash it three times with 50 μL of 1×PBS solution, and then resuspend it with 100 μL of 1×PBS solution to obtain purified NH 2 -DNA and urease-modified signal probe (Urease-DNA) coupled with urease.

[0098] (4) Calculation of Urease-DNA Concentration:

[0099] The concentration of the Urease-DNA conjugate is calculated according to the following formula:

[0100] A 260UrD = A 260urease + A 260DNA (1)

[0101] A 280UrD = A 280urease + A 280DNA (2)

[0102] A 260DNA / A 280DNA = α (3)

[0103] A 260urease / A 280urease = β (4)

[0104] Substituting equations (3) and (4) into (1) and (2) respectively, we get:

[0105] A 260UrD =βA 280urease + A 260DNA (5)

[0106] A 280UrD = A 280urease + (A 260DNA × 1 / α) (6)

[0107] Substituting equation (5) into (6), we get:

[0108] A 260DNA = (αA 260UrD - αβA 280UrD ) / (α-β) (7)

[0109] A 280urease = (αA 280UrD - A 260UrD ) / (α-β) (8)

[0110] Use Nanodrop 2000 / 2000c to measure the absorbance A at 260 nm and 280 nm of NH 2 -DNA, urease solution and Urease-DNA solution 260DNA , A 280DNA , A 260urease , A 280urease , A 260UrD and A 280UrD . Among them, α = 1.72, β = 0.72, A 260UrD = 0.082, A 280UrD = 0.082. Substituting them into (7) and (8), we get:

[0111] A 260DNA =(1.72×0.082 - 1.72×0.72×0.082) / (1.72 - 0.72)=0.02296

[0112] A 280urease =(1.72×0.082 - 0.082) / (1.72 - 0.72)=0.05904

[0113] According to Lambert-Beers-Law: c = A / (ε×L), we get

[0114] c DNA = A 260DNA / (ε DNA ×L) (9)

[0115] c urease = A 280urease / (ε urease ×L) (10)

[0116] According to OligoAnalyzer 3.1 (http: / / www.idtdna.com / calc / analyzer), for NH 2 -DNA, ε = 329600 M -1 ·cm -1 ; while for urease, ε = 54780 M -1 ·cm -1 . When using Nanodrop 2000 / 2000c, L = 0.1 cm. Substituting the above values into formulas (9) and (10), we get:

[0117] c DNA =0.02296 / (329600 M -1 ·cm -1 ×0.1 cm) = 1.2 μmol / L

[0118] c urease =0.05904 / (54780 M -1 ·cm -1 ×0.1 cm) = 10.78 μmol / L

[0119] According to the above calculations, 1.2 μmol / L of DNA in Urease-DNA is equivalent to approximately 10.78 μmol / L of urease monomers. Since urease exists in the form of hexamers, the DNA / urease ratio is 0.67.

[0120] 1.3. Optimization of experimental conditions

[0121] According to the experimental requirements, experimental conditions such as the sequences of BP primers and Urease-DNA probes, the concentration of FDP probes, the concentration of BP primers, the FEN1 cleavage reaction time, the amount of T4 DNA ligase, the T4 DNA ligation time, the amount of phi 29 DNA polymerase, the RCA amplification time, the dNTP concentration, etc. in the experiment are optimized to establish the best detection method. Through the signal-to-noise ratio, i.e., (A 570 / A 443 sample) / (A 570 / A443 (negative control) to evaluate each experimental parameter, and take the maximum signal-to-noise ratio as the optimal experimental condition.

[0122] 1.4. Determination of FEN1 standard

[0123] Dilute the FEN1 standard solution to different concentrations, namely 0.05 U / mL, 0.1 U / mL, 1 U / mL, 5 U / mL, 10 U / mL, 100 U / mL, 500 U / mL, 1000 U / mL, 5000 U / mL, and 10000 U / mL, and detect with this kit. Take the logarithm of the FEN1 concentration as the abscissa and A 570 / A 443 as the ordinate to plot the standard curve.

[0124] 1.5. ATA inhibits FEN1 activity experiment

[0125] Dilute the ATA standard solution to different concentrations, namely 0.2 μmol / L, 1 μmol / L, 2 μmol / L, 6 μmol / L, 8 μmol / L, 10 μmol / L, 12 μmol / L, 14 μmol / L, 16 μmol / L, 18 μmol / L, 20 μmol / L, 30 μmol / L, and 40 μmol / L. Take 4 μL of ATA standard at different concentrations and mix it with 4 μL of 500 U / ml FEN1 standard. Use the mixture of 4 μL of DEPC-treated water and 4 μL of 500 U / ml FEN1 standard as the negative control group, and add them to the detection system of this kit for FEN1 activity detection. Take the ATA concentration as the abscissa and the relative activity of FEN1 in different ATA concentration groups compared to the negative control group as the ordinate to plot the inhibition fitting curve and calculate the IC of ATA on FEN1 50 .

[0126] 2. FEN1 activity detection

[0127] 2.1. Reaction system and reaction conditions for highly sensitive visualization detection of FEN1 activity

[0128] The reaction volume for FEN1 to cleave the flap structure is 20 μL, including 4 μL of FEN1 standard or sample to be tested, 2 μL of 500 nmol / L FDP, 2 μL of 10× ThermoPol buffer solution, and 12 μL of DEPC-treated water. After pipetting and mixing evenly, heat in a water bath at 37 °C for 1 h.

[0129] Subsequently, add 20 μL of T4 DNA ligation reaction solution (containing 2 μL of 10× T4 DNA ligase buffer solution, 60 U of T4 DNA ligase, and DEPC-treated water), pipette and mix evenly, and then heat in a water bath at 37 °C for 45 min.

[0130] Then, 10 μL of RCA amplification reaction solution (containing 1 μL of 10×phi 29 DNA polymerase buffer solution, 1 μL of 10 mmol / L dNTP, 5 U of phi 29 DNA polymerase, 2 μL of BP, 2 μL of Urease-DNA and DEPC-treated water) was added thereto. After pipetting and mixing evenly, it was heated in a water bath at 37 °C for 1 h. Meanwhile, 100 μL of blocking solution was added to 15 μL of 5 mg / mL SA-MB, and after incubating in a water bath at 37 °C for 1 h, the centrifuge tube was placed on a magnetic rack and left standing until all the magnetic beads were adsorbed to the tube wall, and then the supernatant solution was aspirated and discarded.

[0131] The FEN1 reaction solution and 50 μL of blocking solution were added to the blocked MB, and after incubating in a water bath at a constant temperature for 15 min, the supernatant was also removed by magnetic separation, and then washed three times with 100 μL of washing solution to remove non-specific binding substances on the surface of the MB.

[0132] Finally, the MB was resuspended with 60 μL of 0.1 mM acetic acid solution at pH 6.0, 20 μL of 0.04% phenol red solution and 100 μL of urease substrate solution were added, and after reacting at room temperature for 1 h, the supernatant was aspirated by magnetic separation and the color change (from yellow to pink) was observed with the naked eye, and A 443 and A 570 were measured, and A 570 / A 443 .

[0133] 2.2. Establishment of FEN1 activity detection standard curve

[0134] The FEN1 standard product solution was diluted to different concentrations, namely 0.05 U / mL, 0.1 U / mL, 1 U / mL, 5 U / mL, 10 U / mL, 100 U / mL, 500 U / mL, 1000 U / mL, 5000 U / mL and 10000 U / mL. The group without adding FEN1 was used as the negative control group, and the FEN1 activity was detected with this kit. The logarithm of the FEN1 concentration was used as the abscissa, and A 570 / A 443 was used as the ordinate to draw the standard curve.

[0135] As Figure 2 shown, when the FEN1 concentration was in the range of 0.05 U / mL to 5000 U / mL ( Figure 2 a), the standard curve had a good linearity (R 2 = 0.9850), and the lowest concentration visually observed was 5 U / mL ( Figure 2 b). The established FEN1 activity detection method could determine A 570 / A 443Value to achieve the quantitative detection of FEN1 activity. (When there is no FEN1 in the solution, the solution appears yellow, while when the FEN1 concentration is greater than 5 U / mL, the color of the solution gradually deepens. The higher the concentration, the more obvious the pink color. As can be seen in Figure 2 at 5 U / mL, the color has already deepened.)

[0136] 2.3. Selectivity experiment

[0137] The method established in the present invention is used to detect the activity of FEN1 as the target. Therefore, the experiment selectively investigated the interference of other common restriction endonucleases HindIII, ExoIII, Lambda Exo, ExoI, T 4 PNK, TdT, and human serum albumin (HSA) on the detection of FEN1 activity by this method.

[0138] When there are 4 μL of 100 U / mL in the system and when there is no FEN1, 4 μL of 100 U / mL of the above restriction endonucleases or 1 μL of 1 mg / mL of human serum albumin are added to the system, and the reaction buffer solution system (without the above interference factors) is used as the negative control group. The selectivity of this method is analyzed by the A 570 / A 443 value, and each sample is detected in parallel for 3 times.

[0139] The results are as shown in Figure 3 a. The A 570 / A 443 value of the sample containing FEN1 is about 2, while the A 570 / A 443 values of the samples without FEN1 are all less than 0.3, and the activity of FEN1 in the system can be judged by visual observation ( Figure 3 b). It shows that the established method can effectively distinguish FEN1 from other common restriction endonucleases HindIII, ExoIII, Lambda Exo, ExoI, T 4 PNK, TdT, and the results of the serum albumin group also show that this method has strong anti-matrix interference ability.

[0140] 3. ATA inhibits FEN1 activity experiment

[0141] The feasibility of screening FEN1 inhibitors using this kit was investigated by inhibition experiments with ATA. The ATA standard solution was diluted to different concentrations, namely 0.2 μmol / L, 1 μmol / L, 2 μmol / L, 6 μmol / L, 8 μmol / L, 10 μmol / L, 12 μmol / L, 14 μmol / L, 16 μmol / L, 18 μmol / L, 20 μmol / L, 30 μmol / L, and 40 μmol / L. 4 μL of ATA standard solutions at different concentrations were mixed with 4 μL of 500 U / ml FEN1 standard. A mixture of 4 μL of DEPC-treated water and 4 μL of 500 U / ml FEN1 standard was used as the negative control group. They were respectively added to the detection system of this kit for FEN1 activity detection. With the ATA concentration as the abscissa and the percentage of FEN1 activity in different ATA concentration groups relative to the FEN1 activity in the negative control group as the ordinate, an inhibition fitting curve was plotted.

[0142] In the presence of the inhibitor ATA, as the ATA concentration increased, the color of the final reaction solution gradually faded ( Figure 4 b), indicating that ATA blocked a series of reaction chains of cleavage-induced DNA ligation and the subsequent nucleic acid amplification and enzyme-catalyzed chromogenic reaction by inhibiting FEN1 activity.

[0143] As Figure 4 shown in 50 a, as the ATA concentration increased from 0 to 40 μmol / L, the activity of FEN1 relative to that without inhibitor decreased in a concentration-dependent manner. The half-inhibitory concentration (IC

[0144] 4. Detection of serum samples with different concentrations of FEN1

[0145] FEN1 was added to blank serum samples to prepare samples containing low concentration of 0.5 U / mL, medium concentration of 10 U / mL, and high concentration of 500 U / mL. Blank serum samples without FEN1 were used as negative controls. The A 570 / A 443 values of FEN1 samples at each concentration were measured in triplicate, and the measured FEN1 activity of the samples was calculated by substituting into the standard curve.

[0146] After testing, the precisions of this kit detection method at low, medium, and high concentrations were 2.17%, 0.84%, and 4.96% respectively, and the accuracies were 116.1%, 106.8%, and 101.6% respectively. The results showed that this kit had good precision and accuracy and could be used as a kit for FEN1 activity detection.

[0147] As can be seen from the implementation, the kit of the present invention has high sensitivity, is easy to operate, does not require additional instrument equipment, has low cost, and the results can be observed with the naked eye. It can be used for the screening of FEN1 inhibitor candidate drugs, narrowing the range of inhibitor candidates through primary screening, significantly improving the drug discovery efficiency, and having great application potential in the discovery of FEN1 inhibitor anti-tumor drugs.

[0148] The above specific implementation manners are used to explain and illustrate the present invention, rather than limiting the present invention. Any modifications and changes made within the spirit and scope of the claims of the present invention fall within the protection scope of the present invention.

[0149] The above is only the preferred implementation manner of the present invention. Therefore, any equivalent changes or modifications made according to the structure, characteristics and principles described in the scope of the present invention patent application are included in the scope of the present invention patent application.

[0150] The gene sequences designed by the present invention are as follows:

[0151] SEQ ID No.1;

[0152] Name: DNA sequence of dumbbell-shaped DNA probe with flap structure

[0153] DNA type: other DNA

[0154] Organism source: artificial sequence (Artificial Sequence) / synthetic construct

[0155] TTAACGACCATAGCTGCCCTATAGTGAGTCGTATTACAGCTATGGTT GCCGTCAGAATCTACACTTAGTAGAAATTATCTGACGGCAA

[0156] SEQ ID No.2;

[0157] Name: DNA sequence of amino-modified signal probe

[0158] DNA type: other DNA

[0159] Organism source: artificial sequence (Artificial Sequence) / synthetic construct

[0160] TTTTTTTGACGGCAACCATAGCTGCCCTATAGTGA

[0161] SEQ ID No.3;

[0162] Title: DNA Sequence of Biotinylated Primer

[0163] DNA Type: other DNA

[0164] Organism Source: Artificial Sequence / synthetic construct TAATACGACTC

Claims

1. A highly sensitive visual detection kit for FEN1 activity, characterized in that: The kit includes a DNA probe, an enzyme, a rolling circle amplification reaction solution, a biotin-modified primer, a signal probe, a streptavidin-modified magnetic microsphere, a blocking solution, a washing solution, an acetic acid solution, a urease substrate solution, a phenol red solution and a FEN1 standard; The DNA probe adopts a dumbbell-shaped DNA probe FDP with a flap structure; The signal probe is a urease-modified signal probe Urease-DNA, which is a conjugate of an amino-modified signal probe and urease.

2. A highly sensitive visual detection kit for FEN1 activity according to claim 1, characterized in that: The gene sequence of the dumbbell-shaped DNA probe with flap structure is SEQ ID No. 1, namely, TTAACGACCATAGCTGCCCTATAGTGAGTCGTATTACAGCTATGGTTGC CGTCAGAATCTACACTTAGTAGAAATTATCTGACGGCAA; The gene sequence of the amino-modified signal probe is SEQ ID No. 2, i.e., AmMC6T-TTTTTT TGACGGCAACCATAGCTGCCCTATAGTGA, where AmMC6T represents an amino group; The gene sequence of the biotin-modified primer is SEQ ID No. 3, namely Biotin-TAATACGA CTC, where Biotin represents biotin.

3. A highly sensitive visual detection kit for FEN1 activity according to claim 1, characterized in that: The rolling circle amplification reaction solution is a mixture of 1 mmol / L deoxyribonucleotide triphosphate, 1×Therm oPol buffer solution, 1×T4 DNA ligase buffer solution and 1×phi 29 DNA polymerase buffer solution; The enzymes are T4 DNA ligase and phi 29 DNA polymerase; The streptavidin-modified magnetic microspheres are formed by modifying the surface of the magnetic microspheres with streptavidin, and the particle size is 1.5 μm.

4. A highly sensitive visual detection kit for FEN1 activity according to claim 1, characterized in that: The blocking solution is a mixture of a washing solution with a pH of 7.5 and skimmed milk powder with a mass concentration of 5%; The washing solution is a mixed solution mainly composed of 10mmol / L tris(hydroxymethyl)aminomethane hydrochloride, 3mol / L sodium chloride, 1mmol / L magnesium chloride and 0.01% Tween 20, with a pH of 7.5; The acetic acid solution has a concentration of 0.1 mmol / L and a pH of 6.0; The urease substrate solution is a mixed solution with a pH of 6.0, which is mainly composed of 3 mol / L NaCl, 60 mmol / L MgCl2, 50 mmol / L urea and 1 mmol / L HCl; The mass concentration of the phenol red solution is 0.04%.

5. A highly sensitive visual detection kit for FEN1 activity according to claim 1, characterized in that: The urease modified signal probe is prepared in the following manner: (1) NH2-DNA activation: Weigh 3-maleimidobenzoic acid succinimidyl ester MBS powder and dissolve it in dimethyl sulfoxide DMSO solution to obtain MBS solution, then add amino-modified signal probe NH2-DNA to the above MBS solution, and add 1×PBS solution to 100 μL, and place it at room temperature to activate the amino-modified signal probe NH2-DNA to obtain an activated NH2-DNA solution; (2) Ultrafiltration and concentration to purify activated NH2-DNA: Use an ultrafiltration tube to ultrafiltration and concentrate the activated NH2-DNA solution in the previous step to remove excess 3-maleimidobenzoic acid succinimidyl ester MBS in the solution, wash it three times with 1×PBS solution, and then resuspend it with 1×PBS solution to obtain a purified activated NH2-DNA solution; (3) Coupling of the purified activated NH2-DNA with urease: Weigh urease powder and dissolve it in 1×PBS solution to obtain a urease solution. Add the purified activated NH2-DNA solution obtained in the previous step to the urease solution and place it at room temperature to allow the urease and activated NH2-DNA to react by coupling. (4) The solution after the coupling reaction is then concentrated by ultrafiltration using an ultrafiltration tube to remove the amino-modified signal probe NH2-DNA that is not coupled to urease in the solution, and then washed three times with 1×PBS solution and resuspended with 1×PBS solution to obtain purified NH2-DNA and urease-coupled urease-modified signal probe Urease-DNA.

6. Use of the highly sensitive visual detection kit according to any one of claims 1 to 5, characterized in that: Including applications in FEN1 activity detection and concentration detection, and applications in screening FEN1 candidate anti-tumor drugs.

7. A method for detecting FEN1 using the highly sensitive visual detection kit according to any one of claims 1 to 5, characterized in that: The method is specifically as follows: S1. First, a FEN1 standard of known concentration is diluted in a gradient manner to prepare solutions with concentrations of 0.05U / ml to 5000U / ml to obtain a series of gradient solutions of the FEN1 standard. Then, the series of gradient solutions of the FEN1 standard and the aqueous solution without FEN1 are used as test solutions and treated with the highly sensitive visual detection kit to perform the reaction process of FEN1 cutting-DNA ligation-RCA amplification-urease catalytic reaction chain. After the reaction is completed, the absorbance ratio parameter of the reaction solution is measured, and then a relationship working curve is established according to the relationship between different concentrations of the series of gradient solutions of the FEN1 standard and their corresponding absorbance ratio parameters; S2. For the FEN1 solution to be tested, the FEN1 solution to be tested is used as the test solution and treated with the high-sensitivity visual detection kit to carry out the reaction process of FEN1 cutting-DNA ligation-RCA amplification-urease catalytic reaction chain. After the reaction is completed, the absorbance ratio parameter of the reaction solution is measured, and the absorbance ratio parameter is substituted into the relationship working curve for judgment to obtain the activity detection result and the concentration detection result.

8. A method for using the highly sensitive visual detection kit for candidate FEN1 anti-tumor drugs according to any one of claims 1 to 5, characterized in that: The method is specifically as follows: L1. Prepare FEN1 standard solution; L2. A series of drug solutions with different drug concentrations are prepared by gradient dilution of a drug standard of known concentration, and a series of drug solutions with different drug concentrations are added to the FEN1 standard solution of step 1) to obtain a series of drug and FEN1 mixed solutions with different concentrations. A series of drug and FEN1 mixed solutions with different concentrations and a FEN1 standard solution without the drug to be tested are used as test solutions and are treated with the highly sensitive visualization detection kit to carry out the reaction process of FEN1 cutting-DNA ligation-RCA amplification-urease catalytic reaction chain. After the reaction is completed, the absorbance ratio parameter of the reaction solution is measured and judged: If the absorbance ratio parameters corresponding to a series of drug-FEN1 mixed solutions are all smaller than the absorbance ratio parameters corresponding to the FEN1 standard solution without the drug to be tested, then the current drug to be tested is a FEN1 inhibitor, and is used as a candidate anti-tumor drug; Then, the FEN1 inhibition fitting curve was established based on the relationship between different drug concentrations of a series of drug-FEN1 mixed solutions and their corresponding absorbance ratio parameters, and the half-inhibitory concentration IC was calculated. 50 , the inhibitory effects of different drugs were compared by half-inhibitory concentration.

9. The method for detecting FEN1 using the highly sensitive visual detection kit according to claim 7 or 8, characterized in that: The reaction process of the FEN1 cutting-DNA ligation-RCA amplification-urease catalysis reaction chain is specifically as follows: 1) Add the test solution to a mixed solution consisting of a dumbbell-shaped DNA probe FDP with a flap structure, 10×ThermoPol buffer solution and DEPC-treated water, mix by pipetting and heat in a 37°C water bath for a period of time; 2) Then, a T4 DNA ligation reaction solution containing 10×T4 DNA ligase buffer solution, T4 DNA ligase and DEPC-treated water was added thereto, and the mixture was mixed by pipetting and heated in a water bath at 37° C. for a period of time; 3) Then, RCA amplification reaction solution was added thereto, wherein the RCA amplification reaction solution contained 10×phi 29 DNA polymerase buffer solution, deoxyribonucleotide triphosphate dNTP, phi 29 DNA polymerase, biotin-modified primer BP, urease-modified signal probe Urease-DNA and DEPC-treated water, and after being blown and mixed, it was heated in a water bath for a period of time to obtain a FEN1 sample solution; 4) Add blocking solution to the streptavidin-modified magnetic microsphere solution SA-MB and place it in a centrifuge tube. Then, place the centrifuge tube in a 37°C water bath and incubate it at constant temperature for a period of time. Then, place the centrifuge tube on a magnetic rack and let it stand until all the magnetic beads are adsorbed to the tube wall. Then, remove the supernatant solution and obtain the blocked MB solution. 5) Add the FEN1 sample solution and blocking solution obtained in step 3) to the blocked SA-MB solution, incubate in a water bath at a constant temperature for a period of time, discard the supernatant by magnetic separation, and wash three times with washing solution; 6) Finally, SA-MB is resuspended with acetic acid solution, and then phenol red solution and urease substrate solution are added to react at room temperature for a period of time, and then the supernatant is magnetically separated and taken as the reaction solution.

Images