High-yield AAV target gene vector and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and discloses a target gene vector with high AAV yield and application. A recombinant sequence is inserted into a skeleton plasmid of the target gene vector of the high-yield AAV, and the recombinant sequence comprises a 5 'ITR sequence of the AAV, a target gene sequence, a 3' ITR sequence of the AAV, at least one promoter sequence, an Intron sequence and a cap sequence. The target gene vector with high AAV yield can significantly improve the AAV yield of single cells. The invention provides a new method for producing the adeno-associated virus, and the production cost of the rAAV can be reduced.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and particularly relates to a target gene vector with high yield of AAV and its application. Background Art

[0002] Adeno-associated virus (AAV) has many advantages, making it a favored gene therapy delivery vector. First, the replication of AAV requires the participation of a helper virus, so it is considered to be non-pathogenic. Second, after AAV enters the cell, its genome wrapped by the ITR structure can circularize to form an episomal structure, reducing the probability of recombination with the genome and thus reducing genomic toxicity. In addition, AAV has 12 different serotypes and hundreds of variants derived therefrom, greatly expanding its application scope.

[0003] rAAV-based vectors can target both dividing and non-dividing cells, including the retina, liver, heart, muscle, and central nervous system (CNS), to achieve long-term expression of therapeutic genes. To date, more than 200 clinical trials have been conducted for the treatment of various diseases, such as hemophilia A and B, Parkinson's disease, wet age-related macular degeneration, mucopolysaccharidosis (MPS), Batten disease, etc. Although rAAV-based gene therapy has been successful in clinical trials, due to low yields and high-dose requirements for certain disease indications, high manufacturing costs remain a bottleneck in the field of gene therapy, thus limiting patients' access to these promising products. This, in turn, has increased the demand for reducing the production cost of AAV and establishing a flexible and GMP-compliant AAV production system.

[0004] However, the yield bottleneck of AAV needs to be broken urgently. Transient transfection of human embryonic kidney (HEK) 293 cells with plasmids is a common strategy for the preparation of adeno-associated virus (AAV) vectors, which has the main advantages of short production cycle, easy operation, and strong flexibility. The three-plasmid transfection method is the most commonly used method for rAAV production. This method uses three plasmids to co-transfect HEK293 cells: an auxiliary plasmid pADhelper, which provides adenovirus E2A, E4, and VA RNA elements; an auxiliary plasmid pRC, which provides the Rep and Cap protein coding sequences of AAV. The Rep protein is responsible for the replication of the AAV genome and assisting in the assembly of AAV genome particles, and the Cap protein forms the AAV capsid; a plasmid including the target sequence, which can be abbreviated as pGOI. There is a 5' ITR and a 3' ITR sequence from the natural AAV genome upstream and downstream of the target sequence respectively. Grimm D and Tang Q et al. combined the packaging plasmid and the auxiliary plasmid in the three plasmids into one plasmid, that is, the AAV rep / cap and Ad helper genes were combined in a single auxiliary plasmid pDG, and only two plasmids were needed for AAV preparation.

[0005] Therefore, improving and innovating in the upper reaches of production to increase the AAV yield is one of the key points to reduce the current production cost of gene therapy. Summary of the Invention

[0006] The object of the present invention is to overcome the deficiencies of the prior art and provide a target gene vector for high-yield AAV and its application.

[0007] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] In the first aspect, the present invention provides a target gene vector for high-yield AAV, in which a recombinant sequence is inserted into the backbone plasmid, and the recombinant sequence includes the 5' ITR sequence of AAV, the target gene sequence, the 3' ITR sequence of AAV, at least one promoter sequence, an Intron sequence, and a cap sequence.

[0009] As a preferred embodiment of the target gene vector for high-yield AAV of the present invention, the recombinant sequence sequentially includes any one of the following sequences from 5' to 3':

[0010] i. The 5' ITR sequence of AAV, the target gene sequence, the 3' ITR sequence of AAV, a promoter sequence, and a cap sequence;

[0011] ii. The 5' ITR sequence of AAV, the target gene sequence, the 3' ITR sequence of AAV, a promoter sequence, an Intron sequence, and a cap sequence;

[0012] iii. The 5' ITR sequence of AAV, the target gene sequence, the 3' ITR sequence of AAV, a first promoter sequence, a second promoter sequence, an Intron sequence, and a cap sequence.

[0013] As a preferred embodiment of the target gene vector for high-yield AAV of the present invention, the promoter sequence includes a CMV promoter and / or a P40 promoter.

[0014] In the second aspect, the present invention provides a plasmid group for high-yield AAV, including an auxiliary plasmid, a packaging plasmid, and the target gene vector for high-yield AAV; or including a packaging auxiliary plasmid and the target gene vector for high-yield AAV.

[0015] In the third aspect, the present invention provides a reagent for high-yield AAV, including the plasmid group for high-yield AAV.

[0016] In the fourth aspect, the present invention provides a cell for high-yield AAV, including the plasmid group for high-yield AAV.

[0017] As a preferred embodiment of the cell for producing high-yield AAV of the present invention, the cell includes at least one of HeLa, HEK293, and insect Sf9 cells.

[0018] In a fifth aspect, the present invention provides a kit for producing high-yield AAV, including the reagent or the cell described above.

[0019] In a sixth aspect, the present invention provides a method for producing high-yield AAV, which comprises transforming the plasmid group into a host cell and then culturing the host cell; or culturing the cell described above.

[0020] In a seventh aspect, the present invention applies the target gene vector for producing high-yield AAV, the plasmid group, the reagent, the cell, and the kit in the production of recombinant adeno-associated virus.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] The present invention proposes a new target gene vector for producing high-yield AAV, which has the effect of increasing the rAAV virus yield when adding one copy of the cap sequence to the target gene vector, and can significantly improve the AAV yield of single cells. It provides a new method for the production of adeno-associated virus and can reduce the production cost of rAAV. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is a schematic diagram of the design of the target gene vector in the examples.

[0024] Figure 2 It is a schematic diagram of the structural elements of the plasmid backbone in the examples.

[0025] Figure 3 It shows the comparison results of the virus titers in the lysates of each group of vectors (triple plasmid system) detected in the examples with the control vector.

[0026] Figure 4 It shows the comparison results of the virus titers in the lysates of each group of vectors (double plasmid system) detected in the examples with the control vector. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0027] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0028] Unless otherwise specified, the test methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial channels.

[0029] Example 1: Construction of the target gene plasmid

[0030] By designing combinations of different placement positions of the CMV promoter and p40 promoter sequences, different plasmids of target genes were constructed by conventional molecular cloning methods, and then the yields of each plasmid of target gene in the transfection system were compared in parallel.

[0031] Among them, the plasmid backbone (as Figure 2 shown) has the sequence as shown in SEQ ID No.1; the CMV promoter sequence is as shown in SEQ ID No.2; the p40 promoter sequence is as shown in SEQ ID No.3; the CMV-p40 promoter sequence is as shown in SEQ ID No.4; the intron sequence is as shown in SEQ ID No.5; the cap is from adeno-associated virus type 9, and its sequence is as shown in SEQ ID No.6. The 5' ITR sequence is as shown in SEQ ID No.7; the target gene sequence is as shown in SEQ ID No.8; the 3' ITR sequence is as shown in SEQ ID No.9;

[0032] By designing combinations of different placement positions of the CMV promoter and p40 promoter, different candidate vectors of target genes were constructed by conventional molecular cloning methods based on the backbone vector sequence (SEQ ID No.1), CMV promoter sequence (SEQ ID No.2), p40 promoter sequence (SEQ ID No.3), CMV-p40 promoter sequence (SEQ ID No.4), intron sequence (SEQ ID No.5), Cap gene sequence (SEQ ID No.6), 5' ITR sequence (SEQ ID No.7), target gene sequence (SEQ ID No.8), 3' ITR sequence (SEQ ID No.9) (as Figure 1 shown). Then, AAV packaging was carried out by co-transfecting different plasmids of target genes with helper plasmids and packaging plasmids or by co-transfecting different plasmids of target genes with packaging helper plasmids, and then the virus-producing titers of each helper vector in the three-plasmid transfection system and the two-plasmid transfection system were compared in parallel.

[0033] The specific steps for plasmid construction are as follows:

[0034] (1) Using the plasmid containing the cap gene as a template, the cap gene sequence, p40 promoter sequence, and intron sequence were amplified. The CMV promoter was amplified using the plasmid containing the CMV promoter as a template. The 5' ITR-EGFP-3' ITR sequence was obtained by enzymatic digestion using the plasmid containing the 5' ITR-EGFP-3' ITR sequence as a template.

[0035] The PCR reaction system is shown in Table 1:

[0036] Table 1 PCR reaction system

[0037] Reaction components Volume (μL) 5×Q5 Reaction Buffer 10 10 mM dNTPs 1 Q5 Hot Start High-Fidelity DNA Polymerase 0.5 Forward primer 2.5 Reverse primer 2.5 Plasmid template 1 Deionized water 32.5

[0038] The primers used for plasmid B are as follows:

[0039] Forward primer 1: cgcctgtcttcgggtttggtcaccaagcaggaagtca;

[0040] Reverse primer 1: gcaggacatgtggtcttccttaacaacgtcgtgactgggaaa;

[0041] Forward primer 2: caggcgcctaagcttgggagttccgtcg;

[0042] Reverse primer 2: atgaaaacgtccgctgggaa;

[0043] Forward primer 3: atcgataagcttgggagttcc;

[0044] Reverse primer 3: acctgatttaaatgcgatctgacggttcactaaac.

[0045] The primers used for plasmid C are as follows:

[0046] Forward primer 1: cgcctgtcttcgggtttggtcaccaagcaggaagtca;

[0047] Reverse primer 1: gcaggacatgtggtcttccttaacaacgtcgtgactgggaaa.

[0048] The primers used for plasmid D are as follows:

[0049] Forward primer 1: cgcctgtcttcgggtttggtcaccaagcaggaagtca;

[0050] Reverse primer 1: gcaggacatgtggtcttccttaacaacgtcgtgactgggaaa;

[0051] Forward primer 2: caggcgcctaagcttgggagttccgtcg;

[0052] Reverse primer 2: atgaaaacgtccgctgggaa.

[0053] The primers used for plasmid E are as follows:

[0054] Forward primer 1: cgcctgtcttcgggtttggtcaccaagcaggaagtca;

[0055] Reverse primer 1: gcaggacatgtggtcttccttaacaacgtcgtgactgggaaa;

[0056] Forward primer 2: gggcgccatcgataagcttgggagttcc;

[0057] Reverse primer 2: cgggtctcgcgatctgacggttcactaaac;

[0058] Forward primer 3: cggtctcgatcgcggtcaccaagcaggaagtca;

[0059] Reverse primer 3: ggggtacctgtctgcgtagttg.

[0060] The PCR reaction conditions are shown in Table 2:

[0061] Table 2 PCR reaction conditions

[0062]

[0063] The digestion reaction system is shown in Table 3:

[0064] Table 3 Reaction system

[0065] Reaction components Volume (μL) 10×FastDigest Green buffer 5 FastDigest enzyme 1 DNA 2 μg Nuclease-free Water to 50 μL

[0066] The reaction condition is 37 °C for 1 h.

[0067] (2) Detect the bands amplified by PCR and the digested bands by agarose gel electrophoresis, and use a gel extraction kit to recover the target fragment.

[0068] Use a seamless cloning kit for multi-fragment ligation.

[0069] The seamless cloning reaction system is shown in Table 4:

[0070] Table 4 Reaction system

[0071] Reaction components Volume (μL) 2×Assembly Mix 5 Linearized vector 1 Inserts n Nuclease-free Water to 10

[0072] The reaction condition is 50 °C for 1 h.

[0073] Use T4 ligase to ligate the recovered fragments.

[0074] The T4 ligation reaction system is shown in Table 5:

[0075] Table 5 Reaction system

[0076] Reaction components Volume (μL) T4 DNA Ligase Buffer (10×) 1 Vector DNA 25 ng Insert DNA 75 ng T4 DNA Ligase 1 Nuclease-free Water to 10

[0077] The reaction conditions were a reaction at room temperature for 4 h.

[0078] (3) Transform the product after the reaction into Escherichia coli, spread it on a plate containing resistance, pick colonies for bacterial p identification the next day, send the positive colonies to Guangzhou Genewiz for sequencing, and select the required correct plasmids.

[0079] Example 2: Production of AAV by transfection of three plasmids

[0080] (1) Seed about 3E+05 293T cells (293T, derived from CRL-3216TM) into a 6-well plate, use high-glucose DMEM medium containing 10% newborn bovine serum and 1% Penicillin / Streptomycin, and culture in a 37 °C, 5% CO 2 cell incubator for about 48 h. The cell density at the time of transfection was about 60%-70%.

[0081] (2) Add the 4 kinds of target gene plasmids (GOI) A-D constructed in Example 1, packaging plasmid pRC, and helper plasmid pHelper to 0.5 mL of DMEM at a ratio of 1:1:1 respectively, then add 3 μL of PEI (1 μg / μL), vortex and mix well. After standing at room temperature for 10 minutes, add it to 1.5 ml of transfection medium and vortex and mix well. Aspirate the medium in the 6-well plate, add the transfection mixture medium, and then put it back into the 37 °C cell incubator (5% CO 2 concentration) for culture.

[0082] (3) After culturing for 72 h, add 15 μL of cell lysate, collect the cells and supernatant into a 2 mL centrifuge tube, shake and lyse at 250 rpm on a shaker at 37 °C for 1 h, and the supernatant after centrifugation at 10,000 g for 10 minutes is the crude AAV extract.

[0083] Example 3: Production of AAV by transfection of two plasmids

[0084] (1) Seed about 3E+05 293T cells (293T, derived from CRL-3216TM) into a 6-well plate, use high-glucose DMEM medium containing 10% newborn bovine serum and 1% Penicillin / Streptomycin, and culture in a 37 °C, 5% CO 2 cell incubator for about 48 h; the cell density at the time of transfection was about 60%-70%;

[0085] (2) Add the 4 kinds of target gene plasmids (GOI) A - D constructed in Example 1 and the packaging helper plasmid pRC - Helper at a ratio of 1:1 to 0.5 mL of DMEM, then add 3 μL of PEI (1 μg / μL), vortex and mix well. After standing at room temperature for 10 minutes, add it to 1.5 ml of transfection medium and vortex and mix well. Aspirate the medium in the 6 - well plate, add the transfection mixed medium, and then put it back into the 37 °C cell culture incubator (5% CO 2 concentration) for culture

[0086] (3) After culturing for 72 hours, add 15 μL of cell lysate, collect the cells and supernatant into a 2 - mL centrifuge tube, shake and lyse at 250 rpm on a shaker at 37 °C for 1 h, and centrifuge at 10000 g for 10 minutes. The supernatant is the crude AAV extract.

[0087] Example 4: Determination of AAV lysate titer

[0088] Determine the titers of the AVV produced in each group in Examples 2 and 3. The specific method is as follows:

[0089] Use the primers FWD WPRE (5‘-TGCTTCCCGTATGGCTTTCA), REV WPRE (5’-ACGGAATTGTCAGTGCCCAA) to specifically detect the sequences of WPRE of all types of AAV vectors.

[0090] The group settings are shown in Table 4:

[0091] Table 4 Group settings

[0092] Group Plasmid information A 5’ITR + GOI + 3’ITR B 5’ITR + GOI + 3’ITR + CMV-cap C 5’ITR + GOI + 3’ITR + p40-intron-cap D 5’ITR + GOI + 3’ITR + CMV-intron-cap E 5’ITR + GOI + 3’ITR + CMV-p40-intron-cap

[0093] (1) DNase I digestion of samples

[0094] The reaction system is shown in Table 5:

[0095] Table 5 Reaction system

[0096]

[0097]

[0098] Take 5 μL of the sample and dilute it 20 times. Take the corresponding number of PCR tubes, add 18 μL of digestion solution to each tube, and add 2 μL of the diluted sample and 2 μL of the plasmid standard for making the standard curve (containing 4E+08 AAV copies (Genome Copies, GC), as the DNase I digestion control) respectively, which is equivalent to a 10 - fold dilution, and incubate at 37 °C for 30 min. After digestion, take 5 μL of the sample and add it to 95 μL of water, and dilute it continuously 2 times, with a total dilution of 80000 times. Ref AAV (plasmid standard) is diluted 4000 times in total.

[0099] (2) SYBR Green qPCR

[0100] Standard preparation: Take the plasmid standard containing 2E+08 AAV copies / μL and make 6 consecutive dilutions with 8 μL + 72 μL of water. Then the first gradient concentration is 2E+08 GC / μL, and its concentration is set to 8E+14 GC / mL in the software to reflect the dilution gradient of the sample. The subsequent series of gradients are 8E+13 GC / mL, 8E+12 GC / mL, 8E+11 GC / mL, 8E+10 GC / mL, and 8E+09 GC / mL in turn.

[0101] The components of the reaction system are shown in Table 6:

[0102] Table 6 Reaction System

[0103] Reaction components Volume (μL) SYBR PCR reagent (2×) 10 ROX (50×) 0.4 FWD WPRE (50 μM) 0.1 REV WPRE (50 μM) 0.1 Nuclease-free water 4.4 Sample DNA 5

[0104] Calculated by making 3 replicate wells for each sample, prepare the corresponding volume of the mixture, with 18 μL per well, and then add 2 μL of the sample to each well.

[0105] The conditions for SYBR Green qPCR are: Pre-denaturation: 95°C for 10 min; Cycling: 40 cycles: 95°C for 15 sec; 60°C for 1 min.

[0106] After converting all the titer detection results into the multiple relationship with the control target gene vector 5’ITR-EGFP-3’ITR, as Figure 3 and 4 shown. In the case of using the three-plasmid transfection system, adding one copy of p40-intron-cap can increase the rAAV virus yield by about 20%, adding one copy of CMV-intron-cap can increase the rAAV virus yield by about 35%, and adding one copy of CMV-p40-intron-cap can increase the rAAV virus yield by about 27%. In the case of using the two-plasmid transfection system, adding one copy of p40-intron-cap can increase the rAAV virus yield by about 38%, adding one copy of CMV-intron-cap can increase the rAAV virus yield by about 38%, and adding one copy of CMV-p40-intron-cap can increase the rAAV virus yield by about 45%. The results show that compared with the conventional target gene vector, adding one copy of the cap gene to the target gene vector has the effect of increasing the rAAV virus yield.

[0107] In the examples, an auxiliary plasmid of a specific serotype (Rep2Cap9) was used. Those skilled in the art should understand that the present invention is not limited to this specific serotype, but other serotype auxiliary plasmids that are currently known and may continue to be discovered in the future can be used to implement the present invention.

[0108] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present invention and not to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A high-yield AAV target gene vector, characterized in that: The backbone plasmid is inserted with a recombinant sequence, which includes a 5'ITR sequence of AAV, a target gene sequence, a 3'ITR sequence of AAV, at least one promoter sequence, an Intron sequence and a cap sequence.

2. The high-yield AAV target gene vector according to claim 1, characterized in that: The recombinant sequence includes any of the following sequences from 5' to 3': i. AAV 5'ITR sequence, target gene sequence, AAV 3'ITR sequence, promoter sequence, cap sequence; ii. AAV 5'ITR sequence, target gene sequence, AAV 3'ITR sequence, promoter sequence, Intron sequence and cap sequence; iii. AAV 5'ITR sequence, target gene sequence, AAV 3'ITR sequence, first promoter sequence, second promoter sequence, Intron sequence and cap sequence.

3. The high-yield AAV target gene vector according to claim 1, characterized in that: The promoter sequence includes CMV promoter and / or P40 promoter.

4. A plasmid set for high-yield AAV, characterized in that: It comprises an auxiliary plasmid, a packaging plasmid and the high-yield AAV target gene vector according to any one of claims 1 to 3; or it comprises a packaging auxiliary plasmid and the high-yield AAV target gene vector according to any one of claims 1 to 3.

5. A reagent for high-yield AAV, characterized in that: A plasmid set comprising the high-yield AAV as described in claim 4.

6. A cell that produces high levels of AAV, characterized in that: A plasmid set comprising the high-yield AAV as described in claim 4.

7. The high-producing AAV cell according to claim 6, characterized in that The cells include at least one of HeLa, HEK293, and insect Sf9 cells.

8. A kit for high-yield AAV, characterized in that: Comprising the reagent of claim 5 or the cell of claim 6 or 7.

9. A method for high-yield AAV, characterized in that: Transform host cells with the plasmid set described in claim 4, and then culture the host cells; or culture the cells described in claim 6 or 7.

10. Use of the high-yield AAV target gene vector according to any one of claims 1 to 3, the plasmid set according to claim 4, the reagent according to claim 5, the cell according to claim 6 or 7, and the kit according to claim 8 in the production of recombinant adeno-associated virus.

Images