Construction and application of high-yield corac acid engineering bacteria

Abstract

The invention relates to a recombinant engineering bacterium for efficiently producing corac acid (CA) and application of the recombinant engineering bacterium. A key gene synthesized by CA is edited, and rcsA and rcsB are constructed; galU, galE, ugD, manB, manC, gmd and fcl genes, an acetic acid pathway gene, a cofactor regeneration related gene and a CA synthesis cluster related gene; through overexpression in two modes of plasmid or genome integration, a recombinant engineering bacterium for high-yield production of CA is obtained. The provided recombinant engineering bacterium provides a basis for large-scale production.

Description

Construction and application of an engineered bacterium that produces high colanic acid yield

[0001] priority

[0002] This application claims the benefit of and priority to PCT International Application No. PCT / CN2022 / 143748 filed on December 30, 2022, and PCT International Application No. PCT / CN2023 / 114524 filed on August 23, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The invention belongs to the fields of genetic engineering and fermentation engineering, and particularly relates to the construction and application of a high-yield colanic acid engineering bacterium. Background Art

[0004] Colanic acid (CA) is a bacterial exopolysaccharide produced by most Escherichia coli strains and other species of the Enterobacteriaceae family. It is synthesized during bacterial life to adapt to environmental changes and improve survival. CA has a large molecular weight and is loosely coated on the bacterial surface, resulting in a mucus-like appearance. This prevents cell dehydration, protects cells, and protects against harmful substances. Under conditions unfavorable for growth, such as desiccation, low pressure, and low pH, mucoid strains exhibit greater survival than wild-type strains. In 2017, Han et al. reported that feeding purified CA or CA-secreting Escherichia coli significantly extended the lifespan of Caenorhabditis elegans. Furthermore, as a unique active biopolymer, CA possesses unique biological properties and physiological parameters, offering broad application prospects. For example, due to its porous cellulose structure and numerous hydrophilic groups on the surface, CA is a natural hydrogel with excellent hydration and a soft texture, making it a promising candidate for future applications in the cosmetics and healthcare markets.

[0005] In vivo studies using zebrafish as a model have shown that polysaccharides or oligosaccharides containing fucose have significant anti-inflammatory properties. Other studies have shown that fucose molecules or fucose-containing polysaccharides or oligosaccharides can more easily penetrate the dermis, increase skin thickness, and promote a more refined collagen structure. Therefore, fucose and fucose-rich polysaccharides or oligosaccharides can slow down skin aging. CA is composed of D-glucose, L-fucose, D-galactose, D-glucuronic acid, and non-stoichiometrically modified O-acetyl and pyruvic acid on the side chains. The L-fucose content is as high as approximately 30%, which means that CA has great application potential in anti-inflammatory, immune-enhancing, and anti-aging applications.

[0006] Colanic acid, synthesized by E. coli under certain conditions, has a relatively high molecular weight, approximately 8-10 million Da. This high-molecular-weight polysaccharide has applications in cosmetics, health foods, and other fields. Currently, colanic acid is primarily synthesized in E. coli. Research has shown that colanic acid synthesis can be achieved under certain culture conditions by knocking out and / or overexpressing the relevant E. coli genes. For example, Sun Junsong et al. (patent CN109439708A) achieved high CA production by intracellular transfection of an acid-resistant Escherichia coli with a plasmid pBhya-CAB, with a yield of 10.22 g / L. However, the strain needed to be cultured under low pH conditions, and the by-product PHB was synthesized at the same time, which was not conducive to the subsequent product separation; Wang Xiaoyuan et al. (patent CN113755515A) knocked out the genes related to lipopolysaccharide synthesis in Escherichia coli and overexpressed the genes of two precursor synthesis pathways, and finally achieved the synthesis of 19.79 g / L CA. However, the strain had a long culture cycle, requiring 72 hours to complete the fermentation of a batch, and its production efficiency was low.

[0007] The present invention aims to engineer strains through a series of synthetic biology techniques to prepare several engineered bacteria that can efficiently produce CA, providing a basis for the large-scale production of CA.

[0008] Summary of the Invention

[0009] In one aspect, the present disclosure provides a recombinant engineered bacterium, wherein the recombinant engineered bacterium

[0010] a) The lipopolysaccharide core polysaccharide synthesis gene cluster waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG and waaQ on the genome were knocked out; at the same time, the Lon protein encoding gene lon and the HNS regulatory protein encoding gene hns were knocked out;

[0011] b) Overexpression of the rcsA gene encoding the DNA-binding transcriptional activator RcsA and the rcsB gene encoding the DNA-binding transcriptional activator RcsB;

[0012] c) Overexpression of the gene encoding UTP-1-glucose uridyltransferase galU, UDP-glucose-4-isomerase galE, UDP-glucose-6-dehydrogenase ugD, phosphomannanase manB, mannose-1-phosphate guanylyltransferase manC, GDP-mannose-4,6-dehydrogenase gmd, and GDP-L-fucose synthase fcl.

[0013] In some specific embodiments, the genes overexpressed in b) and c) are derived from any one of Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces, or Streptomyces, preferably Escherichia coli.

[0014] Those skilled in the art should be aware that in different engineered bacteria, the specific sequences of the above genes may be homologous rather than completely identical. It can be expected that the functions of the same gene in different bacterial genera are highly similar. Therefore, the specific gene sequence does not limit the scope of this disclosure.

[0015] In some specific embodiments, the Ptac promoter is used to enhance the expression of rcsA, rcsB, galU, galE, ugD, manB, manC, gmd and fcl genes in the recombinant engineered bacteria.

[0016] In some specific embodiments, the Ptac promoter P2 is used in the recombinant engineered bacteria to enhance the expression of rcsA and rcsB, the Ptac promoter P3 is used to enhance the expression of galU, galE and ugD, and the Ptac promoter P4 is used to enhance the expression of manB and manC; the Ptac promoter P1 is used to enhance the expression of gmd and fcl, wherein the sequence of the P1 includes SEQ ID NO: 1, the sequence of the P2 includes SEQ ID NO: 2, the sequence of the P3 includes SEQ ID NO: 3, and the sequence of the P4 includes SEQ ID NO: 4.

[0017] In some specific embodiments, the sequence of P1 is shown as SEQ ID NO: 1, the sequence of P2 is shown as SEQ ID NO: 2, the sequence of P3 is shown as SEQ ID NO: 3, and the sequence of P4 is shown as SEQ ID NO: 4.

[0018] In some specific embodiments, the 5′ ends of the rcsA, rcsB, galU, galE, ugD, manB, manC, gmd, and fcl genes are all connected to a ribosome binding site (RBS) sequence.

[0019] In some specific embodiments, the ribosome binding site RBS sequence comprises a sequence selected from the group consisting of SEQ ID NO: 5-31.

[0020] In some embodiments, the 5′ end of rcsA is linked to the ribosome binding site RBS sequence R H1 The 5′ end of rcsB is connected to the ribosome binding site RBS sequence R H2 The 5′ end of galU is connected to the ribosome binding site RBS sequence R L3 The 5′ end of galE is connected to the ribosome binding site RBS sequence RL4 The 5′ end of ugD is connected to the ribosome binding site RBS sequence R L5 The 5′ end of manB is connected to the ribosome binding site RBS sequence R M6 The 5′ end of manC is connected to the ribosome binding site RBS sequence R M7 The 5′ end of GMD is connected to the ribosome binding site RBS sequence R L8 The 5′ end of fcl is connected to the ribosome binding site RBS sequence R L9 wherein said R H1 The sequence includes SEQ ID NO: 5; said R H2 The sequence includes SEQ ID NO: 6; said R L3 The sequence includes SEQ ID NO: 25; said R L4 The sequence includes SEQ ID NO: 26; said R L5 The sequence includes SEQ ID NO: 27; said R M6 The sequence includes SEQ ID NO: 19; said R M7 The sequence includes SEQ ID NO: 20; said R L8 The sequence includes SEQ ID NO: 30; said R L9 The sequence includes SEQ ID NO:31.

[0021] In some specific embodiments, wherein said R H1 The sequence is shown in SEQ ID NO: 5; the R H2 The sequence is shown in SEQ ID NO: 6; the R L3 The sequence is shown in SEQ ID NO: 25; the R L4 The sequence is shown in SEQ ID NO: 26; the R L5 The sequence is shown in SEQ ID NO: 27; the R M6 The sequence is shown in SEQ ID NO: 19; the R M7 The sequence is shown in SEQ ID NO: 20; the R L8 The sequence is shown in SEQ ID NO: 30; the R L9 The sequence is shown in SEQ ID NO:31.

[0022] In the present disclosure, the recombinant engineered bacteria is selected from any one of the Enterobacteriaceae family, more preferably selected from Escherichia coli BL21 (DE3), JM109, Nissle 1917 (EcN), BW23110 or MG1655.

[0023] In a second aspect, the present disclosure provides a method for constructing an engineered bacterium for producing colanic acid, comprising:

[0024] a) Knockout the lipopolysaccharide core polysaccharide synthesis gene cluster waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaS, waaP, waaG, and waaQ in the genome, and simultaneously knock out the Lon protein encoding gene lon and the HNS regulatory protein encoding gene hns;

[0025] b) Overexpression of the gene encoding the DNA-binding transcriptional activator RcsA, rcsA, and the gene encoding the DNA-binding transcriptional activator RcsB, rcsB;

[0026] c) Overexpression of galU, galE, ugD, manB, manC, gmd and fcl genes.

[0027] In some specific embodiments, the genes overexpressed in b) and c) are derived from any one of Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces, or Streptomyces, preferably Escherichia coli.

[0028] In some specific embodiments, in the above method, the recombinant engineered bacteria uses Ptac promoter P2 to enhance expression of rcsA and rcsB, uses Ptac promoter P3 to enhance expression of galU, galE, and ugD, and uses Ptac promoter P4 to enhance expression of manB and manC; and uses Ptac promoter P1 to enhance expression of gmd and fcl, wherein the sequence of P1 comprises SEQ ID NO: 1, the sequence of P2 comprises SEQ ID NO: 2, the sequence of P3 comprises SEQ ID NO: 3, and the sequence of P4 comprises SEQ ID NO: 4. Preferably, in a specific embodiment, the sequence of P1 is as shown in SEQ ID NO: 1, the sequence of P2 is as shown in SEQ ID NO: 2, the sequence of P3 is as shown in SEQ ID NO: 3, and the sequence of P4 is as shown in SEQ ID NO: 4.

[0029] In some specific embodiments, in the above method, the 5′ ends of the rcsA, rcsB, galU, galE, ugD, manB, manC, gmd and fcl genes are all connected to a ribosome binding site RBS sequence.

[0030] In some specific embodiments, in the above method, the ribosome binding site RBS sequence includes a sequence selected from the group consisting of SEQ ID NO: 5-31.

[0031] In some specific embodiments, in the above method, the 5′ end of the rcsA is connected to the ribosome binding site RBS sequence R H1 The 5′ end of rcsB is connected to the ribosome binding site RBS sequence R H2 The 5′ end of galU is connected to the ribosome binding site RBS sequence R L3 The 5′ end of galE is connected to the ribosome binding site RBS sequence R L4 The 5′ end of ugD is connected to the ribosome binding site RBS sequence R L5 The 5′ end of manB is connected to the ribosome binding site RBS sequence R M6 The 5′ end of manC is connected to the ribosome binding site RBS sequence R M7 The 5′ end of GMD is connected to the ribosome binding site RBS sequence R L8 The 5′ end of fcl is connected to the ribosome binding site RBS sequence R L9 wherein said R H1 The sequence includes SEQ ID NO: 5; said R H2 The sequence includes SEQ ID NO: 6; said R L3 The sequence includes SEQ ID NO: 25; said R L4 The sequence includes SEQ ID NO: 26; said R L5 The sequence includes SEQ ID NO: 27; said R M6 The sequence includes SEQ ID NO: 19; said R M7 The sequence includes SEQ ID NO: 20; said R L8 The sequence includes SEQ ID NO: 30; said R L9 The sequence includes SEQ ID NO: 31. Preferably, in a specific embodiment, wherein said R H1 The sequence is shown in SEQ ID NO: 5; the R H2 The sequence is shown in SEQ ID NO: 6; the R L3 The sequence is shown in SEQ ID NO: 25; the R L4 The sequence is shown in SEQ ID NO: 26; the R L5 The sequence is shown in SEQ ID NO: 27; the R M6 The sequence is shown in SEQ ID NO: 19; the R M7 The sequence is shown in SEQ ID NO: 20; the R L8 The sequence is shown in SEQ ID NO: 30; the R L9 The sequence is shown in SEQ ID NO:31.

[0032] In some specific embodiments, in the above method, the engineered bacteria is selected from any one of the Enterobacteriaceae family, more preferably selected from Escherichia coli BL21 (DE3), JM109, Nissle 1917 (EcN), BW23110 or MG1655.

[0033] In some specific embodiments, the engineered bacteria uses any species of Escherichia coli as a host cell, and uses pET series vectors, pRSFDuet-1, pACYDuet-1, pCDFDuet1 and related modified plasmids as expression vectors to overexpress genes.

[0034] In another aspect, the present disclosure provides use of any of the above-described recombinant engineered bacteria in preparing a product for producing colanic acid.

[0035] In another aspect, the present disclosure provides a recombinant engineered bacterium, wherein the recombinant engineered bacterium

[0036] a) The lipopolysaccharide core polysaccharide synthesis gene cluster waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG, and waaQ were knocked out in the genome; at the same time, the Lon protein encoding gene lon and the HNS regulatory protein encoding gene hns were knocked out;

[0037] b) knocking out the acetate biosynthesis pathway gene poxB;

[0038] c) Overexpression of the DNA transcription activator encoding gene rcsA and the DNA binding transcription activator encoding gene rcsB;

[0039] d) Overexpression of the isocitrate dehydrogenase gene icd, and / or the pyridine nucleotide transhydrogenase encoding gene pntAB, genes related to promoting NADPH regeneration; and integrated expression of the guanine nucleoside kinase encoding gene gsk, a gene related to GTP regeneration;

[0040] e) overexpression of the UDP-1-phosphate glucose uridyltransferase encoding gene galU;

[0041] f) overexpression of the colanic acid biosynthesis cluster-related genes, the UDP-glucose-1-phosphotransferase encoding gene wcaJ and / or the colanic acid polymerase encoding gene wcaD;

[0042] In some specific embodiments, the overexpressed gene in c) to f) is derived from any one of Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces, or Streptomyces, preferably Escherichia coli.

[0043] In another aspect, the present disclosure provides a method for constructing a colanic acid-producing recombinant engineered bacterium, comprising:

[0044] a) knocking out the lipopolysaccharide core polysaccharide synthesis gene cluster waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG and waaQ, the Lon protein encoding gene lon and the HNS regulatory protein encoding gene hns in the genome;

[0045] b) knocking out the acetate biosynthesis pathway gene poxB;

[0046] c) Overexpression of the DNA transcription activator encoding gene rcsA and the DNA binding transcription activator encoding gene rcsB;

[0047] d) Overexpression of the isocitrate dehydrogenase gene icd, and / or the pyridine nucleotide transhydrogenase encoding gene pntAB, genes related to promoting NADPH regeneration; and integrated expression of the guanine nucleoside kinase encoding gene gsk, a gene related to GTP regeneration;

[0048] e) overexpression of the UDP-1-phosphate glucose uridyltransferase encoding gene galU;

[0049] f) Overexpression of the colanic acid biosynthesis cluster-related genes, UDP-glucose-1-phosphotransferase encoding gene wcaJ and / or colanic acid polymerase encoding gene wcaD.

[0050] In some specific embodiments, the overexpressed gene in c) to f) is derived from any one of Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces, or Streptomyces, preferably Escherichia coli. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] The present invention can be more fully understood with reference to the following drawings.

[0052] FIG1 shows a plasmid map of pTarget-waaF.

[0053] FIG2 shows the comparison of waaF and LQ before and after knockout.

[0054] FIG3 shows the corresponding yields of the LPS module knockout strain.

[0055] Figure 4 shows the effects of knockout of RcsCDB module-related genes on CA production and OD 600 impact.

[0056] FIG5 shows the construction of plasmids related to the RcsCDB module.

[0057] Figure 6 shows single gene enhancement of the precursor synthesis pathway.

[0058] FIG. 7 shows double genetic enhancement of the precursor synthesis pathway.

[0059] FIG8 shows multi-gene enhancement of the precursor synthesis pathway.

[0060] FIG9 shows the effect of gene sequence on yield.

[0061] FIG10 shows the effect of promoter optimization on yield.

[0062] FIG11 shows the enhanced expression cassette corresponding to the engineered bacterium Δ3AB-Pc.

[0063] FIG12 shows the relative fluorescence intensities of different RBSs.

[0064] FIG13 shows the CA production after optimization of promoter and RBS combination.

[0065] FIG14 shows the yield and pH changes corresponding to the engineered bacteria Δ4.

[0066] FIG15 shows the yield and OD600 of the engineered bacteria expressing rcsA and rcsB.

[0067] FIG16 shows the yield and OD600 of strains expressing genes related to enhanced cofactor regeneration.

[0068] FIG. 17 shows the production and OD600 of strains expressing genes related to the colanic acid biosynthesis cluster.

[0069] FIG18 shows the yield of the optimal strain when scaled up in a 5-L fermenter.

[0070] Detailed Description of the Invention

[0071] Various features and aspects of the present invention are discussed in greater detail below.

[0072] This technical solution mainly includes three parts. The first and second parts are the first technical route for the construction of high-yield strains. The first part is a modular engineering strategy to achieve the improvement of CA production, which involves the lipopolysaccharide synthesis module, the RcsCDB phosphate transfer module, and the precursor synthesis pathway module. By knocking out or overexpressing these modules accordingly, the direction and intensity of the metabolic flow are changed, so that the yield is greatly improved. The second part is the component screening and optimization of the balanced metabolic flow to increase CA production. It involves promoter optimization, ribosome binding site (RBS) optimization and balanced metabolism of the promoter and RBS combination. The third part is the study of CA synthesis-related pathways through genome integration, knocking out the acetic acid synthesis pathway, integrating and expressing the RcsCDB phosphate transfer module, overexpressing the cofactor regeneration pathway genes and overexpressing the CA synthesis cluster-related genes. The starting strain can be selected from any one of the Enterobacteriaceae family, more preferably, selected from Escherichia coli BL21 (DE3), JM109, Nissle 1917 (EcN), BW23110 or MG1655.

[0073] The overexpression methods described in the present disclosure include plasmid overexpression or genome integration overexpression. Those skilled in the art will understand that as long as the overexpression of the target gene is achieved in the strain, it is an overexpression method.

[0074] 1. Modular engineering strategy to increase CA production

[0075] 1.1 LPS module knockout

[0076] Lipopolysaccharide (LPS) is a major component of the outer membrane of most Gram-negative bacteria. LPS synthesis consumes precursors such as glucose (glu) and galactose (gal), which are also common raw materials for the synthesis of CA polysaccharides. Therefore, knocking out the LPS synthesis pathway can redirect metabolic flux toward CA polysaccharide synthesis and increase production. The enzymes involved in LPS core sugar synthesis are encoded by 15 genes in the waa gene cluster (waaD, waaF, waaC, waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaS, waaP, waaG, waaQ, and waaA). This study employed three knockout methods: knocking out waaF, LQ (waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaS, waaP, waaG, waaQ), and LG (waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaS, waaP, waaG), resulting in three recombinant strains: ΔwaaF, ΔLG, and ΔLQ. These strains were then validated and analyzed. The results showed that all three strains synthesized CA, with the ΔLQ knockout having a more pronounced effect.

[0077] 1.2 RcsCDB phosphotransfer module

[0078] Based on the aforementioned ΔLQ strain, the lon or hns gene was further knocked out, resulting in engineered strains ΔLQΔlon and ΔLQΔhns. Both strains were found to significantly increase CA production. Further knocking out hns from the ΔLQΔlon strain resulted in the triple knockout strain ΔLQΔlonΔhns. Analysis of this strain revealed further improvements in CA production, surpassing the previously mentioned highest-yielding strain, designated Δ3. This strain was then further overexpressed with rcsA, rcsB, and rcsA+rcsB. The optimal engineered strain was the enhanced rcsA+rcsB strain, designated Δ3AB.

[0079] 1.3 Precursor synthesis module

[0080] Genes involved in the precursor synthesis pathway include pgi, pgm, galU, galE, ugD, manA (pmi), manB (cpsG, rfbK), manC (cpsB, mni, rfbM), gmd, and fcl (wcaG, yefB). First, overexpression of individual precursor pathway genes was performed, resulting in a series of strains with enhanced single-gene expression, which showed varying degrees of improvement in CA production. Then, double gene enhancement pgm-galU (MU), pgm-galE (ME), pgm-ugD (MD), galU-galE (UE), galU-ugD (UD), galE-ugD (ED), manA-manB (AB), manB-manC (BC), manB-gmd (BG), manB-fcl (BF), manC-gmd (CG), gmd-fcl (GF), galU-manB (UB), galU-manC (UC), galU-gmd (UG), and galU-fcl (UF) were carried out respectively. Through double gene combination enhancement, different engineered bacteria were obtained, and their CA production showed different increases. It is easy to imagine that other double-gene combinations may also result in different degrees of increase in CA production, such as pgm-manA (MA), pgm-manB (MB), pgm-manC (MC), pgm-gmd (MG), pgm-fcl (MF), galU-manA (UA), galU-manB (UB), galU-manC (UC), galU-gmd (UG), galU-fcl (UF), galE-manA (EA), galE-manB (EB), galE-manC (EC), galE-gmd (EG), galE-fcl (EF), ugD-manA (DA), ugD-manB (DB), ugD-manC (DC), ugD-gmd (DG), ugD-fcl (DF), etc.

[0081] Further triple gene enhancement with galU-galE-ugD, galU-gmd-fcl, and galU-manB-manC also resulted in varying degrees of improvement in yield. In addition to the triple gene enhancement combinations listed above, it's easy to imagine many other triple gene enhancements, such as pgm-gulU-manA (MUA), pgm-galU-manB (MUB), pgm-galU-manC (MUC), pgm-galU-gmd (MUG), pgm-galU-fcl (MUF), and galU-galE-manA (UEA).

[0082] Based on the above research, the results showed that genes in the metabolic pathway all have a certain impact on CA production. Therefore, further research was conducted on four-gene combination enhancement (galU-galE-manB-manC (UEBC), galU-galE-gmd-fcl (UEGF)), five-gene combination enhancement (galU-galE-manB-manC-gmd (UEBCG), galU-galE-manB-manC-fcl (UEBCF)), six-gene combination enhancement (galU-galE-manB-manC-gmd-fcl (UEBCGF), and seven-gene combination enhancement (galU-galE-ugD-manB-manC-gmd-fcl (UEDBCGF)). Transfection of these different combination enhancements into the Δ3AB strain resulted in newly engineered bacteria with varying degrees of increased production. The optimal engineered strain was the one with the seven-gene UEDBCGF enhancement, designated Δ3AB-Pa.

[0083] In one embodiment, three Ptac promoters are used, specifically Ptac-galU-galE-ugD, Ptac-manB-manC, and Ptac-gmd-fcl, that is, the Ptac promoter in the first expression frame controls the expression of the three genes galU-galE-ugD, the Ptac promoter in the second expression frame controls the expression of the two genes manB-manC, and the Ptac promoter in the third expression frame controls the expression of the two genes gmd-fcl. Those skilled in the art will understand that different gene arrangements can achieve the expected effect by simply overexpressing the gene. Therefore, the gene order is only used as an example and does not limit the scope of this disclosure. For example, EDBCGFU, DBCGFUE, BCGFUED, etc. can be expected to have similar effects.

[0084] The selection of precursor synthesis pathway genes is not limited to Escherichia coli itself, but can also come from Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces, Streptomyces, etc.; genes with the same function are within the range if the sequence similarity is greater than or equal to 30% through sequence analysis.

[0085] 2. Component screening and metabolic flow balance

[0086] Biocomponents are the cornerstone of synthetic biology. The design, assembly, and construction of biocomponent libraries are essential and crucial for the engineering of synthetic biology. With the rapid development of synthetic biology, researchers have discovered that various components (promoters, ribosome binding sites, terminators, transcription factors, etc.) significantly influence the efficient expression of proteins and various compounds. A promoter is a DNA sequence located 5' upstream of a gene that is recognized by RNA polymerase and transcribes the DNA into RNA from the transcription start site. The strength of the promoter influences the level of transcription. The ribosome binding site (RBS) is the binding site for translation initiation. Optimizing the RBS sequence can significantly upregulate or downregulate translation. In recent years, an increasing number of microbial gene expression components have been identified, and various component libraries have been constructed based on these components. Building on this foundation, bioinformatics has been further integrated to screen and design these component libraries, optimizing the combination of multiple components to enhance the expression of target CAs.

[0087] 2.1 Promoter Optimization

[0088] In the precursor enhancement work, the promoters used were all the same constitutively strong promoter, Ptac (P1). Considering that any promoter that is too strong is detrimental to bacterial growth, we selected three different promoters based on database comparison and mining, and named these three promoters P2 to P4. The sequences corresponding to P1 to P4 are shown in SEQ.1 to SEQ.4. Based on the results of the precursor synthesis module, different promoters were applied to the RcsCDB phosphotransferase and precursor pathway gene combination modules to enhance the expression of corresponding genes. The combination is as follows:

[0089] P1-rcsA-rcsB-P1-galU-galE-ugD-P1-manB-manC-P1-gmd-fcl (control, Δ3AB-Pa)

[0090] P1-rcsA-rcsB-P2-galU-galE-ugD-P3-manB-manC-P4-gmd-fcl (strain designation: Δ3AB-Pb)

[0091] P2-rcsA-rcsB-P3-galU-galE-ugD-P4-manB-manC-P1-gmd-fcl (strain designation: Δ3AB-Pc)

[0092] P3-rcsA-rcsB-P4-galU-galE-ugD-P1-manB-manC-P2-gmd-fcl (strain designation: Δ3AB-Pd)

[0093] P4-rcsA-rcsB-P1-galU-galE-ugD-P2-manB-manC-P3-gmd-fcl (strain designation: Δ3AB-Pe)

[0094] A series of engineered bacteria were obtained, achieving further improvement in yield, among which strain Δ3AB-Pc had the highest yield.

[0095] It should be further explained that changing the gene sequence does not affect the CA yield. Some different gene sequence combinations are as follows:

[0096] P1-gmd-fcl-P2-rcsA-rcsB-P3-galU-galE-ugD-P4-manB-manC (strain designation: Δ3AB-Pf)

[0097] P4-manB-manC-P1-gmd-fcl-P2-rcsA-rcsB-P3-galU-galE-ugD (strain designation: Δ3AB-Pg)

[0098] P3-galU-galE-ugD-P4-manB-manC-P1-gmd-fcl-P2-rcsA-rcsB (strain designation: Δ3AB-Ph)

[0099] P2-rcsA-rcsB-P3-galU-galE-ugD-P4-manB-manC-P1-gmd-fcl (strain designation: Δ3AB-Pi)

[0100] In addition, there are many different permutations and combinations that can achieve similar effects. The above results also show that the expression cassettes P2-rcsA-rcsB, P3-galU-galE-ugD, P4-manB-manC and P1-gmd-fcl can achieve the desired effect as long as they are expressed.

[0101] 2.2 RBS sequence screening and optimization

[0102] The RBS sequences corresponding to the above promoter optimization are all the same (aagaaggaga). Considering that the differences in RBS sequences and the length of the sequences significantly affect the expression of the gene, a 10bp degenerate RBS sequence NNNNNNNNNN was designed here. The effect of RBS sequence differences on the expression of green fluorescent protein was verified based on the P1 promoter. They were ranked according to RBS strength, and the top 90 sequences were selected for subsequent research. The 9 strongest sequences ranked 1 to 9 were named R H1 ~R H9 , 9 medium-intensity sequences ranked 41 to 49 were selected and named RM1 ~R M9 , 9 low-intensity sequences ranked 82 to 90 were selected and named R L1 ~R L9 .

[0103] 2.3 Promoter and RBS combination optimization to improve strain performance

[0104] The RBS in the above strain Δ3AB-Pc-Ac (P2-rcsA-rcsB-P3-galU-galE-ugD-P4-manB-manC-P1-gmd-fcl) were replaced with the strongest RBS sequence R H1 ~R H9 , or medium intensity sequence R M1 ~R M9 , or low intensity sequence R L1 ~R L9 , or different strength combinations. It should be noted that in prokaryotes, although multiple genes can share the same promoter, each gene needs to be preceded by an RBS. The different strength RBS combinations are shown below:

[0105] R H1 -R H2 -R H3 -R H4 -R H5 -R H6 -R H7 -R H8 -R H9 (Δ3AB-Pc-Ra)

[0106] R M1 -R M2 -R M3 -R M4 -R M5 -R M6 -R M7 -R M8 -R M9 (Δ3AB-Pc-Rb)

[0107] R L1 -R L2 -R L3 -R L4 -R L5 -R L6 -R L7 -R L8 -R L9 (Δ3AB-Pc-Rc)

[0108] R H1 -R H2 -R H3-R H4 -R H5 -R H6 -R H7 -R M8 -R M9 (Δ3AB-Pc-Rd)

[0109] R H1 -R H2 -R M3 -R M4 -R M5 -R M6 -R M7 -R M8 -R M9 (Δ3AB-Pc-Re)

[0110] R M1 -R M2 -R M3 -R M4 -R M5 -R H6 -R H7 -R H8 -R H9 (Δ3AB-Pc-Rf)

[0111] R M1 -R M2 -R H3 -R H4 -R H5 -R H6 -R H7 -R H8 -R H9 (Δ3AB-Pc-Rg)

[0112] R H1 -R H2 -R L3 -R L4 -R L5 -R H6 -R H7 -R L8 -R L9 (Δ3AB-Pc-Rh)

[0113] R H1 -R H2 -R M3 -R M4 -R M5 -R M6 -R M7 -R L8 -R L9 (Δ3AB-Pc-Ri)

[0114] R H1-R H2 -R L3 -R L4 -R L5 -R M6 -R M7 -R L8 -R L9 (Δ3AB-Pc-Rj)

[0115] The names in brackets are the corresponding strains. Fermentation tests were conducted on this series of strains, and the strain Δ3AB-Pc-Rj-Ac had the highest fermentation yield.

[0116] The listed combinations are only some of the possible combinations. Based on this strategy, many different combinations can be formed to achieve similar effects.

[0117] 3. Gene integration strategy to improve CA production

[0118] a) Knockout of the lipopolysaccharide core polysaccharide synthesis gene cluster waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG and waaQ, the Lon protein encoding gene lon and the HNS regulatory protein encoding gene hns in the genome;

[0119] b) knocking out the acetate biosynthesis pathway gene poxB;

[0120] c) integrating and expressing the DNA transcription activator encoding gene rcsA and the DNA binding transcription activator encoding gene rcsB at the genomic level;

[0121] d) further integrating and expressing the isocitrate dehydrogenase gene icd, and / or the pyridine nucleotide transhydrogenase encoding gene pntAB, which are genes related to promoting NADPH regeneration; integrating and expressing the guanine nucleoside kinase encoding gene gsk, which is a gene related to GTP regeneration;

[0122] e) further integrating and expressing the UDP-1-phosphate glucose uridyl transferase encoding gene galU;

[0123] f) further integrating and expressing the colanic acid biosynthesis cluster-related genes, UDP-glucose-1-phosphotransferase encoding gene wcaJ, and / or colanic acid polymerase encoding gene wcaD.

[0124] Materials and methods used in specific examples

[0125] Seed culture medium: yeast powder 5-10g / L, trypsin 5-10g / L, sodium chloride 5-10g / L.

[0126] Fermentation medium: yeast powder 10-20g / L, trypsin 20-40g / L, KH2PO4 2-4g / L, K2HPO4 10-15g / L, glucose 10-30g / L, pH 4.5-7.5.

[0127] Molecular cloning-related reagents: seamless cloning enzyme (Takara), DNA polymerase (Takara), DNA recovery kit (Shanghai Bioengineering), plasmid extraction kit (Shanghai Bioengineering), DNA marker (Takara).

[0128] Seed culture method: Use an inoculation loop to pick and streak a single colony on a flat plate and inoculate it into 3-7 mL of seed culture medium. Incubate at 34-38°C for 10-18 hours.

[0129] Shake flask fermentation test culture method: take the seed liquid and inoculate it into the fermentation medium at an inoculum rate of 1%-10%, and culture the inoculated fermentation medium at 25-32°C for 48 hours.

[0130] Polysaccharide detection method: (1) Sample processing. After 48 hours of cultivation, the fermentation liquid was centrifuged at 10,000-15,000 rpm in a refrigerated centrifuge for 20 minutes, and the supernatant was collected; 1.5-4 times of anhydrous ethanol was added to the supernatant and the supernatant was kept in a refrigerator at 2-8°C overnight. The alcohol-precipitated solution was centrifuged at high speed for 20 minutes, the supernatant was removed, and the precipitate was retained; an appropriate amount of sterile water was added to re-dissolve the precipitate, and the resulting solution was the extracted polysaccharide extract. (2) CA yield detection. First, prepare different concentrations of fucose standards: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 g / L; take 50 μL of different concentrations of fucose standards, add 4.5 mL of sulfuric acid solution (H2SO4 / H2O (6:1; v / v).), boil in water bath for 20 minutes, cool naturally to room temperature, and measure their OD using an enzyme reader. 396 and OD 427 Then, add 100 μL of 1 mol / L cysteine ​​hydrochloride solution and remeasure the OD'396 and OD'427 values. Calculate ΔOD396 (OD'396 - OD396) and ΔOD427 (OD'427 - OD427). Plot a standard curve for fucose concentration using fucose concentration as the abscissa and ΔOD396 - ΔOD427 as the ordinate, and calculate the concentration conversion equation. To determine sample concentration, take 50 μL of a diluted sample of appropriate concentration and run the same test procedure. Use the ΔOD396 - ΔOD427 value to calibrate the fucose concentration in the sample against the fucose standard curve to calculate the CA concentration. Example

[0131] The following examples are illustrative only and are not intended to limit the scope or content of the invention in any way.

[0132] Example 1 Construction of single gene knockout strain for lipopolysaccharide pathway

[0133] The synthesis of lipopolysaccharide consumes precursor substances. Consider knocking out genes (clusters) in this pathway. In a specific embodiment, the exemplary starting strain is Escherichia coli str. K-12 substr. MG1655, and the gene waaF (gene ID: 948135), gene cluster LG (including genes waaL (gene ID: 948148), waaU (gene ID: 948147), waaZ (gene ID: 948146), waaY (gene ID: 948145), waaR (gene ID: 948142), waaO (gene ID: 948143), waaB (gene ID: 948144), waaS (gene ID: 948151), waaP (gene ID: 948150), waa G (gene ID: 948149)) or gene cluster LQ (waaL (gene ID: 948148), waaU (gene ID: 948147), waaZ (gene ID: 948146), waaY (gene ID: 948145), waaR (gene ID: 948142), waaO (gene ID: 948143), waaB (gene ID: 948144), waaS (gene ID: 948151), waaP (gene ID: 948150), waaG (gene ID: 948149), waaQ (gene ID: 948155)). CRISPR-Cas9 was used to knock out genomic genes.

[0134] 1. Construction of homology arm fragments and sgRNA plasmids

[0135] To knock out the relevant genes, 1000bp nucleotide sequences corresponding to the upstream and downstream of the gene (cluster) were first amplified by PCR and named waaF-arm1, waaF-arm2; LG-arm1, LG-arm2; LQ-arm1, LQ-arm2. The primers used were named waaF-arm1-F / R, waaF-arm2-F / R; LG-arm1-F / R, LG-arm2-F / R; LG-arm1-F / LQ-arm1-R, LQ-arm2-F / R, respectively. The specific sequences are shown in Table 2.

[0136] Table 2. Primers and sgRNA sequences required for engineering bacteria construction

[0137] The two corresponding upstream and downstream homology arms were ligated using fusion PCR to form a single fragment: waaF, LG-arm, and LQ-arm. To construct sgRNAs, the corresponding gene sequences were used as templates and sgRNA sequences were designed online using the chopchop website. The resulting sequences were ligated into the pTarget plasmid, resulting in plasmids containing the corresponding gene sgRNAs: pTarget-waaF, pTarget-LG, and pTarget-LQ, respectively. The corresponding pTarget-waaF plasmid map is shown in Figure 1, and the maps of the other two plasmids are similar.

[0138] 2. Preparation of E. coli MG1655 Competent Cells

[0139] In order to perform gene knockout, the constructed homology arm fragment and sgRNA plasmid need to be introduced into the cells. To do this, the cells need to be made competent to absorb exogenous DNA. (1) Inoculate the strain containing the pCas9 plasmid into 50 mL LB medium at a rate of 1% to 2%, and culture at 30°C; wait until the OD 600 When the cells grow to 0.1-0.2, add 2 mL of 1 M L-arabinose (final concentration 40 mM) and culture at 30 °C to induce the expression of the recombinase. The induction time is at least 1 hour. 600 When the pH reaches 0.6-0.7, start preparing competent cells. (2) Centrifuge at 5000 rpm for 5 minutes at 4°C to collect the cells. Add pre-cooled sterile 10% glycerol to resuspend the cells and wash three times (using 1 mL of glycerol solution for washing). (3) Finally, add 500 μL of pre-cooled 10% glycerol (50 mL of bacterial solution concentrated 100 times) to prepare competent cells. Aliquot 90 μL per tube and freeze at -80°C until needed.

[0140] 3. Electroporation Knockout

[0141] The obtained homology arm fragments waaF-arm, LG-arm, LQ-arm and sgRNA pTarget-waaF, pTarget-LG, and pTarget-LQ plasmids were added to the competent cells in a ratio of 1:1 to 1:4, mixed gently, and placed on ice for 30 minutes; transferred to an electroporation cuvette for electroporation (1mm electroporation cuvette, 1800V, 200Ω). Immediately after electroporation, 600μL of pre-chilled LB medium was added, transferred to a 1.5mL EP tube, and incubated at 30°C for 2.5-3 hours. Then, the cells were spread onto plates containing spectinomycin and kanamycin resistance. After colonies grew at 30°C, PCR was performed to verify the knockout results. The results are shown in Figure 2, which shows the results before and after the waaF and LQ knockouts. The absence of bands indicates successful knockout.

[0142] 4. Elimination of Plasmids

[0143] The strains selected for successful deletion are plated into 2 mL of LB solution (supplemented with the antibiotic Kan), supplemented with IPTG to a final concentration of 0.5 mM, and incubated at 30°C for 12 hours to eliminate the pTarget plasmid. A small amount of the bacterial solution is streaked onto a Kan plate and incubated at 30°C. A single colony that grows is then picked and spotted on both an Spc plate and a Kan plate. Strains that grow on the Kan plate but not on the Spc plate have eliminated the pTarget plasmid. A single colony is inoculated into LB medium and incubated overnight at 37°C (42°C is also acceptable) (high temperatures cause loss of the thermosensitive pCas plasmid). A small amount of the bacterial solution is then streaked onto an antibiotic-free plate and incubated at 37°C. A single colony is then spotted onto a Kan plate and an antibiotic-free plate and incubated at 37°C. A colony that grows on the antibiotic-free plate but not on the Kan plate indicates a strain with successful plasmid elimination. This results in strains ΔF, ΔLG, and ΔLQ with the relevant genes deleted.

[0144] Example 2 Verification of LPS pathway gene knockout strains

[0145] The strains ΔF, ΔLG, and ΔLQ generated by the aforementioned knockouts were inoculated into seed culture medium and then transferred to fermentation medium for fermentation testing. The resulting fermentation broths were centrifuged at high speed, and the supernatants were collected. Colorimetric analysis revealed that the yields of the three strains were 0.3 g / L, 0.15 g / L, and 0.4 g / L, respectively (Figure 3). These results demonstrate that knockout of genes involved in the lipopolysaccharide pathway significantly promotes CA production, with the highest yield observed when the gene cluster LQ was knocked out.

[0146] Example 3 Knockout of related genes in the RcsCDB module

[0147] Using the same technical means as in Example 1, the homology arms hns-arm and lon-arm, as well as the sgRNA plasmids pTarget-hns and pTarget-lon, were constructed based on the ΔLQ strain to knock out hns (gene ID: 945829) and lon (gene ID: 945085); the relevant primer design sequences are shown in Table 2. The same method was used to carry out the competent preparation-electroporation knockout-plasmid loss steps to obtain strains ΔLQΔhns and ΔLQΔlon. The strains were then verified by shake flask analysis, and the corresponding yields are shown in Figure 4. The knockout of both genes significantly increased CA production, reaching 0.7 g / L and 0.6 g / L, respectively. Therefore, lon was further knocked out based on the ΔLQΔhns strain, resulting in the iterative knockout strain ΔLQΔhnsΔlon (Δ3), whose yield reached 1.0 g / L, as shown in Figure 4. This technical strategy shows that the knockout of genes related to the RcsCDB module can effectively achieve an increase in CA production. At the same time, the growth status of the three engineered bacteria was analyzed. As shown in Figure 4, the growth status of the three bacteria was not much different and was not significantly affected.

[0148] Example 4 Overexpression of related genes in the RcsCDB module

[0149] Analysis revealed that rcsA and rcsB play a crucial role in regulating CA biosynthesis. Therefore, overexpression of rcsA, rcsB, or a combination of rcsA and rcsB was performed to investigate the effects of different engineered strains on CA production. Using the E. coli genome as a template, rcsA (Gene ID: 946467) and rcsB (Gene ID: 947441) were amplified by PCR using primers rcsA-F / R and rcsB-F / R, respectively. Using the pRSFDuet-1 plasmid as a backbone, the two T7 promoters on the plasmid were replaced with two Ptac promoters by PCR. The newly constructed plasmid was named pTac. The amplified rcsA and rcsB genes were then ligated into plasmids to generate pTac-rcsA and pTac-rcsB, respectively. The rcsB gene fragment was then ligated into the pTac-rcsA-rcsB plasmid using the pTac-rcsA plasmid as a template. The construction process is shown in Figure 5.

[0150] The strain Δ3 constructed earlier was inoculated into a seed culture medium and prepared into a competent state for chemical transformation using a common competent state preparation method. The pTac-rcsA, pTac-rcsB, and pTac-rcsA-rcsB plasmids were then introduced, and shake flask analysis of the resulting strains revealed yields of 1.4 g / L, 0.9 g / L, and 1.6 g / L, respectively. The results showed a significant increase in yield when overexpressing rcsA alone or in combination with the rcsA-rcsB plasmids, but a slight decrease in yield when overexpressing rcsB alone was not observed. Studies have shown that rcsA regulates the gene cluster involved in CA synthesis, so overexpression of this gene increases production, which is consistent with this research. While rcsB is closely related to CA synthesis, overexpressing rcsB alone reduces production, while overexpressing both rcsB and rcsA increases production. This suggests that rcsB needs to work in conjunction with rcsA to function, and that rcsB may also be involved in the regulation of many other genes within the cell. Overexpressing rcsB alone may cause metabolic abnormalities within the cell, leading to reduced synthesis of the target product, CA. The strain overexpressing rcsA-rcsB was named Δ3AB.

[0151] Example 5 Enhanced expression of a single gene in the precursor synthesis pathway

[0152] Using the Escherichia coli genome as a template, the precursor synthesis pathway genes pgi (gene ID: 948535), pgm (gene ID: 945271), galU (gene ID: 945730), galE (gene ID: 945354), ugD (gene ID: 946571), manA (gene ID: 944840), manB (gene ID: 946574), manC (gene ID: 946580), gmd (gene ID: 946562), and fcl (gene ID: 946804) were amplified; the corresponding primers are shown in Table 2. Using the pTac plasmid constructed in Example 4 as a backbone, these genes were ligated into the plasmid to generate recombinant plasmids pTac-pgi, pTac-pgm, pTac-galU, pTac-galE, pTac-ugD, pTac-manA, pTac-manB, pTac-manC, pTac-gmd, and pTac-fcl. These plasmids were transformed into the Δ3AB strain, and the resulting recombinant strains were analyzed in shake flasks. The corresponding yields are shown in Figure 6. The results showed that when pgm, galU, galE, ugD, manA, manB, manC, gmd, and fcl were individually overexpressed, CA yields increased to varying degrees, while overexpression of pgi did not improve CA yield.

[0153] Example 6 Enhanced expression of two genes in the precursor synthesis pathway

[0154] Based on the results of Example 5, the genes that can promote CA synthesis were further combined in pairs, and the following combinations were selected: pgm-galU (MU), pgm-galE (ME), pgm-ugD (MD), galU-galE (UE), galU-ugD (UD), galE-ugD (ED), manA-manB (AB), manB-manC (BC), manB-gmd (BG), manB-fcl (BF), manC-gmd (CG), gmd-fcl (GF), galU-manB (UB), galU-manC (UC), galU-gmd (UG), galU-fcl (UF) were constructed into the pTac plasmid, and the resulting recombinant plasmid was transformed into the Δ3AB strain. The obtained recombinant strain was subjected to shake flask verification analysis, and the corresponding yield is shown in Figure 7. The results showed that the highest yield, reaching 6.2 g / L, was achieved when galU-manB was overexpressed. Overall, the results showed that when two genes are overexpressed in tandem, if only one precursor pathway is enhanced, the yield increase is limited. However, when both pathways are overexpressed simultaneously, such as UB, UC, UG, and UF, the overall expression level is higher than when the tandem expression of genes is overexpressed on both sides. This result demonstrates that it is important to consider not only gene overexpression but also the balance of metabolic fluxes within different pathways.

[0155] Example 7 Enhanced expression of multiple genes in the precursor synthesis pathway

[0156] Further investigations were conducted on the effects of three-gene enhancement of galU-galE-ugD (UED), galU-gmd-fcl (UGF), and galU-manB-manC (UBC); four-gene combination enhancement of galU-galE-manB-manC (UEBC), and galU-galE-gmd-fcl (UEGF); five-gene combination enhancement of galU-galE-manB-manC-gmd (UEBCG), and galU-galE-manB-manC-fcl (UEBCF); six-gene combination enhancement of galU-galE-manB-manC-gmd-fcl (UEBCGF), and galU-galE-ugD-manA-manB-manC (UEDABC); and seven-gene combination enhancement of galU-galE-ugD-manB-manC-gmd-fcl (UEDBCGF), and galU-galE-ugD-manA-manB-manC-gmd (UEDABCG) on CA yield. The results are shown in Figure 8. The control group was a dual-gene enhanced galU-manB strain. Overexpressing three genes resulted in a maximum yield of 8.3 g / L (UBC), which increased further to 10.3 g / L (UEGF) when four genes were overexpressed. Overexpressing five genes resulted in a maximum yield of 13.5 g / L (UEBCF), and finally, overexpressing seven genes resulted in a maximum yield of 18.7 g / L (UEDBCGF). This optimal strain was designated Δ3AB-Pa. These results demonstrate that different gene combinations can achieve varying CA yield increases.

[0157] The above-mentioned combinations are only a part of all possible combinations, and other different combinations can also achieve similar effects.

[0158] Example 8 Effect of Gene Arrangement Order on CA Yield

[0159] The optimal seven-gene combination (galU-galE-ugD-manB-manC-gmd-fcl (UEDBCGF)) obtained above achieved the highest CA yield. These genes were arranged in different orders: EDBCGFU, DBCGFUE, BCGFUED, CGFUEDB, GFUEDBC, and FUEDBCG. The resulting engineered bacteria were fermented and tested for CA yield. The results are shown in Figure 9. No significant differences in CA yield were observed among the various order combinations, indicating that similar effects can be achieved by expressing these genes in different orders.

[0160] Example 9 Promoter Optimization to Improve CA Synthesis

[0161] In previous work, the yield was increased by overexpressing the precursor pathway, but all genes were overexpressed using the pTac promoter (P1). Different promoters have a significant effect on gene expression. Here, three promoters from Escherichia coli were selected and named P2-P4. The sequences corresponding to P1 to P4 are shown in SEQ ID NO: 1-4. The expression cassette of the optimal strain Δ3AB-Pa mentioned above was constructed as P1-rcsA-rcsB-P1-galU-galE-ugD-P1-manB-manC-P1-gmd-fcl. Each expression cassette in this strain used the pTac promoter (P1). The other three different promoters were applied to this strategy to construct the following combined enhanced strains: P1-rcsA-rcsB-P2-galU-galE-ugD-P3-manB-manC-P4-gmd-fcl (strain named: Δ3AB-Pb), P2-rcsA-rcsB-P3-galU-galE-ugD-P4-manB-manC-P1-gmd-fcl (strain named: Δ3AB-Pc), P3-rcsA-rcsB-P4-galU-galE-ugD-P1-manB-manC-P2-gmd-fcl (strain named: Δ3AB-Pd), and P4-rcsA-rcsB-P1-galU-galE-ugD-P2-manB-manC-P3-gmd-fcl (strain named: Δ3AB-Pe) were obtained. The yields of these strains varied to varying degrees, with strain Δ3AB-Pc having the highest yield, reaching 16 g / L. The results are shown in Figure 10.

[0162] The promoter is not limited to P1-P4. It can be considered that similar effects can be achieved by using promoter sequences from other different sources through certain optimization.

[0163] SEQ ID NO:1:ttgacaattaatcatcggctcgtataatgtgatcagacctttgtttaactttaagaaggagatatacc

[0164] SEQ ID NO:2:ttgacagctagctcagtcctaggtataatactagt

[0165] SEQ ID NO:3:taatacgactcactatagg

[0166] SEQ ID NO:4:gtttatacataggcgagtactctgttatgg

[0167] Example 10 RBS sequence screening

[0168] A more detailed description of the expression cassette corresponding to the enhanced expression of the engineered strain Δ3AB-Pc obtained in Example 9 is shown in Figure 11. As can be seen from the figure, the expression cassette contains four different promoters, each of which is preceded by an identical RBS sequence: aagaaggaga. Since the RBS is the ribosome binding site, differences in this sequence can significantly affect the strength of its binding to the ribosome, affecting the ribosome's translation process and thus causing differences in gene expression. Therefore, we screened the RBS sequence here.

[0169] First, the green fluorescent protein gene egfp was inserted into the pTac plasmid to obtain the pTac-eGFP plasmid. Then, degenerate primers were designed and the pTac-eGFP plasmid was used as a template. After amplification with the degenerate primers 10RBS-F / R, a plasmid library containing different RBS sequences was obtained. The plasmid library was transferred into Escherichia coli, and several colonies grown were picked into 96-well plates using an automatic bacteria picker. A total of about 40,000 single colonies were picked. The well plates were then cultured under the same conditions, and the corresponding relative fluorescence intensity in each well plate was recorded after 24 hours of culture. 90 strains of bacteria with fluorescence intensity from high to low were selected, and their relative fluorescence intensities are shown in Figure 12; 9 RBS sequences ranked 1 to 9 with the highest fluorescence intensity were selected and named R H1 ~R H9 , the 9 medium-intensity RBS sequences ranked 41 to 49 were selected and named R M1 ~R M9 , 9 low-intensity RBS sequences ranked 82 to 90 were selected and named R L1 ~R L9 The RBS sequences of these 27 strains were sequenced, and the obtained sequence results are shown in Table 1.

[0170] Table 1. Different RBS sequences

[0171] Example 11 Promoter and RBS combination optimization balanced metabolic flux

[0172] The usage of the RBS corresponding to the strain Δ3AB-Pc (P2-rcsA-rcsB-P3-galU-galE-ugD-P4-manB-manC-P1-gmd-fcl) in Example 9 is shown in Figure 11. Since the same RBS is used in front of all genes, the strain obtained by this construction method has poor strain stability due to the presence of multiple identical sequences; on the other hand, the same RBS causes the expression of all genes to be too strong or too weak, which is not conducive to metabolic flux balance and product synthesis. Here, the RBS in the Δ3AB-Pc strain is replaced with all the strongest RBS sequences RH1 to RH9, or medium strength sequences RM1 to RM9, or low strength sequences RL1 to RL9, or different strength combinations. The different RBS combinations are shown below:

[0173] R H1 -R H2 -R H3 -R H4 -R H5 -R H6 -R H7 -R H8 -R H9 (Δ3AB-Pc-Ra)

[0174] R M1 -R M2 -R M3 -R M4 -R M5 -R M6 -R M7 -R M8 -R M9 (Δ3AB-Pc-Rb)

[0175] R L1 -R L2 -R L3 -R L4 -R L5 -R L6 -R L7 -R L8 -R L9 (Δ3AB-Pc-Rc)

[0176] R H1 -R H2 -R H3 -R H4 -RH5 -R H6 -R H7 -R M8 -R M9 (Δ3AB-Pc-Rd)

[0177] R H1 -R H2 -R M3 -R M4 -R M5 -R M6 -R M7 -R M8 -R M9 (Δ3AB-Pc-Re)

[0178] R M1 -R M2 -R M3 -R M4 -R M5 -R H6 -R H7 -R H8 -R H9 (Δ3AB-Pc-Rf)

[0179] R M1 -R M2 -R H3 -R H4 -R H5 -R H6 -R H7 -R H8 -R H9 (Δ3AB-Pc-Rg)

[0180] R H1 -R H2 -R L3 -R L4 -R L5 -R H6 -R H7 -R L8 -R L9 (Δ3AB-Pc-Rh)

[0181] R H1 -R H2 -R M3 -R M4 -R M5 -R M6 -R M7 -R L8 -R L9 (Δ3AB-Pc-Ri)

[0182] R H1 -R H2 -RL3 -R L4 -R L5 -R M6 -R M7 -R L8 -R L9 (Δ3AB-Pc-Rj)

[0183] The strain names are in parentheses. Fermentation tests were conducted on this series of strains. Among them, strain Δ3AB-Pc-Rj achieved the highest fermentation yield, reaching 25.8 g / L. The results are shown in Figure 13. In this optimal strain, the rcsA-rcsB genes utilize the strongest RBS sequences (RH1-RH2), while the galU-galE-ugD genes are expressed using three weak RBS sequences (RL3-RL4-RL5). Subsequently, galU-galE-ugD is expressed using a moderately strong RBS sequence (RM6-RM7), and gmd-fcl is expressed using a weak RBS sequence (RL8-RL9). Despite using all the strongest RBS sequences, strain Δ3AB-Pc-Ra achieved a yield of only 15.3 g / L, which is lower than the control. This result demonstrates that the strength and combination of RBS sequences significantly influence CA yield, and that significant increases in CA yield can be achieved through RBS sequence selection and optimization.

[0184] The listed combinations are only some of the possible combinations. Based on this strategy, many different combinations can be formed to achieve similar effects.

[0185] When the starting bacteria are Escherichia coli BL21 (DE3), JM109, Nissle 1917 (EcN), BW23110 or MG1655, the gene knockout or gene overexpression, promoter optimization, and ribosome binding site optimization of Examples 1-12 are repeated to obtain optimized strains that can achieve a significant increase in CA production.

[0186] Example 12 Knockout of the Acetate Biosynthesis Pathway Gene poxB

[0187] Using the Δ3 strain constructed in Example 3 as the starting strain, the same techniques as in Example 1 were used to construct the poxB knockout gene (gene ID: 946132) homology arm, poxB-arm, and the sgRNA plasmid, pTarget-poxB, to generate the engineered strain Δ4, which had the acetate synthesis pathway gene poxB knockout. The Δ3 and Δ4 strains were then verified by shake flask analysis, and the corresponding colanic acid production and pH changes are shown in Figure 14. The control strain Δ3 achieved a maximum yield of approximately 1.0 g / L, while the Δ4 strain, which had the acetate synthesis pathway gene knockout, reached a maximum yield of 1.8 g / L. With prolonged fermentation, the pH of the fermentation broths of both strains decreased continuously, while the pH of the Δ4 strain showed relatively little change, decreasing from an initial pH of 7.0 to pH 6.5, while the pH of the control strain decreased from pH 7.0 to pH 4.8. The results indicate that the amount of acetic acid synthesis can be reduced by blocking the pathway of acetic acid synthesis. At the same time, due to the small change in the pH of the fermentation liquid, the bacterial growth environment is more suitable for strain growth, thereby further improving the production of colanic acid.

[0188] Example 13: Genomic integration and overexpression of rcsA and rcsB

[0189] In Example 4, it was found that overexpressing rcsA and / or rcsB via plasmids significantly disrupted colanic acid synthesis. Here, the rcsA and / or rcsB genes were integrated into the engineered Δ4 genome via genomic integration. The procedure is as follows:

[0190] 1. Construction of Integration Homology Arm Fragments and sgRNA Plasmids

[0191] To integrate the rcsA and / or rcsB genes into the genome, PCR was first used to amplify 1000 bp of nucleotide sequences upstream and downstream of the integration site and the desired gene sequence. These sequences were designated rcsA-arm1, rcsA, and rcsA-arm2, respectively; and rcsB-arm1, rcsB, and rcsB-arm2, respectively. The promoter and RBS sequences were included in the primers for amplifying the rcsA and rcsB gene sequences. The corresponding upstream and downstream homology arms and gene sequences were then ligated using fusion PCR to create a single DNA fragment, rcsA-arm and rcsB-arm.

[0192] In order to construct sgRNA, the corresponding gene sequence was used as a template and the sgRNA sequence was designed online using the chopchop website. The obtained sequence was connected to the pTarget plasmid by PCR to obtain plasmids containing the corresponding gene sgRNA, namely pTarget-rcsA and pTarget-rcsB.

[0193] 2. Preparation of Competent Colorectal Cells

[0194] This step is the same as step 2 in Example 1.

[0195] 3. Electroporation Knockout

[0196] The obtained DNA fragments rcsA-arm, rcsB-arm and sgRNA pTarget-rcsA, pTarget-rcsB plasmids were added to competent cells in a ratio of 1:1 to 1:4, mixed gently, and placed on ice for 30 minutes. Transferred to an electroporation cuvette for electroporation (1mm cuvette, 1800V, 200Ω). Immediately after electroporation, 600μL of pre-chilled LB medium was added, transferred to a 1.5mL EP tube, and incubated at 30°C for 2.5-3 hours. Then, the cells were plated onto plates containing spectinomycin and kanamycin resistance. After colonies were grown at 30°C, PCR was performed to verify the knockout results.

[0197] 4. Elimination of Plasmids

[0198] The plasmid elimination step was the same as step 4 in Example 1. The resulting recombinant strains expressing rcsA, rcsB, and rcsA+rcsB were named Δ4-A, Δ4-B, and Δ4-AB, respectively. Shake flask fermentation analysis of the relevant strains is shown in Figure 15. The results show that colanic acid production increased to varying degrees when rcsA, rcsB, and rcsA+rcsB were enriched, reaching a maximum of 4.6 g / L (Δ4-AB), 2.56 times that of the control strain (Δ4). When rcsB was integrated and expressed, the yield reached 2.2 g / L, which was 0.4 g / L higher than that of the control strain. However, the results in Example 4 showed that the yield decreased by 0.1 g / L when rcsB was overexpressed by a single plasmid. The reason for this may be that when rcsB was overexpressed by a single plasmid, the expression intensity was too high, causing metabolic imbalance, which had a certain impact on the yield. However, when rcsB was overexpressed by integration, since only one copy number was added to the genome, the upregulation of rcsB was not too large. While strengthening the gene, the stability and coordination of the strain metabolism were ensured, thereby improving the strain yield.

[0199] Example 14 Overexpression of NADPH and GTP Cofactor Regeneration Pathway Genes Improves Colanic Acid Synthesis

[0200] In some enzyme catalysis processes, cofactors such as NADPH and GTP affect enzyme activity. Many enzymes in the colanic acid synthesis process require cofactors. Therefore, enhancing the cofactor synthesis pathway can increase colanic acid production. Using the protocol described in Example 13, strain Δ4-AB was overexpressed by integrating the isocitrate dehydrogenase gene icd (Gene ID: 945702), the pyridine nucleotide transhydrogenase gene pntAB (Gene IDs: 946628, 946144), and the guanosine kinase gene gsk (Gene ID: 946584), respectively, to generate recombinant strains Δ4-ABI, Δ4-ABP, and Δ4-ABG. Shake flask fermentation analysis of the relevant strains is shown in Figure 16. The results show that when icd, pntAB, and gsk were enhanced, positive results were observed, with varying degrees of increase in colanic acid production, reaching 9.5 g / L (Δ4-ABI), 7.8 g / L (Δ4-ABP), and 6.4 g / L (Δ4-ABG), respectively. The strain with the highest yield increase, Δ4-ABI, was 2.1 times higher than the control strain (Δ4-AB). OD600 values ​​showed that further enhancement of different genes slightly decreased the OD600 values ​​of the strains compared to the control, possibly due to the toxic effects of the increased cofactors on the cells.

[0201] Example 15 Construction of a strain expressing the pathway gene galU to increase colanic acid production

[0202] Based on the above-mentioned strain Δ4-ABI, the key pathway gene galU (Gene ID: 945730) was further overexpressed to obtain the engineered strain Δ4-ABIU. In shake flask testing, this strain achieved a colanic acid production of 13.2 g / L, a 38% increase over the control strain, and the strain's OD600 growth was essentially the same as that of the control strain.

[0203] Example 16 Construction of a strain overexpressing the gene of the colanic acid synthesis cluster and improvement of colanic acid production

[0204] The colanic acid biosynthesis cluster contains over a dozen genes related to colanic acid synthesis, which work synergistically to control colanic acid synthesis. wcaJ (Gene ID: 946583) is the first step in colanic acid polymerization, transferring UDP-glucose to initiate the first step of synthesis; wcaD (Gene ID: 946550) encodes colanic acid polymerase, which polymerizes the building blocks into the macromolecule colanic acid. Here, strain Δ4-ABIU was further overexpressed with wcaJ, wcaD, and wcaJ+wcaD to generate engineered strains Δ4-ABIUJ, Δ4-ABIUD, and Δ4-ABIUJD. Shake flask fermentation analysis of the relevant strains is shown in Figure 17. The results showed that colanic acid production increased to varying degrees, reaching 17.9 g / L (Δ4-ABIUJ), 17.4 g / L (Δ4-ABIUD), and 23.2 g / L (Δ4-ABIUJD), respectively. The strain with the highest yield increase, Δ4-ABIUJD, showed a 75.7% increase over the control strain (Δ4-ABIU). Analysis of the OD600 values ​​for the different strains revealed essentially identical growth patterns, indicating no significant effect of overexpression of the relevant genes.

[0205] Example 17 5-L fermentation tank scale-up verification of strain production performance

[0206] The optimal production strain Δ3AB-Pc-Rj obtained in Example 11 achieved a yield of 25.8 g / L in a shake flask test, and the optimal production strain Δ4-ABIUJD obtained in Example 16 achieved a maximum yield of 23.2 g / L in a shake flask test. Here, the two strains were further scaled up to a 5-L fermenter for comparison and verification of their production performance. The strain yield comparison results are shown in Figure 18. The maximum yields of strains Δ3AB-Pc-Rj and Δ4-ABIUJD in a 5-L fermenter reached 63.0 g / L and 68.2 g / L, respectively. Both strains reached the highest fermentation point within 24 hours, which is also the strain with the highest yield and production efficiency reported so far. Analysis of the alkali solution addition situation found that the final alkali solution addition amount of strain Δ3AB-Pc-Rj was 80mL / L, while the alkali solution addition amount of Δ4-ABIUJD was 30mL / L, indicating that strain Δ4-ABIUJD produced less acid during the fermentation process, which may also be one of the reasons why the yield of this strain was higher than that of the Δ3AB-Pc-Rj strain when it was finally scaled up.

[0207] When the starting bacteria are Escherichia coli BL21 (DE3), JM109, Nissle 1917 (EcN), BW23110 or MG1655, the gene knockout, gene overexpression or optimization of Examples 1-3 and Examples 12-17 are repeated to obtain optimized strains that can achieve a significant increase in CA production.

[0208] Incorporated by Reference

[0209] Each patent and scientific document mentioned herein is incorporated by reference in its entirety for all purposes.

[0210] Equivalence

[0211] The present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. Therefore, the above embodiments should be considered in all cases as illustrative rather than limiting of the invention described herein. The scope of the present invention is therefore indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalence of the claims are intended to be embraced therein.

Claims

1. A recombinant engineered bacterium, wherein: The recombinant engineering bacteria a) The lipopolysaccharide core polysaccharide synthesis gene cluster waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG and waaQ on the genome were knocked out; at the same time, the Lon protein encoding gene lon and the HNS regulatory protein encoding gene hns were knocked out; b) Overexpression of the gene rcsA encoding the DNA-binding transcription activator RcsA and the gene rcsB encoding the DNA-binding transcription activator RcsB; c) Overexpressed the gene encoding UTP-1-glucose uridylyltransferase galU, UDP-glucose-4-isomerase galE, UDP-glucose-6-dehydrogenase ugD, phosphomannanase manB, mannose-1-phosphate guanylyltransferase manC, GDP-mannose-4,6-dehydrogenase gmd, and GDP-L-fucose synthase fcl.

2. The recombinant engineered bacterium according to claim 1, wherein The overexpressed genes in b) and c) are derived from any one of Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces, or Streptomyces, preferably Escherichia coli.

3. The recombinant engineered bacterium according to claim 1, wherein The Ptac promoter is used in the recombinant engineering bacteria to enhance the expression of rcsA, rcsB, galU, galE, ugD, manB, manC, gmd and fcl genes.

4. The recombinant engineered bacterium according to claim 3, wherein In the recombinant engineered bacteria, Ptac promoter P2 is used to enhance the expression of rcsA and rcsB, Ptac promoter P3 is used to enhance the expression of galU, galE and ugD, and Ptac promoter P4 is used to enhance the expression of manB and manC; Ptac promoter P1 is used to enhance the expression of gmd and fcl, wherein the sequence of P1 includes SEQ ID NO:1, the sequence of P2 includes SEQ ID NO:2, the sequence of P3 includes SEQ ID NO:3, and the sequence of P4 includes SEQ ID NO:

4.

5. The recombinant engineered bacterium according to any one of claims 1 to 4, wherein The 5′ ends of the rcsA, rcsB, galU, galE, ugD, manB, manC, gmd and fcl genes are all connected to the ribosome binding site RBS sequence.

6. The recombinant engineered bacterium of claim 5, wherein the ribosome binding site (RBS) sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 5-31.

7. The recombinant engineered bacterium according to any one of claims 1 to 6, wherein The 5′ end of rcsA is connected to the ribosome binding site RBS sequence R H1 The 5′ end of rcsB is connected to the ribosome binding site RBS sequence R H2 The 5′ end of galU is connected to the ribosome binding site RBS sequence R L3 The 5′ end of galE is connected to the ribosome binding site RBS sequence R L4 The 5′ end of ugD is connected to the ribosome binding site RBS sequence R L5 The 5′ end of manB is connected to the ribosome binding site RBS sequence R M6 The 5′ end of manC is connected to the ribosome binding site RBS sequence R M7 The 5′ end of GMD is connected to the ribosome binding site RBS sequence R L8 The 5′ end of fcl is connected to the ribosome binding site RBS sequence R L9 ;in The R H1 The sequence includes SEQ ID NO: 5; The R H2 The sequence includes SEQ ID NO: 6; The R L3 The sequence includes SEQ ID NO:25; The R L4 The sequence includes SEQ ID NO:26; The R L5 The sequence includes SEQ ID NO:27; The R M6 The sequence includes SEQ ID NO: 19; The R M7 The sequence includes SEQ ID NO: 20; The R L8 The sequence includes SEQ ID NO:30; The R L9 The sequence includes SEQ ID NO:

31.

8. The recombinant engineered bacterium according to any one of claims 1 to 7, wherein the recombinant engineered bacterium is selected from any one of the Enterobacteriaceae, more preferably selected from Escherichia coli BL21 (DE3), JM109, Nissle 1917 (EcN), BW23110 or MG1655.

9. A method for constructing an engineered bacterium for producing colanic acid, comprising: a) knocking out the lipopolysaccharide core polysaccharide synthesis gene cluster waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaS, waaP, waaG, waaQ in the genome, and knocking out the Lon protein encoding gene lon and the HNS regulatory protein encoding gene hns at the same time; b) Overexpression of the gene rcsA encoding the DNA-binding transcription activator RcsA and the gene rcsB encoding the DNA-binding transcription activator RcsB; c) Overexpression of galU, galE, ugD, manB, manC, gmd and fcl genes.

10. The method of claim 9, wherein: The overexpressed genes in b) and c) are derived from any one of Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces, or Streptomyces, preferably Escherichia coli.

11. The method of claim 9, wherein the Ptac promoter is used in the recombinant engineered bacteria to enhance the expression of rcsA, rcsB, galU, galE, ugD, manB, manC, gmd and fcl genes.

12. The method of claim 11, wherein In the recombinant engineering bacteria, Ptac promoter P2 is used to enhance the expression of rcsA and rcsB, Ptac promoter P3 is used to enhance the expression of galU, galE and ugD, Ptac promoter P4 is used to enhance the expression of manB and manC; Ptac promoter P1 is used to enhance the expression of gmd and fcl, wherein, The sequence of P1 includes SEQ ID NO:1, the sequence of P2 includes SEQ ID NO:2, the sequence of P3 includes SEQ ID NO:3, and the sequence of P4 includes SEQ ID NO:

4.

13. The method of any one of claims 9 to 12, wherein The 5′ ends of the rcsA, rcsB, galU, galE, ugD, manB, manC, gmd and fcl genes are all connected to the ribosome binding site RBS sequence.

14. The method of any one of claims 13, wherein the ribosome binding site (RBS) sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 5-31.

15. The method according to any one of claims 13 or 14, wherein: The 5′ end of rcsA is connected to the ribosome binding site RBS sequence R H1 The 5′ end of rcsB is connected to the ribosome binding site RBS sequence R H2 The 5′ end of galU is connected to the ribosome binding site RBS sequence R L3 The 5′ end of galE is connected to the ribosome binding site RBS sequence R L4 The 5′ end of ugD is connected to the ribosome binding site RBS sequence R L5 The 5′ end of manB is connected to the ribosome binding site RBS sequence R M6 The 5′ end of manC is connected to the ribosome binding site RBS sequence R M7 The 5′ end of GMD is connected to the ribosome binding site RBS sequence R L8 The 5′ end of fcl is connected to the ribosome binding site RBS sequence R L9 ;in The R H1 The sequence includes SEQ ID NO: 5; The R H2 The sequence includes SEQ ID NO: 6; The R L3 The sequence includes SEQ ID NO:25; The R L4 The sequence includes SEQ ID NO:26; The R L5 The sequence includes SEQ ID NO:27; The R M6 The sequence includes SEQ ID NO: 19; The R M7 The sequence includes SEQ ID NO: 20; The R L8 The sequence includes SEQ ID NO:30; The R L9 The sequence includes SEQ ID NO:

31.

16. The method according to any one of claims 9 to 15, wherein the engineered bacteria is selected from any one of the Enterobacteriaceae, more preferably selected from Escherichia coli BL21 (DE3), JM109, Nissle 1917 (EcN), BW23110 or MG1655.

17. Use of the recombinant engineered bacteria according to any one of claims 1 to 8 in the preparation of a product for producing colanic acid.

18. A recombinant engineered bacterium, wherein: The recombinant engineering bacteria a) The lipopolysaccharide core polysaccharide synthesis gene cluster waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG and waaQ on the genome were knocked out; at the same time, the Lon protein encoding gene lon and the HNS regulatory protein encoding gene hns were knocked out; b) Knockout of the acetate biosynthesis pathway gene poxB; c) Overexpression of rcsA, a gene encoding a DNA transcription activator, and rcsB, a gene encoding a DNA binding transcription activator; d) Overexpression of isocitrate dehydrogenase gene icd, a gene related to promoting NADPH regeneration, and / or pyridine nucleotide transhydrogenase encoding gene pntAB; integration expression of guanine nucleoside kinase encoding gene gsk, a gene related to GTP regeneration; e) overexpression of UDP-1-phosphate glucose uridyl transferase encoding gene galU; f) overexpression of the colanic acid biosynthesis cluster-related genes, UDP-glucose-1-phosphotransferase encoding gene wcaJ and / or colanic acid polymerase encoding gene wcaD; 19. The recombinant engineered bacterium according to claim 18, wherein The overexpressed gene in c) to f) is derived from any one of Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces, or Streptomyces, preferably Escherichia coli.

20. A method for constructing a colanic acid recombinant engineered bacterium, comprising: a) knocking out the lipopolysaccharide core polysaccharide synthesis gene cluster waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG and waaQ, the Lon protein encoding gene lon and the HNS regulatory protein encoding gene hns in the genome; b) Knockout of the acetate biosynthesis pathway gene poxB; c) overexpressing the DNA transcription activator encoding gene rcsA and the DNA binding transcription activator encoding gene rcsB by genomic integration; d) Overexpression of isocitrate dehydrogenase gene icd, a gene related to promoting NADPH regeneration, and / or pyridine nucleotide transhydrogenase encoding gene pntAB; integration expression of guanine nucleoside kinase encoding gene gsk, a gene related to GTP regeneration; e) overexpression of UDP-1-phosphate glucose uridyl transferase encoding gene galU; f) Overexpression of the colanic acid biosynthesis cluster-related genes, UDP-glucose-1-phosphotransferase encoding gene wcaJ and / or colanic acid polymerase encoding gene wcaD.

21. The recombinant engineered bacterium according to claim 20, wherein The overexpressed gene in c) to f) is derived from any one of Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Kluyveromyces, or Streptomyces, preferably Escherichia coli.

Images