Multifunctional protein MZM29 and application thereof

Abstract

The invention provides a multifunctional protein MZM29 and application thereof, and belongs to the technical field of biological medicine. The multifunctional protein MZM29 or the homologous multifunctional protein of the MZM29 provided by the invention comprises an amino acid sequence as shown in any one of SEQ ID NO.1-12; or a partial segment comprising any one or more of the amino acid sequences shown as SEQ ID NO.1-12, or a partial segment comprising any one or more of the amino acid sequences shown as SEQ ID NO.1-12; or a sequence having more than 80% of homology with any one amino acid sequence of SEQ ID NO.1-12. The multifunctional protein MZM29 has relatively good antibacterial and anti-inflammatory effects, and shows antiviral activity to HPV16 and HPV18. Good application prospects are shown in preparation of antibacterial, anti-inflammatory or anti-virus products.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a multifunctional protein MZM29 and applications thereof. Background Art

[0002] Antibiotics are a widely used class of drugs in the pharmaceutical field. Since the successful development of penicillin, antibiotics have played a vital role in the treatment of human diseases. In animal husbandry and aquaculture, antibiotics are primarily used to prevent animal diseases and promote growth. However, with the widespread use of antibiotics, problems such as overuse and resistance have gradually emerged. Bacterial resistance to antibiotics is increasing, causing many antibiotics to lose their effectiveness and posing a serious threat to public health. Overuse of antibiotics can lead to adverse reactions such as intestinal dysbiosis, liver and kidney damage, and even death from serious infections caused by overuse of antibiotics. Currently, the evolution of bacterial resistance is far faster than the development of new antibiotics. If this continues, the overuse of antibiotics will continue to exacerbate the challenges of preventing and treating bacterial diseases in humans and animals, necessitating an urgent need for innovative alternatives to antibiotics.

[0003] Bioprotein, also known as bioactive protein or active protein peptide, is a general term for peptides composed of naturally occurring amino acids in proteins in various compositions and arrangements, ranging from dipeptides to complex linear and cyclic structures. These multifunctional compounds are derived from proteins. Bioprotein has numerous metabolic and physiological regulatory functions, is easily digestible and absorbable, and has immune-boosting, hormone-regulating, antibacterial, antiviral, and blood pressure-lowering, lipid-lowering properties. It is highly safe for consumption, making it a hot research topic in the international food industry and a promising functional factor.

[0004] As part of animal and plant autoimmunity, bioproteins are less likely to lead to the development of drug-resistant strains due to their antimicrobial mechanisms, which differ from those of traditional antibiotics. Therefore, bioproteins are considered the most promising antibiotic alternatives. LL-37 is a cationic antimicrobial peptide composed of 37 amino acids, produced by cleavage of the C-terminus of the 18kDa human hCAP18 protein. It has an α-helical structure and carries six positive charges. LL-37 exhibits antimicrobial activity against many Gram-positive and Gram-negative bacteria and fungi, as well as immunomodulatory effects, and is considered a potential alternative to conventional antibiotics.

[0005] The development of multifunctional proteins with better antibacterial, anti-inflammatory and antiviral activities is a hot topic in current research. Patent CN118878628A discloses a highly efficient and stable self-assembling protein peptide RW7 and its preparation method and application. The protein peptide RW7 has an excellent inhibitory effect on aquatic pathogens. It also has an excellent inhibitory effect on common Gram-negative and Gram-positive bacteria. Patent CN118930615A discloses a biological peptide and its application in antibacterial and bactericidal activities. The biological peptide has the characteristics of a broad antibacterial spectrum and strong antibacterial activity, low hemolytic activity, no cytotoxicity and high stability.

[0006] Therefore, providing a multifunctional protein MZM29 with antibacterial, anti-inflammatory and antiviral effects and its homologous multifunctional proteins have shown good application prospects in the preparation of antibacterial, anti-inflammatory or antiviral products. Summary of the Invention

[0007] To address the above-mentioned deficiencies, the present invention provides a multifunctional protein MZM29 and its applications. The multifunctional protein MZM29 or a multifunctional protein homologous to MZM29 provided by the present invention comprises an amino acid sequence as shown in any one of SEQ ID NOs. 1-12; or a partial segment of any one or more of the amino acid sequences as shown in SEQ ID NOs. 1-12; or a sequence having greater than 80% homology with any one of the amino acid sequences in SEQ ID NOs. 1-12. The multifunctional protein MZM29 has good antibacterial and anti-inflammatory effects and exhibits antiviral activity against HPV16 and HPV18. It shows good application prospects in the preparation of antibacterial, anti-inflammatory, or antiviral products.

[0008] The amino acid letters in the present invention have the following meanings:

[0009] A stands for alanine; C stands for cysteine; D stands for aspartic acid; E stands for glutamic acid; F stands for phenylalanine; G stands for glycine; H stands for histidine; I stands for isoleucine; K stands for lysine; L stands for leucine; M stands for methionine; N stands for asparagine; P stands for proline; Q stands for glutamine; R stands for arginine; S stands for serine; T stands for threonine; V stands for valine; W stands for tryptophan; and Y stands for tyrosine.

[0010] In the present invention, "codon degeneracy" refers to the phenomenon that the same amino acid has two or more codons. In particular, the degeneracy of cytosine and uracil or guanine and adenine at the third position of the codon is often equal.

[0011] In the present invention, a "recombinant vector" refers to a vector capable of expressing a desired protein by inserting a nucleic acid molecule corresponding to the desired protein into a vector backbone. Typically, the vector backbone is a plasmid, but other vector backbones that can serve the same purpose are also possible. The "recombinant vector" can be used to transfect cells and express the protein in the cells.

[0012] In the present invention, "genetically engineered cells" refer to cells transformed by genetic engineering methods, and the genetic engineering methods may be plasmid transformation or cell fusion.

[0013] In the present invention, "Gram-negative bacteria" and "Gram-positive bacteria" refer to bacteria that have been stained with crystal violet solution and iodine solution, decolorized with alcohol, and then stained with dilute fuchsin solution. After this treatment, bacteria that are stained purple are Gram-positive bacteria, and those that are stained red are Gram-negative bacteria.

[0014] The technical solution of the present invention is:

[0015] In a first aspect, the present invention provides a multifunctional protein MZM29 or a multifunctional protein homologous to MZM29, characterized in that the multifunctional protein MZM29 or a multifunctional protein homologous to MZM29 has an amino acid sequence as shown in any one of the following:

[0016] (1) comprising the amino acid sequence shown in any one of SEQ ID NOs. 1-12; or

[0017] (2) comprising a partial segment of any one or more of the amino acid sequences shown in SEQ ID NOs. 1-12; or

[0018] (3) A sequence having more than 80% homology with any one of the amino acid sequences of SEQ ID NO. 1-12.

[0019] The SEQ ID NO. 1 is (5'→3'): MGRFKSFLKKFKKLFRRITPVIP.

[0020] The SEQ ID NO. 2 is (5'→3'): LGRFSSFLKKFKKLFRRITGVIP.

[0021] The SEQ ID NO. 3 is (5'→3'): VGRFLSFLKKFKLLFRRITSVIP.

[0022] The SEQ ID NO. 4 is (5'→3'): LGFFKSFLKKFKRLFKKISPVIS.

[0023] The SEQ ID NO. 5 is (5'→3'): GARFKSFLTKFTKLFKRITPVIT.

[0024] The SEQ ID NO. 6 is (5'→3'): VGRFKSWLRKFKKLFRKITTVIT.

[0025] The SEQ ID NO. 7 is (5'→3'): FKFFSRKIPVKKGPTFRLLRILK.

[0026] The SEQ ID NO. 8 is (5'→3'): KFLLPKKKRLFTIRKFRGPVFIS.

[0027] The SEQ ID NO. 9 is (5'→3'): LGFSKSFLKKFKRLFKKISPVIS.

[0028] The SEQ ID NO. 10 is (5'→3'): VARFKSFLKKFTKKFKRITPVIS.

[0029] The SEQ ID NO. 11 is (5'→3'): VGRFLRWLLKKKLLFRRITSVIP.

[0030] The SEQ ID NO. 12 is (5'→3'): LGFFSRKIPVKKGPTFRITPVIP.

[0031] Preferably, the amino acid sequence of the multifunctional protein MZM29 or a multifunctional protein homologous to MZM29 is shown as SEQ ID NO. 1-12.

[0032] Specifically, the multifunctional protein MZM29 has an amino acid sequence as shown in any one of the following:

[0033] (1) comprising the amino acid sequence shown in SEQ ID NO. 1; or

[0034] (2) comprising a portion of the amino acid sequence shown in SEQ ID NO. 1; or

[0035] (3) A sequence having more than 80% homology with the amino acid sequence of SEQ ID NO.1.

[0036] Preferably, the amino acid sequence of the multifunctional protein MZM29 is shown in SEQ ID NO.1.

[0037] Specifically, the MZM29 homologous multifunctional protein is multifunctional protein 1-multifunctional protein 11.

[0038] Preferably, the MZM29 homology multifunctional protein has an amino acid sequence as shown in any one of the following:

[0039] (1) comprising the amino acid sequence shown in any one of SEQ ID NOs. 2-12; or

[0040] (2) comprising a partial segment of any one or more of the amino acid sequences shown in SEQ ID NOs. 2-12; or

[0041] (3) A sequence having more than 80% homology with any one of the amino acid sequences of SEQ ID NO. 2-12.

[0042] Preferably, the amino acid sequence of the MZM29 homologous multifunctional protein is shown in SEQ ID NO. 2-12.

[0043] In a second aspect, the present invention provides a coding gene, wherein the coding gene encodes the multifunctional protein MZM29 or a multifunctional protein homologous to MZM29.

[0044] Specifically, the encoding gene encodes the multifunctional protein MZM29.

[0045] Preferably, the coding gene comprises the nucleotide sequence shown in SEQ ID NO.13; or a partial segment of the nucleotide sequence shown in SEQ ID NO.13; or a nucleotide sequence after base substitution of SEQ ID NO.13 according to codon degeneracy.

[0046] Further preferably, the base substitution is to replace the bases on the nucleic acid molecule sequence from one type to another, but the substitution does not affect the amino acid sequence of the final expression product.

[0047] The SEQ ID NO.13 is (5'→3'):

[0048] ATGGGAAGGTTCAAATCATTTCTAAAGAAATTCAAAAAGCTGTTTCGCCGTATTACCCCGGTGATCCCGTAA.

[0049] In a third aspect, the present invention provides a recombinant vector comprising the above-mentioned encoding gene.

[0050] Specifically, the recombinant vector also includes a promoter for driving the expression of the encoding gene.

[0051] Preferably, the promoter is a T7 promoter.

[0052] Specifically, the skeleton of the recombinant vector includes but is not limited to: pET-28a vector, pRSFDuet-1 vector, pETDuet-1 vector, pACYCDuet-1 vector or pTrc99a vector.

[0053] Preferably, the backbone of the recombinant vector is a pET-28a vector.

[0054] Preferably, the coding gene is located between the NcoI restriction site and the XhoI restriction site of the vector.

[0055] In a fourth aspect, the present invention provides a genetically engineered cell, wherein the genetically engineered cell expresses the above-mentioned recombinant vector.

[0056] Specifically, the host cells of the genetically engineered cells include, but are not limited to, one or more of Escherichia coli, Pichia pastoris, and Bacillus subtilis.

[0057] Preferably, the genetically engineered cell is Escherichia coli.

[0058] More preferably, the genetically engineered cell is BL21 (DE3) Plys Escherichia coli.

[0059] In a fifth aspect, the present invention provides a cell preparation, which is prepared by the above-mentioned genetically engineered cells, and the cell preparation includes a lysate and / or a culture.

[0060] In a sixth aspect, the present invention provides the use of the above-mentioned multifunctional protein MZM29 or MZM29 homologous multifunctional protein, encoding gene, recombinant vector, genetically engineered cell or cell preparation in the preparation of antibacterial products, anti-inflammatory products or antiviral products.

[0061] Specifically, the antibacterial product targets one or more of Gram-negative bacteria, Gram-positive bacteria, and fungi.

[0062] Preferably, the Gram-negative bacteria include one or more of Acinetobacter baumannii, Enterobacter aerogenes, Enterobacter cloacae, Escherichia coli, Enterobacter hallii, Klebsiella pneumoniae, Moraxella catarrhalis, Haemophilus influenzae, Haemophilus parahaemolyticus, Haemophilus haemolyticus, Stenotrophomonas maltophilia, Haemophilus parainfluenzae, and Pseudomonas aeruginosa.

[0063] Preferably, the Gram-positive bacteria include one or more of Enterococcus faecium, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Listeria monocytogenes, Staphylococcus aureus, and Streptococcus agalactiae.

[0064] Preferably, the fungus comprises Candida krusei.

[0065] Preferably, the antiviral product targets HPV16 virus and / or HPV18 virus.

[0066] Preferably, the anti-inflammatory product inhibits the secretion of pro-inflammatory factors by blocking the binding of LPS to Toll-like receptors.

[0067] Further preferably, the pro-inflammatory factors include one or more of TNF-α, IL-6, and NO.

[0068] Preferably, the antibacterial products include antibacterial drugs, antibacterial food additives, cosmetic preservatives or antibacterial daily necessities.

[0069] Preferably, the anti-inflammatory product includes an anti-inflammatory drug or an anti-inflammatory cosmetic.

[0070] Preferably, the antiviral product comprises an antiviral drug.

[0071] In a seventh aspect, the present invention provides a drug comprising the above-mentioned multifunctional protein MZM29 or MZM29 homologous multifunctional protein, encoding gene, recombinant vector, genetically engineered cell or cell preparation.

[0072] Preferably, the drug has one or more of antibacterial, anti-inflammatory, and antiviral effects.

[0073] Specifically, the dosage form of the drug includes a parenteral dosage form or a gastrointestinal dosage form.

[0074] Preferably, the dosage forms for administration via the gastrointestinal tract include but are not limited to tablets, powders, granules, solutions, capsules, emulsions, suspensions, and oils.

[0075] Preferably, the non-gastrointestinal dosage form includes but is not limited to an injection dosage form, a respiratory tract dosage form, a skin dosage form, a mucosal dosage form and a cavity dosage form.

[0076] Specifically, the drug further includes one or more pharmaceutically acceptable excipients.

[0077] Preferably, the pharmaceutically acceptable excipients include, but are not limited to, solvents, diluents, disintegrants, precipitation inhibitors, surfactants, glidants, adhesives, lubricants, dispersants, suspending agents, isotonic agents, thickeners, emulsifiers, preservatives, stabilizers, hydrating agents, emulsification accelerators, buffers, absorbents, colorants, flavoring agents, sweeteners, ion exchangers, release agents, coating agents, flavoring agents, or antioxidants.

[0078] In an eighth aspect, the present invention provides an antibacterial food additive, which comprises the above-mentioned multifunctional protein MZM29 or MZM29 homologous multifunctional protein, encoding gene, recombinant vector, genetically engineered cell or cell preparation.

[0079] Specifically, the food includes human food or animal food.

[0080] Specifically, the food includes but is not limited to candy flakes, soy milk, yogurt, canned food, biscuits, chocolate, cakes, cream, cheese, milk powder, ice cream, popsicles, jam, puree, candied fruit, preserved fruit, bread, egg rolls, protein drinks, solid drinks, lactic acid bacteria drinks, plant protein drinks, carbonated drinks, coffee, puffed food or health food.

[0081] Preferably, the health food includes tea products, granules, medicinal wine, capsules, fruit juice, fruit vinegar, granules, fermented milk products, fermented cereal products, fermented bean products, powders, honey pastes or meal replacement powders.

[0082] Further preferably, the health food further comprises conventional health food excipients, which include but are not limited to fillers, flavoring agents, binders, disintegrants, lubricants, antacids or nutritional enhancers.

[0083] In a ninth aspect, the present invention provides a cosmetic preservative, wherein the cosmetic preservative comprises the above-mentioned multifunctional protein MZM29 or MZM29 homologous multifunctional protein, encoding gene, recombinant vector, genetically engineered cell or cell preparation.

[0084] Specifically, the anti-inflammatory cosmetics include cleansers, toners, lotions, creams, essences, facial masks, foundations, concealers, sunscreens, sunscreen sprays, shampoos, conditioners, shower gels, foams, patches, makeup powders, cotton pads, eye essences, eye masks, eye shadows, eye gels or eye creams.

[0085] In a tenth aspect, the present invention provides an antibacterial daily necessity, comprising the above-mentioned multifunctional protein MZM29 or MZM29 homologous multifunctional protein, encoding gene, recombinant vector, genetically engineered cell or cell preparation.

[0086] Preferably, the daily necessities include toiletries, household products, hygiene products, kitchen products or baby products.

[0087] In an eleventh aspect, the present invention provides an anti-inflammatory cosmetic comprising the multifunctional protein MZM29 or a multifunctional protein homologous to MZM29, an encoding gene, a recombinant vector, a genetically engineered cell or a cell preparation.

[0088] Specifically, the anti-inflammatory cosmetics include cleansers, toners, lotions, creams, essences, facial masks, foundations, concealers, sunscreens, sunscreen sprays, shampoos, conditioners, shower gels, foams, patches, makeup powders, cotton pads, eye essences, eye masks, eye shadows, eye gels or eye creams.

[0089] Specifically, the anti-inflammatory cosmetic further includes cosmetically acceptable additives.

[0090] Preferably, the additives include but are not limited to: one or more of diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, cosolvents, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH regulators, antioxidants, and buffers.

[0091] The beneficial effects of the present invention are:

[0092] The multifunctional protein MZM29 or a multifunctional protein homologous to MZM29 provided herein comprises an amino acid sequence as set forth in any one of SEQ ID NOs. 1-12; or a partial segment of any one or more of the amino acid sequences as set forth in SEQ ID NOs. 1-12; or a sequence sharing at least 80% homology with any one of the amino acid sequences as set forth in SEQ ID NOs. 1-12. The multifunctional protein MZM29 exhibits significant antibacterial and anti-inflammatory effects and exhibits antiviral activity against HPV16 and HPV18. It demonstrates promising application prospects in the preparation of antibacterial, anti-inflammatory, or antiviral products. BRIEF DESCRIPTION OF THE DRAWINGS

[0093] Figure 1 The effect of the tested drugs on THP-1 cell viability; ns represents no significant difference; ** represents P < 0.01.

[0094] Figure 2 The effect of the tested drugs on the production of nitric oxide in THP-1 cells; ns in the figure represents no significant difference.

[0095] Figure 3 The effect of the tested drugs on TNF-α secretion in THP-1 cells; ns represents no significant difference; * represents P < 0.05; ** represents P < 0.01.

[0096] Figure 4 The effect of the tested drugs on IL-6 secretion in THP-1 cells; ns represents no significant difference; ** represents P < 0.01.

[0097] Figure 5Figure 2 is the effect of the tested drug on the viability of DS-1 cells; Figure A is the effect of the multifunctional protein MZM29 on the viability of DS-1 cells; Figure B is the effect of LL-37 on the viability of DS-1 cells.

[0098] Figure 6 It is the inhibitory effect of the tested drug on the activity of DS-1 cells.

[0099] Figure 7 EC50 is the median effective dose 50 Schematic diagram of sample loading.

[0100] Figure 8 The half cytotoxic concentration CC 50 Schematic diagram of sample loading.

[0101] Figure 9 These are the results of the anti-HPV16 activity experiment of the multifunctional protein MZM29.

[0102] Figure 10 These are the results of the anti-HPV18 activity experiment of the multifunctional protein MZM29.

[0103] Figure 11 These are the results of the cytotoxicity experiment of the multifunctional protein MZM29.

[0104] Figure 12 This is the effect of multifunctional protein 1-multifunctional protein 11 on nitric oxide production in THP-1 cells.

[0105] Figure 13 This is the effect of multifunctional protein 1-multifunctional protein on TNF-α secretion in THP-1 cells. DETAILED DESCRIPTION

[0106] In order to make the technical means, creative features, purpose and efficacy of the present invention easy to understand, the present invention is further illustrated below in conjunction with specific examples, but the following examples are only preferred embodiments of the present invention, not all. Based on the examples in the implementation manner, other embodiments obtained by those skilled in the art without making creative work are all within the scope of protection of the present invention. In the following examples, unless otherwise specified, the operating methods used are all conventional operating methods, the equipment used are all conventional equipment, and the equipment and materials used in each embodiment are all the same.

[0107] Example 1 Genetically engineered strain expressing multifunctional protein MZM29

[0108] The synthesized gene fragment SEQ ID NO. 13 was inserted between the NcoI and XhoI restriction sites of the pET-28a vector to generate the vector pET-28a-MZM29. The expression vector pET-28a-MZM29 was transformed into BL21(DE3)Plys Escherichia coli using the heat shock method, and positive clones were screened. The resulting recombinant E. coli, named BL21(DE3)Plys-MZM29, was able to highly express the multifunctional protein MZM29.

[0109] Recombinant Escherichia coli BL21(DE3) Plys-MZM29 was cultured as a seed, then inoculated into LB medium for fermentation. The culture broth was centrifuged, the precipitated cells were collected, and the cells were resuspended. The resuspension was ultrasonically disrupted, and the supernatant was collected and purified to obtain the multifunctional protein MZM29.

[0110] Multifunctional proteins 1 to 11 were prepared in a similar manner to that of this example.

[0111] Example 2 Antibacterial activity of the multifunctional protein MZM29

[0112] 1. Test strains

[0113] The strains used in this example are shown in Table 1:

[0114] Table 1

[0115]

[0116]

[0117] Note: In the table, "a" represents MHIIB; "b" represents MHIIB+5% lysed horse blood; "c" represents HTM; "d" represents RPMI1640+MOPs.

[0118] 2. Main reagents

[0119] The main reagents used in this example are shown in Table 2:

[0120] Table 2

[0121]

[0122]

[0123] 3. Preparation of test samples and positive control drugs

[0124] Preparation of stock solution: On the day of the experiment, the test sample (multifunctional protein MZM29) and the positive control drug were dissolved into stock solution, as shown in Table 3.

[0125] Table 3

[0126]

[0127] 4. MIC test method

[0128] 4.1 Aerobic bacteria MIC test

[0129] Aerobic bacteria: Inoculate the bacterial strain onto a plate in advance and incubate overnight at 35°C. On the day of the experiment, adjust the bacterial concentration to a turbidity of 0.2.

[0130] The bacterial suspension was diluted with the corresponding liquid culture medium, and then 50 μl was transferred to a 96-well round-bottom plate with 50 μl of working solution to obtain a test plate. The bacterial concentration was 5×10 5 The 96-well round-bottom plate obtained above was placed in an incubator at 35°C for 20 hours.

[0131] 4.2 MIC test for anaerobic and microaerophilic bacteria

[0132] Aliquot 30 μl of the prepared 100× test sample and positive control drug working solution into a 6-well plate, then add 3 ml of the prepared test agar medium, mix thoroughly, and cool to solidify.

[0133] For anaerobic bacteria, inoculate the desired strain on the blood plate in advance and culture it in an anaerobic environment. On the day of the experiment, pick some colonies from the plate, adjust the turbidity to 0.2, and then use the workstation to inoculate 2μl onto the blood plate containing the drug. 5 After the inoculum was absorbed by the plate, the blood plate was inverted and incubated at 35°C in an anaerobic environment for 2 days.

[0134] 4.3 Fungal MIC test

[0135] Fungi: Inoculate the strain on the plate in advance and culture in an incubator at 35°C. For yeast, adjust the bacterial concentration to a turbidity of 0.2 on the day of the experiment and dilute with the corresponding liquid culture medium. The yeast concentration is 1-5×10 3 Transfer 100 μl to a 96-well round-bottom plate containing 100 μl of the working solution to obtain a test plate. Place the 96-well round-bottom plate obtained above in a 35°C incubator and culture the yeast for 24 hours.

[0136] 4.4MIC reading

[0137] The lowest test sample / positive control drug concentration at which bacterial growth is completely or significantly inhibited by visual observation will be defined as the MIC of the test sample / positive control drug.

[0138] 5. Experimental results

[0139] The minimum inhibitory concentrations (MICs) of the multifunctional protein MZM29 against the strains are shown in Tables 4-32 ("NA" indicates no inhibitory effect). The MICs of the positive control drugs against the quality control strains were all within the CLSI reference range. Therefore, the test data are reliable.

[0140] Table 4

[0141]

[0142]

[0143] Table 5

[0144]

[0145] Table 6

[0146]

[0147] Table 7

[0148]

[0149]

[0150] Table 8

[0151]

[0152] Table 9

[0153]

[0154] Table 10

[0155]

[0156]

[0157] Table 11

[0158]

[0159] Table 12

[0160]

[0161] Table 13

[0162]

[0163] Table 14

[0164]

[0165] Table 15

[0166]

[0167] Table 16

[0168]

[0169]

[0170] Table 17

[0171]

[0172] Table 18

[0173]

[0174] Table 19

[0175]

[0176]

[0177] Table 20

[0178]

[0179] Table 21

[0180]

[0181] Table 22

[0182]

[0183]

[0184] Table 23

[0185]

[0186] Table 24

[0187]

[0188] Table 25

[0189]

[0190]

[0191] Table 26

[0192]

[0193] Table 27

[0194]

[0195] Table 28

[0196]

[0197]

[0198] Table 29

[0199]

[0200] Table 30

[0201]

[0202] Table 31

[0203]

[0204]

[0205] Table 32

[0206]

[0207] The multifunctional protein MZM29 exhibits relatively strong antibacterial activity (4-16 μg / ml) against most Gram-negative (G-) bacteria, including Acinetobacter baumannii, Enterobacter aerogenes, Enterobacter cloacae, Escherichia coli, Enterobacter hallii, Klebsiella pneumoniae, Moraxella catarrhalis, Haemophilus influenzae, Haemophilus parahaemolyticus, and Haemophilus haemolyticus. It also exhibits moderate antibacterial activity (16-64 μg / ml) against Stenotrophomonas maltophilia and Haemophilus parainfluenzae, with comparable activity against both resistant and sensitive strains. Regarding Pseudomonas aeruginosa, it exhibits good activity against the hypersensitive strain ATCC 35151 and the sensitive strain ATCC 27853 (MICs of 4 μg / ml and 32 μg / ml, respectively).

[0208] For Gram-positive bacteria (G+), the multifunctional protein MZM29 showed relatively strong activity against Enterococcus faecium, Staphylococcus epidermidis, Staphylococcus haemolyticus, and Streptococcus mutans (2-16 μg / ml). It also had some antibacterial activity against Staphylococcus aureus, Streptococcus agalactiae, and Listeria monocytogenes (most MICs were 32-128 μg / ml, with some strains reaching 16 μg / ml). Its antibacterial activity against drug-resistant strains such as MRSA and VRSA was not significantly different from that against the sensitive strain MSSA.

[0209] For fungi, the multifunctional protein MZM29 has certain antifungal activity against Candida krusei (MIC is 32 μg / ml).

[0210] Example 3 Anti-inflammatory activity of the multifunctional protein MZM29

[0211] 1. Study on the anti-inflammatory effect of the multifunctional protein MZM29 on THP-1

[0212] 1.1 Test samples

[0213] The test sample in this experimental example was the multifunctional protein MZM29; LL-37 was used as a positive control.

[0214] 1.2 Experimental methods

[0215] (1) Preparation of cell culture medium

[0216] RPMI 1640 medium was purchased from Lonza with the catalog number CC-3156.

[0217] Complete Medium (CM): RPMI 1640 cell culture medium containing 10% FBS and 1% penicillin / streptomycin (100×).

[0218] (2) Preparation of cell stimulants

[0219] Phorbol ester (PMA) was purchased from Sigma under the catalog number P1585; lipopolysaccharide (LPS) was purchased from Sigma under the catalog number L3129. PMA stimulant was prepared according to the method described in Table 33; LPS stimulant was prepared according to the method described in Table 34.

[0220] Table 33

[0221]

[0222] Table 34

[0223]

[0224] (3) Preparation of the drug to be tested

[0225] According to the method described in Table 35, the multifunctional protein MZM29 or LL-37 was prepared.

[0226] Table 35

[0227]

[0228] (4) Experimental steps

[0229] Day 1: Collect THP-1 cells, count them, and adjust the THP-1 cell density to 3×10 6 Add 1ml 3×10 6 THP-1 cells / ml and 1 ml of 20 ng / ml (2×) PMA were incubated in a 37°C incubator for 24 h;

[0230] The next day, THP-1 cells were collected, counted, and the cell density was adjusted to 0.5 × 10 6 200 μL of THP-1 cells were added to a 96-well flat-bottom plate and incubated in a 37°C incubator overnight.

[0231] Day 3: Discard 100 μL of cell supernatant, add 100 μL of 0.15 μg / mL (2×) LPS or LPS + test drug (2×), and incubate in a 37°C incubator for 24 hours;

[0232] Day 4: 100 μL of cell supernatant was collected for cytokine detection of TNF-α (Human TNFαFlex Set, purchased from BD, catalog number 558273), IL-6 (Human IL-6Flex Set, purchased from BD, catalog number 558276) and nitric oxide (NO detection kit, purchased from Beyotime, catalog number S0021S), and the cells were used to detect CTG (CTG detection kit, purchased from Promega, catalog number G7572).

[0233] 1.3 Experimental Results

[0234] Effects of multifunctional proteins MZM29 or LL-37 on cell viability Figure 1 As shown, compared with the LPS stimulation group, MZM29 at a concentration of 40 μg / mL significantly reduced the cell viability of THP-1 in a dose-dependent manner.

[0235] Effects of multifunctional proteins MZM29 or LL-37 on nitric oxide production in THP-1 cells Figure 2 As shown, MZM29 reduced the NO content in the supernatant of THP-1 cells compared with the LPS-stimulated group.

[0236] Effects of multifunctional proteins MZM29 or LL-37 on TNF-α secretion in cells Figure 3 As shown in the figure, compared with the LPS-stimulated group, MZM29 can reduce the secretion of TNF-α in THP-1 cells in a dose-dependent manner. Compared with the LL-37-treated group, the inhibitory effect of MZM29 at a concentration of 40 μg / mL is more significant than that of LL-37.

[0237] Effects of multifunctional proteins MZM29 or LL-37 on IL-6 secretion in cells Figure 4As shown in the data, compared with the LPS-stimulated group, LL-37 reduced IL-6 secretion in THP-1 cells. MZM29 at concentrations of 10 μg / mL and 40 μg / mL also reduced IL-6 secretion in THP-1 cells in a dose-dependent manner. Compared with the LL-37-treated group, the inhibitory effect of MZM29 at concentrations of 10 μg / mL and 40 μg / mL was more significant than that of LL-37.

[0238] 2. Anti-inflammatory effect of multifunctional protein MZM29 on DS-1 cells

[0239] 2.1 Test samples

[0240] The test sample in this experimental example was the multifunctional protein MZM29; LL-37 was used as a positive control.

[0241] 2.2 Experimental methods

[0242] (1) Preparation of cytokines

[0243] Cytokines were prepared according to the method described in Table 36. The recombinant human IL-6 protein in the table was provided by R&D with the product number 206-IL.

[0244] Table 36

[0245] Source management ID Source tube volume (μL) CM volume (μL) Total volume (μL) Target concentration (1×) IL-6 100 μg / mL 2 198 200 1 μg / mL IL-6 1 μg / mL 150 29850 30000 5ng / mL

[0246] (2) Preparation of the drug to be tested

[0247] According to the method described in Table 37, the multifunctional protein MZM29 or LL-37 was prepared.

[0248] Table 37

[0249]

[0250] (3) Experimental steps

[0251] DS-1 cells were collected, counted, and the cell density was adjusted to 2.5 × 10 5 / ml; 100μL 2.5×10 5 Cells / ml DS-1 and 100 μL 5 ng / mL (1×) IL-6 or IL-6 + test drug (2×) were added to a 96-well flat-bottom plate and incubated in a 37°C incubator for 72 hours; 100 μL of the cell supernatant was discarded, and an equal volume of CTG detection reagent (CTG detection kit, purchased from Promega, catalog number G7572) was added; the values ​​were read using a microplate reader.

[0252] 2.3 Experimental Results

[0253] Effects of multifunctional proteins MZM29 or LL-37 on DS-1 cell viability Figure 5 As shown, the inhibitory effect on DS-1 cell viability is as follows Figure 6 As shown. Figure 5-Figure 6 Compared to the untreated group (IL-6 only), LL-37 significantly reduced DS-1 cell viability at concentrations of 10 μg / mL to 80 μg / mL, with an IC50 of 16.2 μg / mL. MZM29 also reduced DS-1 cell viability with an IC50 of 8.967 μg / mL, which was lower than the IC50 value of the positive control, LL-37.

[0254] Example 4 In vitro antiviral activity of the multifunctional protein MZM29 against HPV16 and HPV18

[0255] 1. Test samples

[0256] The test sample in this example is the multifunctional protein MZM29. The control compound (DAPT, also known as GSI-IX) was provided by WuXi AppTec.

[0257] 2. Virus-like particles (VLPs)

[0258] HPV16 VLP and HPV18 VLP were provided by WuXi AppTec.

[0259] 3. Cells and culture medium

[0260] 293FT (ATCC-CRL-3216) cells were provided by WuXi AppTec. DMEM cell culture medium was provided by CORNING.

[0261] 4. Experimental methods

[0262] 4.1 Experimental steps for screening the anti-HPV16 and HPV18 activity of the multifunctional protein MZM29

[0263] On day 1, 293FT cells were plated at 4 × 10 cells per well. 4 The cells were seeded into 96-well plates at a density of 100 cells / well and cultured overnight in a 5% CO2, 37°C cell culture incubator.

[0264] On the second day, the virus, test sample, and control compound were diluted in serum-free medium. 50 μL of diluted MZM29 and 50 μL of 100 viral half tissue infectious doses (TCID50) HPV16 VLPs or HPV18 were added to the cell wells, and 50 μL of control compound and 50 μL of 100 TCID50 HPV16 VLPs or HPV18 were added to the cell wells. At the same time, cell controls (cells without test sample, control compound treatment, or virus infection) and virus controls (cells infected with virus, without test sample or control compound treatment) were set up for antiviral experiments (see for details). Figure 7 ).

[0265] The highest detection point concentration of the test sample multifunctional protein MZM29 was 100 μg / ml, serial dilution, 8 concentration points (100 μg / ml, 40 μg / ml, 16 μg / ml, 8 μg / ml, 4 μg / ml, 2 μg / ml, 1 μg / ml, 0.5 μg / ml), and double-well detection;

[0266] Control compound: GSI-IX was diluted 5-fold, 8 concentration points were detected in duplicate wells, and the starting point and final concentration were 10000nM.

[0267] The cells with the virus, test sample, and control compound were cultured in a 5% CO2, 37°C incubator for 3 days. The antiviral activity of the test sample was expressed as the inhibition rate (%) of the virus-induced cytopathic effect of the sample at different concentrations.

[0268] 4.2 Cytotoxicity assay steps for the multifunctional protein MZM29

[0269] On day 1, 293FT cells were plated at 4 × 10 cells per well. 4 The cells were seeded into 96-well plates at a density of 100 cells / well and cultured overnight in a 5% CO2, 37°C cell culture incubator.

[0270] On the second day, the test samples and control compounds were diluted in serum-free medium. 50 μl of the diluted multifunctional protein MZM29 and control compound and 50 μl of culture medium were added to the cell wells without virus infection (see Figure 8 At the same time, cell controls (cells, no test sample, control compound treatment, or virus infection) and culture medium controls (no cells, no test sample, control compound treatment, or virus infection) were set up for cytotoxicity experiments.

[0271] The highest detection point concentration of the test sample multifunctional protein MZM29 was 100 μg / ml, serial dilution, 8 concentration points (100 μg / ml, 40 μg / ml, 16 μg / ml, 8 μg / ml, 4 μg / ml, 2 μg / ml, 1 μg / ml, 0.5 μg / ml), and double-well detection;

[0272] Control compound: GSI-IX was diluted 5-fold, 8 concentration points were detected in duplicate wells, and the starting point and final concentration were 10000nM.

[0273] The cells to which the test samples and control compounds were added were cultured in a 5% CO2, 37°C incubator for 3 days. The cytotoxicity of the test samples was expressed as the inhibition rate (%) of 293FT cell activity at different sample concentrations.

[0274] 5. Experimental results

[0275] The EC50 of the multifunctional protein MZM29 against HPV16 and HPV18 were 52.90 μg / ml and 35.91 μg / ml, respectively, indicating that MZM29 exhibited antiviral activity against HPV16 and 18 under in vitro experimental conditions. Detailed data are shown in Tables 38 and Figure 9-10 .

[0276] Table 38

[0277]

[0278]

[0279] MZM29 did not induce cytotoxicity at all tested concentrations. 50 >100μg / ml. Detailed data are shown in Table 39 and Figure 11 .

[0280] Table 39

[0281]

[0282] Example 5 Anti-inflammatory effect of homologous multifunctional proteins on THP-1

[0283] 1. Test samples

[0284] The test samples in this example are multifunctional protein 1 to multifunctional protein 11.

[0285] 2. Experimental methods

[0286] 2.1 Preparation of cell culture medium

[0287] RPMI 1640 medium was purchased from Lonza with the catalog number CC-3156.

[0288] Complete Medium (CM): RPMI 1640 cell culture medium containing 10% FBS and 1% penicillin / streptomycin (100×).

[0289] 2.2 Preparation of cell stimulants

[0290] Phorbol ester (PMA) was purchased from Sigma under the catalog number P1585; lipopolysaccharide (LPS) was purchased from Sigma under the catalog number L3129. PMA stimulant was prepared according to the method described in Table 33; LPS stimulant was prepared according to the method described in Table 34.

[0291] 2.3 Preparation of test drugs

[0292] According to the method described in Table 40, the multifunctional protein 1-multifunctional protein 11 test drugs were prepared.

[0293] Table 28

[0294]

[0295] 2.4 Experimental steps

[0296] 1. Day 1: Collect THP-1 cells, count them, and adjust the THP-1 cell density to 3×10 6 pcs / ml;

[0297] 2. Add 1 ml of 3×10 6 THP-1 cells (1000 cells / ml) and 1 ml of 20 ng / ml (2×) PMA were incubated in a 37°C incubator for 24 hours;

[0298] 3. On the next day, collect THP-1 cells, count them, and adjust the cell density to 0.5×10 6 200 μL of THP-1 cells were added to a 96-well flat-bottom plate and incubated in a 37°C incubator overnight.

[0299] 4. On the third day, discard 100 μL of cell supernatant and add 100 μL of 0.15 μg / mL (2×) LPS or LPS + test drug (2×) and incubate in a 37°C incubator for 24 hours;

[0300] 5. On the fourth day, 100 μL of cell supernatant was collected for cytokine detection of TNF-α (Human TNFαFlex Set, purchased from BD, catalog number 558273) and nitric oxide (NO detection kit, purchased from Beyotime, catalog number S0021S).

[0301] 3. Experimental methods

[0302] Effects of the tested drugs on nitric oxide production in THP-1 cells Figure 12 The effects on TNF-α secretion are shown in Figure 13 The results showed that both multifunctional protein 1 and multifunctional protein 11 could reduce the NO content and THF-α secretion in THP-1 cells.

[0303] The above detailed description is a specific description of one feasible embodiment of the present invention and is not intended to limit the scope of the present invention. It should be noted that any equivalent implementation or modification that does not depart from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the scope of protection of the patent of this invention should be based on the attached requirements.

Claims

1. A multifunctional protein MZM29 or a multifunctional protein homologous to MZM29, characterized in that: The multifunctional protein MZM29 or the MZM29 homologous multifunctional protein has an amino acid sequence as shown in any of the following: (1) comprising an amino acid sequence as shown in any one of SEQ ID NOs. 1-12; or (2) comprising a partial segment of any one or more of the amino acid sequences shown in SEQ ID NOs. 1-12; or (3) A sequence having more than 80% homology with any one of the amino acid sequences of SEQ ID NOs. 1-12.

2. The multifunctional protein MZM29 or MZM29 homologous multifunctional protein according to claim 1, characterized in that: The multifunctional protein MZM29 has an amino acid sequence as shown in any of the following: (1) comprising the amino acid sequence shown in SEQ ID NO.1; or (2) comprising a partial segment of the amino acid sequence shown in SEQ ID NO.1; or (3) A sequence having 80% or more homology with the amino acid sequence of SEQ ID NO.

1.

3. The multifunctional protein MZM29 or MZM29 homologous multifunctional protein according to claim 1, characterized in that: The MZM29 homologous multifunctional protein has an amino acid sequence as shown in any of the following: (1) comprising an amino acid sequence as shown in any one of SEQ ID NOs. 2-12; or (2) comprising any one or more partial segments of the amino acid sequences shown in SEQ ID NOs. 2-12; or (3) A sequence having more than 80% homology with any one of the amino acid sequences of SEQ ID NO. 2-12.

4. A coding gene, characterized in that The encoding gene encodes the multifunctional protein MZM29 or the MZM29 homologous multifunctional protein according to any one of claims 1 to 3.

5. The coding gene according to claim 4, characterized in that The coding gene encodes the multifunctional protein MZM29, and the coding gene comprises the nucleotide sequence shown in SEQ ID NO.13; or a partial segment of the nucleotide sequence shown in SEQ ID NO.13; or a nucleotide sequence after base substitution of SEQ ID NO.13 according to codon degeneracy.

6. A recombinant vector, characterized in that: The recombinant vector comprises the coding gene according to any one of claims 4-5.

7. A genetically engineered cell, characterized in that: The genetically engineered cells express the recombinant vector described in claim 6.

8. A cell preparation, characterized in that The cell preparation is prepared by the genetically engineered cell according to claim 7, and the cell preparation comprises lysate and / or culture.

9. Use of the multifunctional protein MZM29 or MZM29 homologous multifunctional protein according to any one of claims 1 to 3, the encoding gene according to any one of claims 4 to 5, the recombinant vector according to claim 6, the genetically engineered cell according to claim 7 or the cell preparation according to claim 8 in the preparation of antibacterial products, anti-inflammatory products or antiviral products.

10. The use according to claim 9, characterized in that: The antibacterial product is directed against one or more of Gram-negative bacteria, Gram-positive bacteria and fungi.

11. The use according to claim 10, characterized in that: The Gram-negative bacteria include one or more of Acinetobacter baumannii, Enterobacter aerogenes, Enterobacter cloacae, Escherichia coli, Enterobacter hallii, Klebsiella pneumoniae, Moraxella catarrhalis, Haemophilus influenzae, Haemophilus parahaemolyticus, Haemophilus hemolyticus, Stenotrophomonas maltophilia, Haemophilus parainfluenzae, and Pseudomonas aeruginosa.

12. The use according to claim 10, characterized in that: The Gram-positive bacteria include one or more of Enterococcus faecium, Staphylococcus epidermidis, Staphylococcus haemolyticus, Streptococcus mutans, Listeria monocytogenes, Staphylococcus aureus and Streptococcus agalactiae.

13. The use according to claim 10, characterized in that: The fungi include Candida krusei.

14. The use according to claim 9, characterized in that: The antiviral product is directed against HPV16 virus and / or HPV18 virus.

15. The use according to claim 9, characterized in that: The anti-inflammatory product inhibits the secretion of pro-inflammatory factors by blocking the binding of LPS and Toll-like receptors.

16. The use according to claim 9, characterized in that: The antibacterial products include antibacterial drugs, antibacterial food additives, cosmetic preservatives or antibacterial daily necessities.

17. The use according to claim 9, characterized in that: The anti-inflammatory products include anti-inflammatory drugs or anti-inflammatory cosmetics.

18. The use according to claim 9, characterized in that: The antiviral products include antiviral drugs.

19. A drug, characterized in that The drug comprises the multifunctional protein MZM29 or MZM29 homologous multifunctional protein according to any one of claims 1 to 3, the encoding gene according to any one of claims 4 to 5, the recombinant vector according to claim 6, the genetically engineered cell according to claim 7 or the cell preparation according to claim 8.

20. The drug according to claim 19, characterized in that The medicine has one or more effects of antibacterial effect, anti-inflammatory effect and antiviral effect.

21. The drug according to claim 19, characterized in that The dosage form of the drug includes a non-gastrointestinal dosage form or a gastrointestinal dosage form.

22. The drug according to claim 19, characterized in that The medicine also includes one or more pharmaceutically acceptable excipients.

23. An antibacterial food additive, characterized in that: The antibacterial food additive comprises the multifunctional protein MZM29 or MZM29 homologous multifunctional protein according to any one of claims 1 to 3, the encoding gene according to any one of claims 4 to 5, the recombinant vector according to claim 6, the genetically engineered cell according to claim 7 or the cell preparation according to claim 8.

24. The antibacterial food additive according to claim 18, characterized in that The food includes human food or animal food.

25. A cosmetic preservative, characterized in that: The cosmetic preservative comprises the multifunctional protein MZM29 or MZM29 homologous multifunctional protein according to any one of claims 1 to 3, the encoding gene according to any one of claims 4 to 5, the recombinant vector according to claim 6, the genetically engineered cell according to claim 7 or the cell preparation according to claim 8. 26.An antibacterial daily necessities, characterized in that: The antibacterial daily necessities include the multifunctional protein MZM29 or MZM29 homologous multifunctional protein described in any one of claims 1-3, the encoding gene described in any one of claims 4-5, the recombinant vector described in claim 6, the genetically engineered cell described in claim 7 or the cell preparation described in claim 8.

27. The antibacterial living product according to claim 26, characterized in that: The antibacterial daily necessities include toiletries, household products, sanitary products, kitchen products or baby products.

28. An anti-inflammatory cosmetic, characterized in that: The anti-inflammatory cosmetic comprises the multifunctional protein MZM29 or MZM29 homologous multifunctional protein according to any one of claims 1 to 3, the encoding gene according to any one of claims 4 to 5, the recombinant vector according to claim 6, the genetically engineered cell according to claim 7 or the cell preparation according to claim 8.

29. The anti-inflammatory cosmetic according to claim 28, characterized in that The anti-inflammatory cosmetics include cleansing milk, toner, lotion, cream, essence, mask, foundation, concealer, sunscreen, sunscreen spray, shampoo, conditioner, shower gel, foam, patch, makeup powder, cotton pad, eye essence, eye mask, eye shadow, eye gel or eye cream.

30. The anti-inflammatory cosmetic according to claim 28, characterized in that The anti-inflammatory cosmetic also includes cosmetically acceptable additives.

Images