Glucose-6-phosphate dehydrogenase mutant, biological material, catalyst and application

By mutation of specific amino acid residues on glucose-6-phosphate dehydrogenase, the catalytic efficiency and broadness of reaction conditions are improved, the problem of inefficient catalytic efficiency of wild-type G6PD is solved, and efficient NADPH regeneration is achieved.

CN120384059AActive Publication Date: 2025-07-29NANJING UNIV

Patent Information

Application Number
CN202510874299.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-27
Publication Date
2025-07-29
Estimated Expiration
2045-06-27

AI Technical Summary

Technical Problem

Wild-type glucose-6-phosphate dehydrogenase (G6PD) has low catalytic efficiency, strong structural sensitivity, and insufficient dynamic regulatory mechanism, resulting in insufficient NADPH regeneration rate, which makes it difficult to meet the needs of industrial applications.

Method used

By mutation at the amino acid residues at positions 111, 127, 214 and 217 of wild-type glucose-6-phosphate dehydrogenase, preferably K111L/T217L, the NADPH regeneration efficiency and broadness of reaction conditions are improved.

Benefits of technology

The catalytic efficiency of the mutant K111L/T217L is increased to 2.06 times that of the wild type, and the reaction conditions are good efficiency in the range of 20-50℃ and pH 6-10, meeting the needs of various industrial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120384059A_ABST
    Figure CN120384059A_ABST
Patent Text Reader

Abstract

The invention discloses a glucose-6-phosphate dehydrogenase mutant, a biological material, a catalyst and application, and belongs to the field of protein engineering, the mutant is based on a wild glucose-6-phosphate dehydrogenase amino acid sequence derived from Aspergillus nidulans FGSC A4, and has one or more amino acid residue mutations in the 111st site, the 127th site, the 214th site and the 217th site. The NADPH regeneration efficiency of the mutant disclosed by the invention is remarkably improved, and the catalytic efficiency of the preferable mutant K111L / T217L is 2.06 times that of wild glucose-6-phosphate dehydrogenase; the obtained mutant has wider reaction conditions, and has good NADPH regeneration efficiency under the conditions that the temperature is 20-50 DEG C and the pH is 6-10.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of protein engineering, and particularly to a glucose-6-phosphate dehydrogenase mutant, a biological material, a catalyst and applications thereof. Background Art

[0002] Glucose-6-phosphate dehydrogenase (G6PD) is the key rate-limiting enzyme of the pentose phosphate pathway (PPP), responsible for catalyzing the oxidation of glucose-6-phosphate (G6P) to 6-phosphogluconolactone, while reducing NADP + to NADPH. This reaction not only provides ribose-5-phosphate for nucleotide synthesis in cells, but also maintains redox homeostasis by generating NADPH. As a key reducing coenzyme, NADPH is involved in the synthesis of biological macromolecules such as fatty acids and cholesterol on the one hand, and on the other hand, it scavenges reactive oxygen species (ROS) by reducing glutathione (GSH), protecting cells from oxidative damage.

[0003] G6PD also has important applications in multiple industries. For example, in the field of medical diagnosis, G6PD mutants with high catalytic activity can significantly improve sensitivity and specificity, becoming a key tool for clinical detection. It not only greatly shortens the detection time, but also enables high-precision quantitative detection, meeting the needs of high-throughput screening; in industrial biomanufacturing, NADPH is an essential cofactor for the synthesis of drug intermediates (such as antibiotics and chiral compounds) and biofuels. Using G6PD for NADPH regeneration can reduce the production cost of microbial cell factories; in agriculture, introducing highly active G6PD mutants into transgenic plants can strengthen the antioxidant system and improve the drought and salt tolerance of crops, providing new ideas for coping with climate change. However, the low catalytic efficiency of wild-type G6PD severely restricts its effectiveness.

[0004] This core problem stems from the structural sensitivity and dynamic regulation mechanism of wild-type G6PD: First, environmental fluctuations such as pH deviation from the optimal range (usually 7.8 - 8.5) or temperature changes may cause conformational changes, reducing substrate binding ability and affecting enzyme activity; second, the affinity of the NADP⁺ binding pocket is insufficient, making it difficult to effectively compete for binding in complex systems; in addition, the feedback inhibition of the product NADPH further weakens catalytic persistence. These defects lead to insufficient NADPH regeneration rate, making it difficult to meet the requirements of industrial applications. Summary of the Invention

[0005] Objectives of the Invention: The objective of the present invention is to provide a glucose-6-phosphate dehydrogenase mutant with high catalytic activity and broader reaction conditions; the second objective is to provide biological materials and catalysts related to the mutant; the third objective is to provide the applications of the mutant and the catalyst in the synthesis of the reduced coenzyme NADPH.

[0006] Technical solution: The glucose-6-phosphate dehydrogenase mutant of the present invention is based on the wild-type glucose-6-phosphate dehydrogenase amino acid sequence shown in SEQ ID NO: 1, and has a mutation of one or more amino acid residues at positions 111, 127, 214, and 217. Among them, the reference sequence of the wild-type glucose-6-phosphate dehydrogenase amino acid sequence is NCBI Reference Sequence: XP_660585.1.

[0007] Preferably, in the amino acid mutation, the lysine residue at position 111 is mutated to a leucine residue, the glutamine residue at position 127 is mutated to a threonine residue, the phenylalanine residue at position 214 is mutated to a glycine residue, and the threonine residue at position 217 is mutated to a leucine residue.

[0008] Preferably, the glucose-6-phosphate dehydrogenase mutant has an amino acid sequence shown in any one of SEQ ID NOs: 2-7.

[0009] The nucleotide sequence of the present invention is based on the wild-type glucose-6-phosphate dehydrogenase nucleotide sequence, contains corresponding base mutations, and encodes the amino acid sequence of the aforementioned glucose-6-phosphate dehydrogenase mutant.

[0010] Preferably, the wild-type glucose-6-phosphate dehydrogenase nucleotide sequence is as shown in SEQ ID NO: 8, which is Aspergillus nidulans FGSC A4 A codon-optimized nucleotide sequence derived from glucose-6-phosphate dehydrogenase.

[0011] The recombinant vector of the present invention contains the aforementioned nucleotide sequence.

[0012] The recombinant microorganism of the present invention contains the aforementioned nucleotide sequence or recombinant vector.

[0013] The catalyst of the present invention contains the aforementioned glucose-6-phosphate dehydrogenase mutant.

[0014] Use of the glucose-6-phosphate dehydrogenase mutant or catalyst of the present invention in the synthesis of NADPH.

[0015] Preferably, the reaction temperature of the application is 20-50 °C and the pH is 6-10.

[0016] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: 1. The NADPH regeneration efficiency of the obtained mutants is significantly improved. Preferably, the catalytic efficiency of the mutant K111L / T217L is 2.06 times that of the wild-type glucose-6-phosphate dehydrogenase; 2. The reaction conditions of the obtained mutants are more extensive, and good NADPH regeneration efficiency can be obtained at a temperature of 20-50 °C and a pH of 6-10. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 FIG. is a comparative diagram of the relative activities of the glucose-6-phosphate dehydrogenase mutants obtained in Examples 1-7 for catalyzing the reduction of oxidized coenzyme NADP + to reduced coenzyme NADPH;

[0018] Figure 2 FIG. is a comparative diagram of the relative activities of the glucose-6-phosphate dehydrogenase mutant K111L / T217L for catalyzing the reduction of oxidized coenzyme NADP + to reduced coenzyme NADPH at different temperatures;

[0019] Figure 3 FIG. is a comparative diagram of the relative activities of the glucose-6-phosphate dehydrogenase mutant K111L / T217L for catalyzing the reduction of oxidized coenzyme NADP + to reduced coenzyme NADPH at different pH values. DETAILED DESCRIPTION OF THE INVENTION

[0020] The technical solution of the present invention will be further described below.

[0021] Example 1 Construction of wild-type glucose-6-phosphate dehydrogenase plasmid and preparation of crude enzyme solution

[0022] The codon-optimized wild-type gene of glucose-6-phosphate dehydrogenase with the sequence shown in SEQ ID NO: 8 was synthesized by GenScript Biotech Corporation and constructed on the pET22b vector to obtain pET22b-G6PD. Among them, the pET22b vector was provided by GenScript Biotech Corporation. Aspergillus nidulans FGSC A4 The pET22b-G6PD was transformed into

[0023] DH5α strain, and the recombinant bacterium E.coli DH5α / pET22b-G6PD was inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin, and cultured at 37 °C and 220 rpm for 12 h. E.coli DH5α / pET22b-G6PD was inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin, and cultured at 37 °C and 220 rpm for 12 h.

[0024] After the cultivation, the bacterial cells were centrifuged at 12,000 rpm for 1 min and the cells were collected. Using a high-purity plasmid miniprep kit, the pET22b-G6PD plasmid was extracted as the template for iterative mutagenesis, which was used for the construction of G6PD mutants.

[0025] Meanwhile, pET22b-G6PD was transformed into E.coli BL21(DE3) to construct a recombinant mutant expression strain E.coli BL21(DE3) / pET22b-G6PD. The successfully constructed recombinant mutant expression strain was spread onto an ampicillin plate containing a final concentration of 100 mg / mL and cultured at 37 °C for 18 h.

[0026] After the cultivation, a single colony was picked and inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin and cultured at 37 °C at 200 rpm for 18 h. Then, it was all transferred into 500 mL of LB medium containing a final concentration of 100 μg / mL ampicillin. When OD 600 = 0.6, isopropyl-β-D-thiogalactoside (IPTG) with a final concentration of 0.5 mM was added and induced at 18 °C for 14 h.

[0027] After centrifuging at 4000 rpm for 10 min to obtain the bacterial cells, they were resuspended in 100 mM phosphate buffer at pH 7.5 to OD 600 = 1. The cells were disrupted by ultrasonic treatment at 65 W in an ice bath with a working time of 2 s and an interval of 5 s, and the total working time was 30 min. Then, it was centrifuged at 12,000 rpm at 4 °C for 20 min. The supernatant was collected and filtered through a 0.22 μm water-based filter head to obtain the crude enzyme solution containing the wild-type enzyme.

[0028] Example 2 Construction of Glucose-6-Phosphate Dehydrogenase Mutant K111L and Preparation of Crude Enzyme Solution

[0029] 1. Recombinant Escherichia coli E.coli Construction of BL21(DE3) / pET22b-G6PD-K111L Mutant

[0030] Gene mutation was carried out by the method of whole plasmid PCR to obtain the target mutant gene. The primers were as follows:

[0031] SEQ ID NO: 9, K111L upstream primer: GATAGCTTTCTGAACCTGGCCAAACATCTGG

[0032] SEQ ID NO: 10, K111L downstream primer: GGCCAGGTTCAGAAAGCTATCATCCTGATC

[0033] The PCR system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0034] Table 1 PCR reaction system

[0035]

[0036] Table 2 PCR reaction conditions

[0037]

[0038] After the PCR amplification was completed, the amplified product was detected by 0.9% agarose gel electrophoresis. The result showed that the amplified product was a single band with a size of approximately 7000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.

[0039] The purified gene fragment was digested with DpnI to remove the template and then recombined with recombinase. The recombinant product was transformed into E.coli DH5α competent cells, and spread on an LB solid culture plate containing 100 mg / mL ampicillin, and cultured at 37 °C for 12 h.

[0040] After the culture was completed, single colonies were picked into LB liquid culture containing 100 mg / mL ampicillin. After culturing, it was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing to verify the correctness of the mutation sites. After verification, part of the bacterial liquid was stored at -80 °C for later use, and part of the bacterial liquid was used to extract the recombinant plasmid pET22b-G6PD-K111L, which was stored in a -20 °C refrigerator.

[0041] The successfully sequenced recombinant expression plasmid pET22b-G6PD-K111L was transferred into E.coli BL21(DE3) to construct a recombinant mutant expression strain E.coli BL21(DE3) / pET22b-G6PD-K111L.

[0042] 2. Cultivation of glucose-6-phosphate dehydrogenase mutant and preparation of crude enzyme solution

[0043] The successfully constructed recombinant mutant expression strain E.coli BL21(DE3) / pET22b-G6PD-K111L was spread on a culture plate containing ampicillin with a final concentration of 100 mg / mL and cultured at 37 °C for 18 h.

[0044] After the cultivation was completed, a single colony was picked and inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin, and cultured at 37 °C with 200 rpm for 18 h. Then, it was transferred to 500 mL of LB medium with a final concentration of 100 μg / mL ampicillin at an inoculation amount of 1%, and IPTG with a final concentration of 0.5 mM was added when OD 600 = 0.6, and induced at 18 °C for 14 h.

[0045] After centrifuging at 4000 rpm for 10 min to obtain the bacterial cells, they were resuspended in 100 mM phosphate buffer at pH 7.5 to OD 600 = 1, and the cells were disrupted by ultrasonic treatment at 65 W in an ice bath with a working time of 2 s and an interval of 5 s, and the total working time was 30 min. Then, it was centrifuged at 12000 rpm for 20 min at 4 °C. The supernatant was collected and filtered through a 0.22 μm aqueous filter head to obtain the crude enzyme solution containing the wild-type enzyme.

[0046] The amino acid sequence of glucose-6-phosphate dehydrogenase mutant K111L is shown in SEQ ID NO: 2.

[0047] Example 3 Construction and preparation of crude enzyme solution of glucose-6-phosphate dehydrogenase mutant Q127T

[0048] For the construction and preparation of the crude enzyme solution of the Q127T mutant, on the basis of Example 2, in step 1, the primers were changed and the other conditions remained unchanged. The primers are as follows:

[0049] SEQ ID NO: 11, Q127T upstream primer: CAGAAGGAGACCAACCGCGTTTTCTATATG

[0050] SEQ ID NO: 12, Q127T downstream primer: CGCGGTTGGTCTCCTTCTGATTCTTTTCAATTT

[0051] The amino acid sequence of glucose-6-phosphate dehydrogenase mutant Q127T is shown in SEQ ID NO: 3.

[0052] Example 4 Construction and preparation of crude enzyme solution of glucose-6-phosphate dehydrogenase mutant F214G

[0053] For the construction and preparation of the crude enzyme solution of the F214G mutant, on the basis of Example 2, in step 1, the primers were changed and the other conditions remained unchanged. The primers are as follows:

[0054] SEQ ID NO: 13, F214G upstream primer: CAATGAATTTGGCAACGCAACCTGGAATCGT

[0055] SEQ ID NO: 14, downstream primer for F214G: GTTGCGTTGCCAAATTCATTGCCGAAACGC

[0056] The amino acid sequence of glucose-6-phosphate dehydrogenase mutant F214G is shown in SEQ ID NO: 4.

[0057] Example 5 Construction of Glucose-6-Phosphate Dehydrogenase Mutant T217L and Preparation of Crude Enzyme Solution

[0058] For the construction of the T217L mutant and the preparation of the crude enzyme solution, on the basis of Example 2, in step 1, the primers were changed and the other conditions remained unchanged. The primers are as follows:

[0059] SEQ ID NO: 15, upstream primer for T217L: TTCAACGCACTGTGGAATCGTCATCATAT

[0060] SEQ ID NO: 16, downstream primer for T217L: CGATTCCACAGTGCGTTGAAAAATTCATTGC

[0061] The amino acid sequence of glucose-6-phosphate dehydrogenase mutant T217L is shown in SEQ ID NO: 5.

[0062] Example 6 Construction of Glucose-6-Phosphate Dehydrogenase Mutant K111L / T217L and Preparation of Crude Enzyme Solution

[0063] For the construction of the K111L / T217L mutant and the preparation of the crude enzyme solution, on the basis of Example 2, using the mutant K111L obtained in Example 2 as the DNA template in step 1, the primers were changed and the other conditions remained unchanged. The primers are as follows:

[0064] SEQ ID NO: 15, upstream primer for T217L: TTCAACGCACTGTGGAATCGTCATCATAT

[0065] SEQ ID NO: 16, downstream primer for T217L: CGATTCCACAGTGCGTTGAAAAATTCATTGC

[0066] The amino acid sequence of glucose-6-phosphate dehydrogenase mutant K111L / T217L is shown in SEQ ID NO: 6.

[0067] Example 7 Construction of Glucose-6-Phosphate Dehydrogenase Mutant Q127T / T217L and Preparation of Crude Enzyme Solution

[0068] Construction of the Q127T / T217L mutant and preparation of the crude enzyme solution. On the basis of Example 2, using the mutant Q127T obtained in Example 3 as the DNA template in Step 1, changing the primers, with other conditions remaining unchanged, the primers are as follows:

[0069] SEQ ID NO: 15, upstream primer for T217L: TTCAACGCACTGTGGAATCGTCATCATAT

[0070] SEQ ID NO: 16, downstream primer for T217L: CGATTCCACAGTGCGTTGAAAAATTCATTGC

[0071] The amino acid sequence of glucose-6-phosphate dehydrogenase mutant Q127T / T217L is shown in SEQ ID NO: 7.

[0072] Test Example 1 Performance Test of Glucose-6-Phosphate Dehydrogenase Mutant

[0073] 1. Glucose-6-phosphate dehydrogenase and its mutant catalyze the reduction of oxidized coenzyme NADP + to reduced coenzyme NADPH

[0074] Prepare NADPH at concentrations of 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 mM, and use a microplate reader to detect the absorbance at 340 nm, and plot the standard curve as y = 2.6016x - 0.0727, where x is the NADPH concentration and y is the absorbance.

[0075] Use the crude enzyme solution obtained in Examples 2 - 7 as the catalyst. The reaction system is: crude enzyme solution with an OD 600 = 0.01 of pre-lysis cell concentration, 2.5 mM oxidized coenzyme NADP + , 5 mM glucose-6-phosphate, 200 mM phosphate buffer, pH = 7.5, with a total volume of 300 μL. Control the reaction temperature at 30 °C through a water bath, react for 5 min, and use a microplate reader to detect the change in absorbance of the product NADPH at 340 nm after 5 min. React the enzyme activity with the change value of NADPH concentration at the same time, set the wild-type enzyme activity as 100%, and compare the relative activities.

[0076] The test results are shown in Table 3 and Figure 1 .

[0077] Table 3 Reduction of Oxidized Coenzyme NADP to Reduced Coenzyme NADPH by Glucose-6-Phosphate Dehydrogenase

[0078]

[0079] FromFigure 1 It can be seen that the catalytic conversion rates of all mutants are higher than that of wild-type glucose-6-phosphate dehydrogenase. In particular, the catalytic efficiency of mutant K111L / T217L is 2.06 times that of wild-type glucose-6-phosphate dehydrogenase.

[0080] 2. Optimal temperature for the mutant glucose-6-phosphate dehydrogenase (K111L / T217L) to catalyze the reduction of oxidized coenzyme NADP + to reduced coenzyme NADPH

[0081] Prepare NADPH with concentrations of 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 mM, detect the absorbance at 340 nm using a microplate reader, and plot the standard curve as y = 2.6016x - 0.0727, where x is the concentration of NADPH and y is the absorbance.

[0082] Using the crude enzyme solution obtained in Example 6 as a catalyst, the reaction system is: crude enzyme solution with an OD of the cell concentration before lysis 600 = 0.01, 2.5 mM oxidized coenzyme NADP + , 5 mM glucose-6-phosphate, 200 mM phosphate buffer, pH = 7.5, and the total volume is 300 μL. Control the reaction temperature at 15°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C through a water bath, react for 5 min, detect the change in the absorbance of the product NADPH at 340 nm after 5 min using a microplate reader, and use the change value of the NADPH concentration at the same time to reflect the enzyme activity. The enzyme activity at 15°C is set as 100% to compare the relative activities. The test results are shown in Figure 2 .

[0083] It can be seen from Figure 2 that the best catalytic effect is observed at 35°C, and the enzyme activity is good in the range of 20 - 50°C.

[0084] 3. Optimal pH for the mutant glucose-6-phosphate dehydrogenase (K111L / T217L) to catalyze the reduction of oxidized coenzyme NADP + to reduced coenzyme NADPH

[0085] Prepare NADPH with concentrations of 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 mM, detect the absorbance at 340 nm using a microplate reader, and plot the standard curve as y = 2.6016x - 0.0727, where x is the concentration of NADPH and y is the absorbance.

[0086] Using the crude enzyme solution obtained in Example 6 as a catalyst, the reaction system is: crude enzyme solution with an OD of the cell concentration before lysis 600= 0.01 crude enzyme solution, 2.5 mM oxidized coenzyme NADP + , 5 mM glucose-6-phosphate, 50 mM citrate-sodium citrate buffer or 50 mM potassium phosphate buffer or 50 mM Tris-HCl buffer or 50 mM Gly-NaOH buffer, with a total volume of 300 μL. Among them, the citrate-sodium citrate buffer controls the reaction pH to 5, the potassium phosphate buffer controls the reaction pH to 6 or 6.5 or 7, the Tris-HCl buffer controls the reaction pH to 7.5 or 8 or 8.5, and the Gly-NaOH buffer controls the reaction pH to 9 or 9.5 or 10. The reaction temperature is controlled at 35 °C by a water bath for 5 min. The absorbance change of the product NADPH at 340 nm after 5 min is detected by an enzyme-labeling instrument. The enzyme activity is reflected by the change value of the NADPH concentration at the same time. The enzyme activity at pH = 5 is set to 100% to compare the relative activities. The test results are shown in Figure 3 .

[0087] It can be seen from Figure 3 that different pH values have a significant impact on the catalytic effect of G6PD. The best catalytic effect is observed at pH = 7, and the enzyme catalytic activity is good in the range of pH 6-10.

Claims

1. A glucose-6-phosphate dehydrogenase mutant, characterized in that, Based on the wild-type glucose-6-phosphate dehydrogenase amino acid sequence shown in SEQ ID NO: 1, there are mutations in one or more amino acid residues at positions 111, 127, 214, and 217.

2. The glucose-6-phosphate dehydrogenase mutant according to claim 1, wherein, Among the amino acid mutations, the lysine residue at position 111 is mutated to a leucine residue, the glutamine residue at position 127 is mutated to a threonine residue, the phenylalanine residue at position 214 is mutated to a glycine residue, and the threonine residue at position 217 is mutated to a leucine residue.

3. The glucose-6-phosphate dehydrogenase mutant according to claim 1, wherein The glucose-6-phosphate dehydrogenase mutant has an amino acid sequence shown in any one of SEQ ID NOs: 2-7.

4. A nucleotide sequence, characterized in that, Based on the wild-type glucose-6-phosphate dehydrogenase nucleotide sequence, it contains corresponding base mutations and encodes the amino acid sequence of the glucose-6-phosphate dehydrogenase mutant according to any one of claims 1-3.

5. The nucleotide sequence according to claim 4, characterized in that, The nucleotide sequence of the wild-type glucose-6-phosphate dehydrogenase is as shown in SEQ ID NO: 8, which is Aspergillus nidulans FGSC A4 a codon-optimized nucleotide sequence derived from glucose-6-phosphate dehydrogenase.

6. A recombinant vector, characterized in that, The recombinant vector contains the nucleotide sequence according to claim 4.

7. A recombinant microorganism, characterized in that, The recombinant microorganism contains the nucleotide sequence according to claim 4 or the recombinant vector according to claim 6.

8. A catalyst, characterized in that, The catalyst contains the glucose-6-phosphate dehydrogenase mutant according to any one of claims 1-3.

9. Use of the glucose-6-phosphate dehydrogenase mutant according to any one of claims 1-3 or the catalyst according to claim 8 in the synthesis of NADPH.

10. The application according to claim 9, wherein The reaction temperature of the use is 20-50 °C and the pH is 6-10.

Citation Information

Patent Citations

  • Citric acid high-yielding Aspergillus niger FY2013 and application thereof

    CN103952318A

  • Genetically optimized microorganism for producing molecules of interest

    CN110678541A

  • Glucose-6-phosphate dehydrogenase mutant as well as preparation method and application thereof

    CN117925552A

  • Polyphosphokinase mutant, biological material, catalyst and application

    CN120310769A

Cited By

  • Glucose-6-phosphate dehydrogenase mutant and application thereof in production of L-tryptophan

    CN121203992A