Application of Luteibacter rhizovicinus in grease degradation

Abstract

The invention provides an application of Luteibacter rhizovicinus in degradation of oil and fat, and particularly provides an application of Luteibacter rhizovicinus in degradation of oil and fat. According to the present invention, the Luteibacter rhizovicinus is preserved in the China General Microbiological Culture Collection Center (CGMCC) on July 05, 2023, and the preservation number of the Luteibacter rhizovicinus is CGMCC No.27740; the provided flavibacter sylvestris can effectively degrade oil and fat.

Description

Technical Field

[0001] The present invention relates to the technical field of agricultural microorganisms, and relates to the application of a strain of Luteibacter rhizovicinus in oil degradation. Background Art

[0002] In remote rural areas, waste with a high oil content such as kitchen waste (food waste) is not easily transported to urban areas for unified treatment, and oil-water separation technology has not been popularized. The high oil content affects the aerobic fermentation and humification process of kitchen waste (food waste) and the quality of fertilizer products. There is an urgent need for oil treatment technology in such scenarios to improve the resource utilization of oil-containing pollutants. In addition, sewage pipes such as catering wastewater are often blocked due to oil problems. When oil-containing wastewater is discharged into water bodies, the oil will float on the water surface, hindering the dissolution of oxygen, destroying the self-purification ability of the water body, and endangering the aquatic ecosystem.

[0003] Traditional physical and chemical degradation methods (such as suspension method, chemical flocculation) have large investment, high risk of secondary pollution, and low removal rates of COD / BOD, which limit their practical applications. Biodegradation has become a new trend due to its advantages of low cost and no secondary pollution. Bacteria with high-efficiency oil degradation are still to be explored and discovered.

[0004] Luteibacter rhizovicinus is a Gram-negative, rod-shaped, and flagellated microorganism belonging to the genus Luteribacter and is commonly used for classification. The efficacy and more research on Luteibacter rhizovicinus have not been reported yet. Summary of the Invention

[0005] The present invention aims to solve at least one of the technical problems in the related art to some extent. The present invention provides a Luteibacter rhizovicinus Luteibacter rhizovicinus , which can be used for oil degradation. As a fungus with high-efficiency oil degradation, it can play the role of oil degradation, and can also supplement the existing library of oil-degrading bacteria, providing more choices. It can also be compounded with other known or unknown bacteria or fungi with oil-degrading functions. For example, it can be compounded with Fusarium proliferatum Fusarium proliferatum to jointly play the role of oil degradation.

[0006] Specifically, the present invention provides the following technical solutions: The first aspect of the present invention provides a use of Luteibacter rhizovicinus Luteibacter rhizovicinus in oil degradation, and the Luteibacter rhizovicinus Luteibacter rhizovicinus was deposited on July 5, 2023 at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, with the deposit number of CGMCC No. 27740.

[0007] According to an embodiment of the present invention, the Luteibacter rhizovicinusLuteibacter rhizovicinus The sequence of its 16srDNA is shown in SEQ ID NO:1.

[0008] In the second aspect of the present invention, there is provided the use of a microbial inoculant in oil degradation, and the microbial inoculant includes Flavobacterium subradicans Luteibacter rhizovicinus , and the Flavobacterium subradicans Luteibacter rhizovicinus was deposited on July 5, 2023 at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, with the deposit number of CGMCC No.27740.

[0009] According to an embodiment of the present invention, the sequence of the 16srDNA of the Flavobacterium subradicans Luteibacter rhizovicinus is shown in SEQ ID NO:1.

[0010] According to an embodiment of the present invention, the microbial inoculant is in the form of dry powder or bacterial liquid, and the effective viable count of the Flavobacterium subradicans Luteibacter rhizovicinus in the dry powder or bacterial agent is at least 1×10 10 CFU / mL.

[0011] According to an embodiment of the present invention, the microbial inoculant is obtained by fermenting and culturing the Flavobacterium subradicans Luteibacter rhizovicinus in an enrichment medium containing 0.16wt% - 1.6wt% animal and plant oils and fats.

[0012] According to an embodiment of the present invention, the formula of the enrichment medium includes 0.1 - 0.5 g of MgSO4·7H2O, 1 - 2 g of (NH4)2SO4, 0.3 - 1 g of KH2PO4, 1 - 2 g of K2HPO4, 3 - 8 g of NaCl, 1.6 - 16 g of soybean oil, 1000 mL of deionized water, and the pH is 7.0 - 7.2.

[0013] The conditions for the fermentation culture are that after inoculating the Flavobacterium subradicans Luteibacter rhizovicinus into the enrichment medium, fermenting and culturing at 28 - 32°C and 100 - 150 r / min for 2 - 7 days.

[0014] The third aspect of the present invention provides a method for degrading oils and fats in a sample or a site, including: mixing and culturing Flavobacterium subradicans Luteibacter rhizovicinus or a microbial inoculant containing Flavobacterium subradicans Luteibacter rhizovicinus with the sample, or placing it in a site containing oils and fats, so as to degrade the oils and fats in the sample or the site.

[0015] According to an embodiment of the present invention, the Flavobacterium subradicans Luteibacter rhizovicinusThe inoculation amount is 0.2 to 5% (w / w) of the amount of the sample.

[0016] According to an embodiment of the present invention, the sample is selected from kitchen waste (food waste), oil-containing waste (such as wastewater, waste gas, waste residue), etc., and the places include at least one of oil-containing sewage pipes and oil-containing pollutant collection places.

[0017] In the fourth aspect of the present invention, a Flavobacterium subradicans is provided Luteibacter rhizovicinus , the Flavobacterium subradicans Luteibacter rhizovicinus was deposited on July 5, 2023 at the China General Microbiological Culture Collection Center, with the deposit number CGMCC No. 27740, and the deposit address is: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0018] According to an embodiment of the present invention, the 16srDNA sequence of the Flavobacterium subradicans Luteibacter rhizovicinus is as shown in SEQ ID NO: 1.

[0019] The beneficial effects obtained by the present invention are at least: The Flavobacterium subradicans provided by the present invention Luteibacter rhizovicinus can effectively degrade oil, and its main function is to accelerate the oil metabolism process. In addition, the provided Flavobacterium subradicans Luteibacter rhizovicinus can improve the original microbial community structure and microecology, and reduce the environmental pollution caused by oil-containing pollutants. The provided Flavobacterium subradicans Luteibacter rhizovicinus can be prepared into solid powder or liquid exogenous microbial inoculants as needed and used in the field of oil degradation.

[0020] Deposit Certificate The taxonomic name is Flavobacterium subradicans Luteibacter rhizovicinus , the deposit number is CGMCC No. 27740, the deposit institution is: China General Microbiological Culture Collection Center, the deposit date is: July 5, 2023, and the deposit address is: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Brief Description of the Drawings

[0021] Figure 1 It is a schematic diagram of the colony characteristics of the Flavobacterium subradicans provided according to an embodiment of the present invention Luteibacter rhizovicinus .

[0022] Figure 2 It is a schematic diagram of the morphological characteristics of the Flavobacterium subradicans provided according to an embodiment of the present invention Luteibacter rhizovicinus .

[0023] Figure 3Xanthobacter subradicis according to an embodiment of the present invention Luteibacter rhizovicinus Oil degradation diagram.

[0024] Figure 4 Xanthobacter subradicis according to an embodiment of the present invention Luteibacter rhizovicinus Growth trend diagram.

[0025] Figure 5 Xanthobacter subradicis according to an embodiment of the present invention Luteibacter rhizovicinus pH value trend diagram.

[0026] Figure 6 Xanthobacter subradicis according to an embodiment of the present invention Luteibacter rhizovicinus Oil content change diagram. Detailed implementation manners

[0027] The embodiments of the present invention will be described in detail below. The examples of the embodiments are shown in the drawings. The embodiments described below by referring to the drawings are exemplary and are intended to explain the present invention, and should not be construed as a limitation to the present invention.

[0028] The present invention provides a Xanthobacter subradicis Luteibacter rhizovicinus , which was deposited on July 5, 2023 at the China General Microbiological Culture Collection Center, with the deposit number CGMCC No. 27740, and the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0029] The provided Xanthobacter subradicis Luteibacter rhizovicinus The sequence of 16s rDNA is shown in SEQ ID NO: 1.

[0030] Its 16s rDNA sequence is as follows:[[]]

[0031] The provided Xanthobacter subradicis Luteibacter rhizovicinus was obtained from kitchen waste and screened step by step through a culture medium containing animal and plant oils. After gradient domestication with an enrichment culture medium containing animal and plant oils, the Xanthobacter subradicis Luteibacter rhizovicinus was obtained by streak isolation. The mentioned animal and plant oils include but are not limited to soybean oil, corn oil, peanut oil, lard, etc. According to a preferred embodiment, the mentioned vegetable oil is soybean oil.

[0032] The present invention also provides a microbial inoculum, including the Xanthobacter subradicis Luteibacter rhizovicinus。 According to the specific implementation manner, the provided microbial inoculum is based on the above-mentioned Xanthobacter subradicis Luteibacter rhizovicinusIt is obtained by preparation. According to specific embodiments, the microbial inoculant can be prepared in the form of dry powder or bacterial liquid, and the effective viable count of the Luteibacter rhizovicinus Xanthobacter radicicola in the dry powder or bacterial liquid is at least 1×10 10 CFU / mL, for example, about 1.5×10 10 CFU / mL, 2×10 10 CFU / mL, 3×10 10 CFU / mL, 4×10 10 CFU / mL, 5×10 10 CFU / mL, 6×10 10 CFU / mL, 7×10 ⏎ 10 CFU / mL, 8×10 10 CFU / mL, 9×10 10 CFU / mL, etc. When in use, the dry powder or bacterial liquid can be pre-activated with a certain amount of sterile water or special required culture medium, for example, it can be activated for 2 - 8 h.

[0033] The microbial inoculant can be obtained by fermentation. According to specific embodiments, the microbial inoculant is obtained by fermenting and culturing the Luteibacter rhizovicinus Xanthobacter radicicola using an enrichment medium containing 0.16 wt% - 1.6 wt% animal and plant oils (soybean oil according to the preferred embodiment). The conditions for the fermentation culture are that after inoculating the Luteibacter rhizovicinus Xanthobacter radicicola into the enrichment medium, it is fermented and cultured at 28 - 32 °C and 100 - 150 r / min for 2 - 7 days. For example, it is fermented and cultured for 5 - 7 days.

[0034] According to the examples of the present invention, the formula of the enrichment medium includes 0.1 - 0.5 g of MgSO4·7H2O, 1 - 2 g of (NH4)2SO4, 0.3 - 1 g of KH2PO4, 1 - 2 g of K2HPO4, 3 - 8 g of NaCl, 1.6 - 16 g of soybean oil, 1000 mL of deionized water, and pH 7.0 - 7.2.

[0035] The above-mentioned Luteibacter rhizovicinus Xanthobacter radicicola or the above-mentioned microbial inoculant can be added to the base fertilizer to obtain a microbial fertilizer, which can then be used in places where oil degradation is required. The mentioned base fertilizer can be composted organic fertilizer. The mentioned composted organic fertilizer can be domestic waste compost (composting using raw waste (food waste) generated in the kitchen); livestock and poultry manure compost; or some dead wood compost (composting by adding fermentation auxiliary materials such as chicken manure or oil residue to the bark); or leaf mold compost (formed by piling up the fallen leaves of deciduous broad-leaved trees), etc.

[0036] The present invention also provides a method for degrading oils and fats in a sample or a site, including: using the aforesaid *Xanthobacter rhizoxinicus* Luteibacter rhizovicinus or the aforesaid microbial inoculum or the aforesaid microbial fertilizer is mixed and cultured with the sample, or placed in a site containing oils and fats, so as to degrade the oils and fats in the sample or the site. The mentioned sites include but are not limited to kitchen waste (food waste) collection sites, kitchen waste (food waste) in remote rural areas that is difficult to transport for centralized treatment, sewage pipes rich in oils and fats, etc.

[0037] The aforesaid provided *Xanthobacter rhizoxinicus* Luteibacter rhizovicinus or the microbial inoculum can be applied in the field of aerobic fermentation of kitchen waste for oil and fat degradation. When the oil and fat content of the initial material is about 20% (for example, the oil and fat content of the initial material is 15% - 30%), the oil and fat degradation efficiency is at least over 40%, for example, over 41%, over 42%, over 43%, over 44%, over 45%, over 46%, over 47%, over 48%, over 49%, over 50%, over 52%, over 55%, over 58%, over 60%. The mentioned oil and fat degradation efficiency can be achieved after fermentation for over 20 days (for example, about 25 days). The lower the oil and fat content of the initial material, the higher the corresponding oil and fat degradation efficiency.

[0038] The technical solution of the present invention will be described below through specific examples. It should be noted that these examples are only for the convenience of those skilled in the art to understand and should not be regarded as a limitation on the protection scope of the present invention. Unless otherwise specified, the reagents used in the examples can be obtained through commercial purchase.

[0039] Example 1 A strain of *Xanthobacter rhizoxinicus* was obtained through screening in Example 1 by the following method Luteibacter rhizovicinus , specifically including: Weigh 5 g of the sample from the materials during the high-temperature composting period of the kitchen waste composting process of a certain kitchen waste treatment company in the Suzhou Research Institute of China Agricultural University, and place it in 250 mL of enrichment medium (the first concentration gradient of soybean oil: 1.6 g / L, 2.4 g / L, 3.2 g / L, 4 g / L, 4.8 g / L). Incubate at 30 °C and 120 r / min for 6 - 7 days. Then, pipette 5 mL of the bacterial solution into 250 mL of a new enrichment medium (the second concentration gradient of soybean oil: 1.6 g / L, 2.4 g / L, 3.2 g / L, 4 g / L, 4.8 g / L), and incubate under the same conditions for 6 - 7 days. Gradient domestication is carried out for 6 cycles in this way (the third concentration gradient of soybean oil: 3.2 g / L, 4 g / L, 4.8 g / L, 5.6 g / L, 6.4 g / L; the fourth concentration gradient of soybean oil: 3.2 g / L, 4.8 g / L, 5.6 g / L, 6.4 g / L, 8 g / L; the fifth concentration gradient of soybean oil: 6.4 g / L, 9.6 g / L, 11.2 g / L, 12.8 g / L, 16 g / L; the sixth concentration gradient of soybean oil: 6.4 g / L, 9.6 g / L, 11.2 g / L, 12.8 g / L, 16 g / L). Each time, select the bacterial community with the best growth and better oil-degrading performance in each cycle for the next stage of gradient domestication.

[0040] Then, gradient-dilute the bacterial solution with good growth after 6 cycles of domestication, and inoculate it onto the medium added with neutral red respectively. Incubate at 30 °C for 48 hours, and observe whether the colonies turn red. If they turn red, it means that the strain can degrade oil and produce fatty acids.

[0041] Screen the colonies that turn red, pick them with an inoculation loop for streak isolation, and store the purified strains in the beef extract peptone solid slant medium for later use.

[0042] The formula of the enrichment medium used includes: basic medium and soybean oil with a certain concentration gradient. The basic medium includes: 0.1 g of MgSO4·7H2O, 1.0 g of (NH4)2SO4, 0.3 g of KH2PO4, 1.5 g of K2HPO4, 5.0 g of NaCl, 1000 mL of deionized water, and pH 7.0 - 7.2. The soybean oil with a certain concentration gradient (using soybean oil as the sole carbon source for gradient screening and domestication of microorganisms), and the mass concentration increases successively with the domestication cycle (as shown above).

[0043] The formula of the beef extract peptone solid medium used is: 5 g of beef extract, 5 g of NaCl, 10 g of peptone, 20 g of agar powder, 1000 mL of deionized water, and pH 7.0. It includes two types: flat plate and slant.

[0044] The formula of the medium containing neutral red used is as follows: add 1 mL of 1.6% (mass fraction) aqueous solution of neutral red and 5.0 g of soybean oil to the beef extract peptone solid medium.

[0045] The strain obtained by screening through this method was named NHYJX1. Then the obtained strain was characterized as follows: (1) Colony characteristics As Figure 1 shown, when the strain NHYJX1 grows on the medium containing neutral red, the colonies are significantly red, forming round and dot-like structures, and are easily distinguishable from other strains.

[0046] (2) Colony morphology Inoculate the strain in the solid or liquid medium onto a blank glass slide and stain it using the Gram staining method. Observe the detailed characteristics of the colonies using an optical microscope with magnifications of 100×, 200×, 500×, 630×, and 1000×. Take pictures using the software LASV4.3.

[0047] Microscopic observation shows that Figure 2 as Figure 2 can be observed, spherical bacterial cells can be seen.

[0048] (3) Identification of the strain Use a DNA extraction kit (manufacturer: Beijing Boyoushun Biotechnology Co., Ltd.) to extract the genome. Take the extracted DNA as the PCR template, and use primers (synthesized by BGI) and a PCR instrument (Tgradient produced by Biometra) to perform PCR amplification to obtain the PCR amplification product. All reagents used for amplification such as Taq DNA polymerase were purchased from TaKaRa Company.

[0049] The universal primers used include: 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO:2); [[ID=;33]] 1492R: TACGGCTACCTTGTTACGACTT (SEQ ID NO:3).

[0050] The PCR amplification system is as follows: 2 μL of the treated sample (20 ng / μL) template, 2.5 μL of dNTP mixture (2.5 mM), 1.5 μL of each primer (20 μM), 5 μL of 10× ExTaq buffer (Mg 2+ plus), 0.2 μL of ExTaq enzyme (5 U / μL), and make up to 50 μL with ddH2O.

[0051] The PCR amplification procedure was as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 45 s, for 30 cycles; extension at 72 °C for 5 min.

[0052] After the PCR amplification products were detected by 1.5% agarose, the target bands were recovered, purified using a PCR purification kit (manufacturer: Promega), and then sequenced bidirectionally using the amplification primers (sequencer: ABI 3730xl). After splicing the obtained sequencing results, they were input into GenBank and compared online using Blast. Finally, this strain was identified as Flavobacterium subradicis. Luteibacter rhizovicinus The sequence of its 16S rDNA is shown in SEQ ID NO:1. This strain was deposited in the China General Microbiological Culture Collection Center, with the deposit number CGMCC No. 27740.

[0053] Example 2 In Example 2, the oil degradation ability of the strain prepared in Example 1 was identified.

[0054] (1) Oil degradation ability To enhance the oil degradation ability of this strain, a enrichment medium (the formula of the basal medium of this medium was the same as that in Example 1 above, except that the soybean oil addition was 10 g / L) was used to test the performance of this strain, and it was cultured at 30 °C and 120 r / min. Finally, it was found that the oil degradation efficiency of this strain exceeded 85% on the 4th day, showing excellent oil degradation performance. The results are as Figure 3 shown.

[0055] The oil degradation efficiency mentioned above was calculated by the following formula: (Oil content on day 0 - Oil content on day n) / Oil content on day 0 × 100% (2) Growth amount The growth rate of this bacterium was evaluated using the OD600 value. The OD600 value can be used to represent the growth rate of the bacterial population. The larger the OD600 value, the higher the corresponding bacterial liquid concentration. During the domestication process of the bacterial population, vegetable oil was used as the sole carbon source, and the size of the oil degradation efficiency represented the oil degradation ability of the bacterial population. The higher the oil degradation efficiency, the better the oil degradation performance of the bacterial population.

[0056] This strain was cultured in the enrichment medium (the formula of the basal medium of this medium was the same as that in Example 1 above, with a soybean oil addition of 10 g / L) at 30 °C and 120 r / min for 6 days, and the OD600 reached about 2.87. As Figure 4 shown.

[0057] (3) Acid production ability To explore the acid-producing ability of this bacterium, the pH value was used to evaluate this index. The change in the pH value of the nutrient solution represents the acidity and alkalinity of the metabolites during the growth of the bacterial community. A decrease in the pH value indicates that acidic substances are produced during the life activities of microorganisms, and conversely, alkaline substances are produced.

[0058] As Figure 5 shown, on the 6th day of culturing this strain in an enrichment medium (the basic medium formula of this medium is the same as that in Example 1 above, and the soybean oil addition amount is 10 g / L) at 30 °C and 120 r / min, the pH value is about 4.6.

[0059] Example 3 Example 3 verified the oil degradation ability of the provided strain.

[0060] Prepare a simulated fermenter with a volume of 725 mL. The fermenter is placed in an incubator with programmable temperature control, and its temperature is controlled by the incubator. Set eight temperature platforms to simulate the actual fermentation process. Platform 1: Run at 30 °C for 1 day, Platform 2: Run at 40 °C for 1 day, Platform 3: Run at 50 °C for 1 day, Platform 4: Run at 55 °C for 1 day, Platform 5: Run at 60 °C for 7 days, Platform 6: Run at 40 °C for 4 days, Platform 7: Run at 45 °C for 4 days, Platform 8: Run at 30 °C for 8 days. Fill it with a mixed material of food waste and straw (mass ratio of food waste: corn straw = 4:1). The filling rate when full is 83%, that is, 600 mL of material. Set two groups of experiments. Then, the experimental group was inoculated with Xanthobacter rhizophilus at an inoculation rate of 1% (W / W) Luteibacter rhizovicinus , and the viable count of this bacterium measured before inoculation was 1×10 10 CFU / mL, and 6 mL was inoculated. The control group was not inoculated with Xanthobacter rhizophilus Luteibacter rhizovicinus . During the composting period, samples were taken on the 0th, 3rd, 7th, 13th, 20th, and 27th days respectively. The ventilation rate was 0.2 L / (min·kg dry weight), and the interval was to ventilate for 30 min every 30 min.

[0061] Then, the oil content at different times was measured. As Figure 6 shown, after 27 days of aerobic fermentation, compared with the oil degradation efficiency of 26.59% in the control group, the oil degradation efficiency of the experimental group added with Xanthobacter rhizophilus Luteibacter rhizovicinus was higher, which was 41.46%, an increase of 14.87%.

[0062] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of Xanthobacter rhizoxinica in oil degradation, characterized in that, Luteibacter rhizovicinus The said Xanthobacter rhizophilus Luteibacter rhizovicinus was deposited on July 5, 2023 at the General Microbiology Center of the China Microbial Culture Collection Center, with the deposit number of CGMCC No. 27740. ​ 2. The use according to claim 1, characterized in that, The said Xanthobacter rhizoxinicus Luteibacter rhizovicinus The sequence of its 16s rDNA is as shown in SEQ ID NO:

1.

3. Use of microbial inoculum in oil degradation, characterized in that, The microbial inoculum includes Flavobacterium radicis Luteibacter rhizovicinus , and the Flavobacterium radicis Luteibacter rhizovicinus was deposited on July 5, 2023 at the China General Microbiological Culture Collection Center with the deposit number CGMCC No. 27740.

4. The use according to claim 3, wherein The microbial inoculant is in the form of dry powder or bacterial liquid, and the effective viable count of the *Xanthobacter rhizophilus* in the dry powder or bacterial liquid Luteibacter rhizovicinus is at least 1×10 10 CFU / mL.

5. The use according to claim 3, wherein The microbial inoculum is obtained by fermenting and culturing the **Xanthobacter radicicola** Luteibacter rhizovicinus in an enrichment medium containing 0.16 wt% to 1.6 wt% of animal and plant oils and fats; The formula of the enrichment medium includes 0.1 - 0.5 g of MgSO4·7H2O, 1 - 2 g of (NH4)2SO4, 0.3 - 1 g of KH2PO4, 1 - 2 g of K2HPO4, 3 - 8 g of NaCl, 1.6 - 16 g of soybean oil, 1000 mL of deionized water, and the pH is 7.0 - 7.

2.

6. The use according to claim 5, wherein, The conditions for the fermentation culture are as follows: after inoculating the Xanthobacter rhizoxinica Luteibacter rhizovicinus into the enrichment medium, fermenting and culturing for 2 to 7 days under the conditions of 28 to 32 °C and 100 to 150 r / min.

7. A method for degrading grease in a sample or a site, characterized in that, including: Xanthobacter subradicis Luteibacter rhizovicinus or contains Xanthobacter subradicis Luteibacter rhizovicinus The microbial inoculum is mixed and cultured with the sample or placed in a place containing oil to degrade the oil in the sample or the place.

8. The method according to claim 7, wherein The inoculum amount of the **Xanthobacter rhizoxinicus** Luteibacter rhizovicinus is 0.2 to 5% (w / w) of the amount of the sample.

9. The method according to claim 7, wherein The sample is selected from at least one of food waste and oil-containing waste, and the site is selected from at least one of oil-containing sewage pipes and oil-containing pollutant collection sites.

10. Flavobacterium rhizophilum Luteibacter rhizovicinus , and the Flavobacterium rhizophilum Luteibacter rhizovicinus was deposited on July 5, 2023 at the General Microbiological Center of the China National Culture Collection Center, with the deposit number CGMCC No. 27740.

Images