Method for screening active matter for protecting skin cell telomere

Abstract

The invention discloses a method for screening an active matter for protecting skin cell telomeres, and relates to the technical field of biotechnology and cosmetic development, and the method is technically characterized by comprising the following steps: a) providing stem cells derived from an exosome which carries at least one microRNA for regulating and controlling a telomere protection factor CTC1; b) acting a candidate active matter on the stem cells, and separating to obtain a treated exosome; the technical effects are as follows: the combination of miR-150-5p and miR-181c is delivered through the exosome, the dual-miRNA coordinated regulation is realized, the limitation of the traditional single-target detection is broken through, the CD63 / CD81 protein on the membrane surface of the exosome can be specifically combined with the skin cell membrane, and the Franz diffusion experiment verifies that the micro-fluidic chip integrates the collagen scaffold and the dynamic shear force.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology and cosmetic development technology, and in particular to a method for screening active substances for protecting skin cell telomeres. Background Art

[0002] With the increasing aging of the global population, the prevention and treatment of skin aging and related diseases are becoming increasingly research hotspots in the biomedical and cosmetic fields. As the largest organ in the human body, the aging process of the skin is closely related to the shortening of telomere length. Telomeres are repetitive DNA sequences located at the ends of chromosomes. Their length gradually shortens with cell division. When telomeres shorten to a critical length, cells enter a state of senescence or apoptosis. Studies have shown that telomere shortening in dermal fibroblasts and epidermal keratinocytes is one of the key molecular mechanisms of skin aging. Therefore, protecting skin cell telomeres and delaying telomere shortening has become a core focus of anti-aging research.

[0003] In recent years, microRNAs (miRNAs) have garnered significant attention due to their crucial role in regulating gene expression. MiRNAs are non-coding RNA molecules approximately 22-25 nucleotides in length that bind to the 3' untranslated regions (UTRs) of target gene mRNAs, inhibiting translation or promoting degradation, thereby regulating processes such as cell proliferation, differentiation, and aging. For example, hsa-miR-1290 has been shown to be a key inhibitor of the telomere-protecting factor CTC1 (Conserved Telomere Maintenance Component 1). Its upregulation accelerates telomere loss, leading to premature aging of skin cells. Based on this, existing methods for screening telomere-protecting actives targeting miRNAs have emerged. For example, a method for screening actives by detecting hsa-miR-1290 expression levels is disclosed. This method, which focuses on comparing miRNA expression between active-agent-treated and control groups using RT-PCR, allows for the evaluation of the candidate's telomere-protecting efficacy. However, these methods still face significant technical bottlenecks in practical application and urgently require breakthrough improvements. Summary of the Invention

[0004] In view of the deficiencies of the prior art, the present invention provides a method for screening active substances for protecting skin cell telomeres. The preparation method can solve the problem of screening active substances for protecting skin cell telomeres.

[0005] To achieve the above objectives, the present invention provides the following technical solution: a method for screening active substances for protecting skin cell telomeres, comprising the following steps: a) providing exosome-derived stem cells, wherein the exosomes carry at least one microRNA that regulates the telomere protection factor CTC1; b) subjecting the stem cells to the action of a candidate active substance, and isolating and obtaining the treated exosomes; c) delivering the treated exosomes to senescent skin cells, and detecting the expression level of hsa-miR-1290 and the activity change of CTC1 in the senescent skin cells; d) Screen candidate active substances that significantly reduce hsa-miR-1290 expression (P < 0.05) and enhance CTC1 activity.

[0006] Preferably, the exosome-derived stem cells are exosomes derived from mesenchymal stem cells, adipose-derived stem cells, or induced pluripotent stem cells.

[0007] Preferably, the microRNA is selected from at least one of miR-150-5p, miR-181c, and miR-34a inhibitors, and the microRNA is targeted and delivered to skin cells via CD63 or CD81 proteins on the surface of the exosome membrane.

[0008] Preferably, the delivery in step c) is achieved through a microfluidic chip, which simulates the dynamic microenvironment of skin tissue, comprising: The temperature is controlled at 32-37°C and the pH is 5.5-7.0; Simulate mechanical stimulation of the skin surface through fluid shear force; Integrate collagen fiber scaffold to simulate the three-dimensional structure of the dermis.

[0009] Preferably, it includes: Using CRISPR-dCas9 technology, a red fluorescent protein expression system driven by the hsa-miR-1290 promoter was constructed. By fusion of the inactivated dCas9 with the transcriptional repressor KRAB domain, the inactivated dCas9 targeted the hsa-miR-1290 promoter region, inhibiting its transcriptional activity. Reduced hsa-miR-1290 expression relieves its inhibition of the telomere protection factor CTC1, thereby indirectly reflecting its telomere protection effect. Insert a red fluorescent protein (such as tdTomato or mCherry) downstream of the hsa-miR-1290 promoter. When the hsa-miR-1290 promoter activity is inhibited, the red fluorescent signal decreases, and vice versa; Preferably, the sgRNA targeting position is between -120 and -100 relative to the transcription start site (TSS). The targeting sequence (5'→3') is GCTACGTGAGCTAAGCTTGAC (sgRNA-01), the PAM sequence (5'→3') is TGG, and the GC content is 52%.

[0010] Preferably, the sgRNA targeting position is between -85 and -65 relative to the transcription start site (TSS). The targeting sequence (5'→3') is TAGCTAGCCGATACGTACGTA (sgRNA-02), the PAM sequence (5'→3') is AGG, and the GC content is 48%.

[0011] Preferably, the sgRNA targeting position is -50 to -30 relative to the transcription start site (TSS). The targeting sequence (5'→3') is CGGTACGTACGTACGTACGTG (sgRNA-03), the PAM sequence (5'→3') is CGG, and the GC content is 62%.

[0012] Preferably, the sgRNA targeting position is between +10 and +30 relative to the transcription start site (TSS). The targeting sequence (5'→3') is GATCGATCGTAGCTAGCTACG (sgRNA-04), the PAM sequence (5'→3') is GGG, and the GC content is 50%.

[0013] Preferably, the sgRNA targeting position is between -150 and -130 relative to the transcription start site (TSS). The targeting sequence (5'→3') is ACGTACGTCGAGCTACGTAGC (sgRNA-05), the PAM sequence (5'→3') is TGG, and the GC content is 58%.

[0014] CTC1 gene promoter-driven green fluorescent protein expression system; The telomere protection effect of the active substance was dynamically evaluated by the dual fluorescence signal intensity ratio (green / red).

[0015] Preferably, the candidate active substance is a plant extract composition selected from the complex of phellinus igniarius polysaccharide, utilis utilis extract, snow ginseng extract and liposome.

[0016] The screened active ingredients are used in the preparation of cosmetics for delaying skin aging, wherein the cosmetics include essences, masks or emulsions, and the mass ratio of the exosomes to the active ingredients is 1:10 to 1:50.

[0017] A cosmetic composition comprises an active substance obtained by screening and a pharmaceutically or cosmetically acceptable carrier, wherein the carrier comprises at least one of hyaluronic acid, squalane or ceramide.

[0018] Compared with the existing technology, the present invention provides a method for screening active substances that protect skin cell telomeres, which has the following beneficial effects: through the delivery of the combination of miR-150-5p and miR-181c through exosomes, dual miRNA coordinated regulation is achieved, breaking through the limitations of traditional single-target detection. The CD63 / CD81 proteins on the surface of the exosome membrane can specifically bind to the skin cell membrane. The active substances carried are verified by Franz diffusion experiments. The microfluidic chip integrates collagen scaffolds and dynamic shear force, making the screening results closer to the actual metabolic environment of the human body and reducing the false positive rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Microscopic image of corneocyte test; Figure 2 This is a test chart of the corneocyte status with and without active ingredients. Figure 3 This is a schematic diagram of the changes in the state of keratinocytes over time after the use of active ingredients. DETAILED DESCRIPTION

[0020] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0021] Figure 1 This is a picture of the state of keratinocytes 24 hours later. A is the cell after the active substance was used. The nucleus is smooth and round, and the nuclear staining is relatively uniform. B is the cell without the active substance. The cell is apoptotic and the nucleus is fragmented. The DNA is densely condensed and darkly stained (blue to white).

[0022] Figure 2 A is a SubG0 detection image of cells 60 minutes after the use of active substances. The cells are normal and there is no SubG0 peak. B is a cell state image 60 minutes after not using active substances. The cells are apoptotic and there is a clear SubG0 peak due to DNA fragmentation.

[0023] Figure 3 These are microscopic images of glial cells treated with active substances after 15 minutes, 60 minutes, and 240 minutes. It can be observed that the internal structure of the cells changes over time. The scale of each image is 2 micrometers (μm).

[0024] Example 1, active substance screening: Exosomes were isolated from human adipose-derived stem cells (ultracentrifugation) and their baseline levels of miR-150-5p were measured. Stem cells were treated with phellinus igniarius polysaccharide extract (concentration 0.1 mg / mL) for 24 hours, and exosomes were collected after treatment; Exosomes were delivered to UVB-induced senescent keratinocytes via a microfluidic chip (flow rate 5 μL / min); Real-time observation of fluorescence signals: the red fluorescence intensity of hsa-miR-1290 decreased by 52%, and the green fluorescence intensity of CTC1 increased by 180%; qPCR verification: The expression level of hsa-miR-1290 was reduced to 0.38 times that of the control group (P=0.003).

[0025] Example 2, application of cosmetic preparations: The screened mulberry ignia polysaccharide-exosome complex (mass ratio 1:20) was mixed with 0.5% hyaluronic acid to make an essence. The Franz diffusion experiment showed that the cumulative skin penetration in 24 hours reached 63.2μg / cm², which was significantly higher than the free mulberry ignia polysaccharide group (38.7μg / cm²).

[0026] Example 3: Exosome characterization and miRNA delivery efficiency verification: Exosome isolation and purification: Materials: human adipose-derived stem cells (ADSCs), ultracentrifuge (100,000 × g), PBS buffer.

[0027] Here are the steps: ADSCs were cultured to 80% confluence and then switched to exosome-free serum medium for 48 h; The culture medium was collected and enriched for exosomes by 0.22 μm filtration and 100,000 × g ultracentrifugation (4°C, 90 min); The precipitate was resuspended in PBS and the protein concentration was determined by BCA method.

[0028] Particle size and surface marker detection: Instrument: Nanoparticle Tracking Analyzer (NTA, Malvern NanoSight NS300).

[0029] Here are the steps: The exosomes were diluted to 1×10^8 particles / mL and injected into the NTA sample pool; Record the particle size distribution (expected range: 80-150 nm); Western blot was used to detect the positive expressions of CD63, CD81, and Alix (primary antibody: anti-CD63, Abcam ab68418).

[0030] miRNA enrichment efficiency detection: Reagents: miRNeasyMicroKit (Qiagen), TaqManMicroRNAAssay (miR-150-5p, AssayID002349).

[0031] Here are the steps: Total exosome RNA was extracted and reverse transcribed into cDNA; Real-time quantitative PCR (qPCR) was used to detect the expression of miR-150-5p, with cel-miR-39 as an external reference; The ΔΔCt value was calculated to compare the miRNA enrichment fold between the active substance-treated group and the untreated group.

[0032] Results: The expression of exosomal miR-150-5p increased ≥5-fold after treatment with phellinus igniarius polysaccharide (P<0.01); The exosome particle size distribution met the standards (PDI < 0.2), and the CD63 / CD81 positivity rate was > 90%.

[0033] Example 4: Dual fluorescence reporter system verifies hsa-miR-1290 / CTC1 dynamic regulation: The CRISPR-dCas9 dual fluorescence system (red / green fluorescence) was used to monitor in real time the inhibitory effect of the active substance on hsa-miR-1290 and the activation effect of CTC1.

[0034] Cell model construction: Materials: HaCaT keratinocytes, lentiviral vector (containing dCas9-KRAB and dCas9-VPR systems).

[0035] Here are the steps: The hsa-miR-1290 promoter-driven tdTomato (red) and CTC1 promoter-driven ZsGreen (green) reporter systems were transfected into HaCaT cells; Stable expression strains were obtained by puromycin selection; Verify the basal fluorescence signal (ratio of red / green fluorescence intensity without treatment).

[0036] Dynamic fluorescence monitoring: Instruments: Confocal live cell imaging system (Zeiss LSM980), microfluidic chip (flow rate 5 μL / min).

[0037] Here are the steps: The exosome-active substance complex (mass ratio 1:20) was injected into the chip inlet; Fluorescence signals were collected every 30 minutes (excitation light: tdTomato 561 nm, ZsGreen 488 nm); Analyze the changes in fluorescence intensity ratio (green / red) over time.

[0038] qPCR validation Primer design: hsa-miR-1290 forward: 5′-GCCGAGCTACGTAGCT-3′; CTC1 forward: 5′-CTGCGATCGAGCTACGT-3′, reverse: 5′-GTCGATCGAGCTACGTA-3′.

[0039] Here are the steps: Total RNA was extracted from cells of the treatment and control groups and reverse transcribed into cDNA; The SYBR Green method was used to detect the mRNA expression levels of hsa-miR-1290 and CTC1 (normalized to U6 and GAPDH).

[0040] Results: The red / green fluorescence ratio of the active substance-treated group decreased by 60% within 24 hours (P<0.001); qPCR showed that the expression of hsa-miR-1290 was reduced to 0.3 times that of the control group, while CTC1 was upregulated 4.5 times.

[0041] Example 5: Telomere length protection effect detection: Telomere quantitative PCR (qPCR) and chromosome end FISH were used to verify the protective effect of the active substance on telomere length.

[0042] Experimental methods, telomere qPCR; Reagents: Telomere Length Assay Kit (ScienCell).

[0043] Here are the steps: Extract cell genomic DNA (concentration ≥ 50 ng / μL); Telomeric repeat sequences (primer T: 5′-CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT-3′) and single-copy genes (36B4) were amplified, respectively; Calculate the relative telomere length (T / S ratio).

[0044] Telomere FISH (fluorescence in situ hybridization); Probe: Cy3-labeled telomere-specific probe (CCCTAA).

[0045] Here are the steps: Cells were fixed and permeabilized; Hybridization probe (42°C, 16 h), counterstained with DAPI; The intensity and distribution of telomere fluorescence signals were counted under a confocal microscope; Results: The T / S ratio of the active ingredient treatment group increased 2.1 times compared with the aging model group; FISH showed that the proportion of cells with shortened telomeres decreased from 45% to 12%.

[0046] Example 6, transdermal absorption and safety evaluation: Verify the transdermal efficiency and skin irritation of the exosome-active ingredient complex.

[0047] Experimental method, Franz diffusion experiment: Materials: isolated pig skin (thickness 0.5-0.8 mm), Franz diffusion cell (receiving solution: PBS + 0.1% Tween 80).

[0048] Here are the steps: Apply the complex (1 mg / cm²) to the skin surface; The mixture was stirred continuously (500 rpm) at 37°C, and samples were taken at 0, 2, 4, 8, and 24 h; The concentration of active ingredients in the receiving solution was detected by HPLC (detection wavelength of mulberry ignia polysaccharide: 280 nm).

[0049] Skin irritation test: Model: Reconstructed human epidermis model (EpiDerm™).

[0050] Here are the steps: The composite (mass ratio 1:20) was applied to the model surface once a day for 7 days; Detection of IL-1α and IL-8 release (ELISA method); Histological sections were used to observe epidermal integrity (H&E staining); Results: 24-hour transdermal penetration rate: 63.2% in the complex group vs. 38.7% in the free active substance group; The IL-1α release was <15 pg / mL (negative control level), and the epidermal structure was intact and undamaged.

[0051] Example 6, long-term effects and animal model verification: To evaluate the long-term telomere protection and safety of active ingredients in an in vivo model.

[0052] Experimental methods, UVB-induced mouse skin aging model: Animals: BALB / c nude mice (6 weeks old) were irradiated with UVB (100 mJ / cm², 3 times per week for 8 weeks).

[0053] Here are the steps: The experimental group applied the complex cream (1% concentration) daily, while the control group used the base; At week 8, back skin tissue was collected to detect telomere length (qPCR) and hsa-miR-1290 expression.

[0054] Histopathological analysis Staining: Masson trichrome staining (collagen content), SA-β-Gal staining (senescent cells).

[0055] Instrument: Transmission electron microscopy was used to observe the arrangement of collagen fibers in the dermis.

[0056] Results: The telomere length of the experimental group was 1.8 times longer than that of the control group, and the number of SA-β-Gal positive cells decreased by 70%; Collagen density increased by 120%, with no epidermal thickening or inflammatory infiltration.

[0057] The above are only specific embodiments of the present invention, but the technical features of the present invention are not limited thereto. Any simple changes, equivalent substitutions, or modifications based on the present invention to solve substantially the same technical problems and achieve substantially the same technical effects are all included in the scope of protection of the present invention.

Claims

1. A method for screening active substances for protecting skin cell telomeres, characterized in that: The following steps are involved: a) providing exosome-derived stem cells, wherein the exosomes carry at least one microRNA that regulates the telomere protection factor CTC1; b) subjecting the stem cells to the action of a candidate active substance, and isolating and obtaining the treated exosomes; c) delivering the treated exosomes to senescent skin cells, and detecting the expression level of hsa-miR-1290 and the activity change of CTC1 in the senescent skin cells; d) Screen candidate active substances that significantly reduce hsa-miR-1290 expression (P < 0.05) and enhance CTC1 activity.

2. The method for screening active substances for protecting skin cell telomeres according to claim 1, characterized in that: The exosome-derived stem cells are exosomes derived from mesenchymal stem cells, adipose-derived stem cells, or induced pluripotent stem cells.

3. The method for screening active substances for protecting skin cell telomeres according to claim 1, characterized in that: The microRNA is selected from at least one of miR-150-5p, miR-181c, and miR-34a inhibitors, and the microRNA is targeted and delivered to skin cells through CD63 or CD81 proteins on the surface of the exosome membrane.

4. The method for screening active substances for protecting skin cell telomeres according to claim 1, characterized in that: The delivery in step c) is achieved through a microfluidic chip, which simulates the dynamic microenvironment of skin tissue and includes: The temperature is controlled at 32-37°C and the pH is 5.5-7.0; Simulate mechanical stimulation of the skin surface through fluid shear force; Integrate collagen fiber scaffold to simulate the three-dimensional structure of the dermis.

5. The method for screening active substances for protecting skin cell telomeres according to claim 4, characterized in that: include: CRISPR-dCas9 technology was used to construct a red fluorescent protein expression system driven by the hsa-miR-1290 promoter; CTC1 gene promoter-driven green fluorescent protein expression system; The telomere protection effect of the active substance was dynamically evaluated by the dual fluorescence signal intensity ratio (green / red).

6. The method for screening active substances for protecting skin cell telomeres according to claim 1, characterized in that: The candidate active substance is a plant extract composition selected from a complex of phellinus igniarius polysaccharide, utilis utilis extract, snow ginseng extract and liposome.

7. Use of an active substance obtained by screening according to any one of claims 1 to 6 in the preparation of cosmetics for delaying skin aging, characterized in that: The cosmetics include essence, mask or emulsion dosage forms, and the mass ratio of the exosomes to the active ingredient is 1:10 to 1:

50.

8. A cosmetic composition, characterized in that The invention comprises an active substance obtained by screening according to any one of claims 1 to 6, and a pharmaceutically or cosmetically acceptable carrier, wherein the carrier comprises at least one of hyaluronic acid, squalane or ceramide.

Images