A soybean-derived antibacterial peptide GmNP8 and its application in antibacterial and disease resistance

Abstract

The present invention belongs to the field of molecular biology technology and specifically relates to a soybean-derived antimicrobial polypeptide, GmNP8, and its use in antibacterial and disease resistance. The present invention discloses a soybean-derived polypeptide, GmNP8, with anti-oomycete activity. Its amino acid sequence is shown in SEQ ID NO. 1, and its nucleotide sequence is shown in SEQ ID NO. 2. Experiments have shown that the polypeptide GmNP8 provided by the present invention can act on and rupture the cell membranes of Phytophthora sojae zoospores, thereby killing the spores and preventing the zoospores from infecting plants, thereby preventing the occurrence of diseases. The present invention is of great significance for the prevention and control of soybean diseases.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a soybean-derived antibacterial polypeptide GmNP8 and its application in antibacterial and disease resistance. Background Art

[0002] Soybean ( Glycine max ) is an important food and oil crop in the world, and its production is closely related to the global food supply and oil industry. However, soybean phytophthora ( Phytophthora sojae ) soybean root rot caused by infection of soybean by Phytophthora spp. is a devastating plant disease that poses a serious threat to the production of the global soybean industry. In nature, the asexual reproduction stage of Phytophthora spp. produces multinucleate sporangia. The zoospores released by mature sporangia have a biflagellar structure that can recognize signals from the soybean root system, migrate to new hosts through chemotaxis, and initiate new infection. Existing methods for the prevention and control of soybean Phytophthora spp. mainly include the use of pesticides and the cultivation of disease-resistant varieties, but both have certain limitations, such as pesticide residue problems and easy loss of disease resistance. Therefore, it is of great significance to develop new, safe, and efficient strategies to resist soybean Phytophthora spp.

[0003] Peptides, due to their ease of synthesis, high stability, and safety, have become an important area of ​​research for antibacterial and disease resistance. However, plant-derived peptides with demonstrated anti-oomycete activity are currently lacking. Therefore, the present invention aims to provide a novel anti-Phytophthora sojae peptide identified from soybeans and to explore its potential applications. Summary of the Invention

[0004] The present invention provides a soybean-derived polypeptide resistant to Phytophthora sojae, which can act on the cell membrane of Phytophthora sojae zoospores and rupture them, thereby preventing the zoospores from infecting plants, thereby achieving the purpose of preventing the occurrence of related diseases caused by Phytophthora sojae.

[0005] In one aspect, the present invention provides a soybean-derived polypeptide GmNP8, wherein the amino acid sequence of the polypeptide GmNP8 is any one of the following:

[0006] 1) the amino acid sequence shown in SEQ ID NO. 1; or

[0007] 2) An amino acid sequence having more than 95% identity with any one or more amino acids in the amino acid sequence shown in 1) obtained by substitution, deletion and / or addition of one or more amino acids and / or terminal modification.

[0008] In certain embodiments, identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using an internet identity search site, such as the BLAST page on the NCBI homepage. The 95% or greater identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0009] On the other hand, the present invention also provides a nucleic acid encoding the polypeptide GmNP8, the sequence of the nucleic acid is any one of the following,

[0010] 1) the nucleotide sequence shown in SEQ ID NO. 2; or

[0011] 2) It can hybridize with the complementary sequence of the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions and encode a protein having the same function as the protein encoded by the nucleotide sequence shown in SEQ ID NO. 2.

[0012] By adopting the above technical scheme, the present invention provides a soybean-derived polypeptide GmNP8 with anti-oomycete activity, which can be obtained by artificial synthesis or encoded by its nucleic acid sequence.

[0013] On the other hand, the present invention also provides a composition having the function of inhibiting oomycete infection of plants, wherein the active ingredient of the composition includes the polypeptide GmNP8 or the nucleic acid encoding the polypeptide GmNP8.

[0014] In certain embodiments, the main active ingredient in the composition is the polypeptide GmNP8 or the nucleic acid encoding the polypeptide GmNP8, and may further include at least one adjuvant and / or at least one carrier; preferably, the active ingredient in the composition accounts for 0.5%-95% of the total weight; preferably 1%-90%.

[0015] In certain embodiments, the composition is in any agriculturally acceptable dosage form; preferably, the dosage form includes emulsifiable concentrates, microemulsions, water emulsions, suspensions, dispersible oil suspensions, wettable powders, emulsifiable powders, granules, water-dispersible granules, emulsifiable granules, dry suspensions, tablets, effervescent tablets; more preferably, the dosage form is a wettable powder, or a water-dispersible granule, or a suspension.

[0016] On the other hand, the present invention also provides the use of the polypeptide GmNP8 or the nucleic acid encoding the polypeptide GmNP8 or the composition in inhibiting oomycete infection of plants.

[0017] Using the above technical solution, the polypeptide GmNP8 or the nucleic acid encoding the polypeptide GmNP8 or the composition is brought into contact with the oomycete, and acts on the cell membrane of the zoospore and ruptures it, thereby killing the spores and effectively inhibiting the growth of oomycete hyphae.

[0018] In certain embodiments, the oomycetes include Phytophthora ( Phytophthora ), Downy Phytophthora ( Peronophythora ), plant Pythium ( Phytopythium ) or Pythium ( Pythium ) bacteria.

[0019] In certain embodiments, the oomycete is Phytophthora sojae ( Phytophthora sojae ).

[0020] In certain embodiments, the plant is soybean.

[0021] On the other hand, the present invention also provides a method for improving plant resistance to oomycetes, comprising the following steps: infiltrating or spraying plant tissues or cells with the polypeptide GmNP8 or the nucleic acid encoding the polypeptide GmNP8 or the composition containing the polypeptide GmNP8.

[0022] In certain embodiments, the plant is soybean.

[0023] In certain embodiments, the oomycetes include Phytophthora ( Phytophthora ), Downy Phytophthora ( Peronophythora ), plant Pythium ( Phytopythium ) or Pythium ( Pythium ), preferably Phytophthora sojae ( Phytophthora sojae ).

[0024] Compared to the prior art, the present invention discovered a soybean-derived polypeptide, GmNP8, with anti-oomycete activity. Its amino acid sequence is shown in SEQ ID NO. 1, and its nucleotide sequence is shown in SEQ ID NO. 2. Experiments have demonstrated that the polypeptide GmNP8 provided by the present invention can act on and rupture the cell membranes of Phytophthora sojae zoospores, thereby killing the spores and preventing the zoospores from infecting plants, thereby preventing the occurrence of diseases. The present invention provides a new approach for preventing and controlling soybean diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a scanning electron microscope photograph of soybean Phytophthora zoospores after being treated with GmNP8 polypeptide.

[0026] Figure 2 This is a diagram showing the inhibitory effect of polypeptide solutions of different concentrations on the growth of soybean Phytophthora mycelium.

[0027] Figure 3 This is a diagram showing the effect of soybean Phytophthora zoospores containing GmNP8 polypeptide on the prevention and control of soybean diseases. DETAILED DESCRIPTION

[0028] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores.

[0029] Example 1 Artificial Synthesis of GmNP8 Polypeptide

[0030] Based on the translationomics and transcriptomics data of soybean during the interaction period with soybean Phytophthora sojae obtained in the laboratory in the early stage, analysis revealed the presence of some polypeptides in the untranslated regions of the soybean genome that were upregulated during the interaction period. Experimental verification by transiently expressing the candidate polypeptides in tobacco and inoculating tobacco Phytophthora sojae revealed that the polypeptides could significantly reduce the area of ​​lesions. Thus, a soybean-derived polypeptide GmNP8 was obtained. The amino acid sequence of the polypeptide is: MIKIRVRPLFALGFKFL (SEQ ID NO.1), and the nucleotide sequence encoding the polypeptide is: ATGATTAAAATAAGAGTAAGACCGTTGTTCGCATTAGGATTTAAATTTCTA (SEQ ID NO.2).

[0031] The polypeptide GmNP8 shown in SEQ ID NO.1 was artificially synthesized and consists of 17 amino acids. The synthesis of the GmNP8 polypeptide was carried out by Nanjing Jiepeptide Biotechnology Co., Ltd., and the GmNP8 polypeptide dry powder was obtained with a purity of >95%.

[0032] Example 2 Effect of GmNP8 polypeptide on zoospores

[0033] 1. Obtaining zoospores of Phytophthora sojae

[0034] The wild-type strain of soybean Phytophthora was placed in a culture dish containing 10% V8 liquid culture medium and cultured in the dark at 25°C for 4 days. The culture medium was filtered out, and the mycelium was rinsed 2-3 times with sterile ultrapure water. Finally, it was soaked in sterile ultrapure water to stimulate sporangium formation and cultured until a large number of zoospores were released. The soybean Phytophthora zoospore suspension was obtained, and the spore concentration was counted under a microscope.

[0035] 2. Scanning electron microscope observation

[0036] Prepare a 1 mmol / L peptide solution by adding 1 mg of the synthesized GmNP8 peptide powder to 490 μL of sterile ultrapure water. Add an appropriate amount of peptide solution to the zoospore suspension to achieve a peptide concentration of 1 μM. Incubate at 25°C in the dark for 30 minutes. Then, add glutaraldehyde solution to a 3% glutaraldehyde concentration. Fix the sample and store in a refrigerator at 4°C. A control group consists of a zoospore suspension without peptide solution.

[0037] The zoospore pellet was collected by centrifugation at 3500 × g for 2 minutes, then dehydrated using a gradient of 30%, 50%, 70%, 90%, and 100% ethanol, followed by drying using a carbon dioxide critical point dryer. The samples were then coated using platinum targets and observed using a scanning electron microscope.

[0038] The results are as follows Figure 1 As shown, deep cracks appeared on the surface of zoospores with the addition of small peptides, while the surface of normal zoospores without the addition of small peptides was smooth, and the two flagella were clear and complete, indicating that the small peptide can act on the cell membrane of zoospores and rupture it, thereby killing the spores.

[0039] Example 3 Antibacterial Experiment

[0040] Take 1 mg of the GmNP8 peptide powder synthesized above and add 490 μL of sterile ultrapure water to prepare a peptide solution with a concentration of 1 mmol / L. Use sterile ultrapure water to dilute the peptide solution to 500 μM, 50 μM, and 5 μM. Use a 6mm punch to take the soybean phytophthora cake and place it in the center of the 10% V8 solid culture medium. Place 4 Oxford cups evenly 2 cm from the center. Add 50 μL of peptide solutions of different concentrations to each Oxford cup, and use sterile ultrapure water as a control. The specific position order is shown in the table. Figure 2 On the right, the plate was sealed and grown in a dark incubator at 25°C for 3 days. Figure 2 As shown on the left, the 500 μM peptide solution has an effect on Phytophthora sojae ( Phytophthora sojae ) Mycelium has a direct inhibitory effect.

[0041] Example 4 Effects of GmNP8 polypeptide in preventing and controlling diseases

[0042] 1 mg of the synthesized GmNP8 peptide powder was added to 490 μL of sterile ultrapure water to prepare a 1 mmol / L peptide solution. The zoospore suspension was taken and an appropriate amount of the peptide solution was added to achieve peptide concentrations of 50 μM, 5 μM, 500 nM, 50 nM, and 5 nM. The spore concentration was counted, and 100 zoospores were inoculated on the hypocotyl of each etiolated soybean seedling. After incubation at 25°C and 80% relative humidity in the dark for 2 days, the lesions were photographed and recorded. Sterile ultrapure water was used as a peptide control.

[0043] The results are as follows Figure 3 As shown in the results, the size of the lesions on the hypocotyls of etiolated soybean seedlings inoculated with the small peptide GmNP8 after zoospores were treated was significantly smaller than that in the water treatment. As the concentration increased, the size of the lesions gradually decreased, indicating that the disease prevention effect of the small peptide GmNP8 was dose-dependent. In summary, the small peptide GmNP8 has a good function in preventing the occurrence of diseases.

[0044] While the specific embodiments of the present invention have been described in detail above, these are intended to be exemplary only, and the present invention is not limited thereto. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, any equivalent changes and modifications made without departing from the spirit and scope of the present invention are intended to be encompassed within the scope of the present invention.

Claims

1. A soybean-derived polypeptide GmNP8, characterized in that: The amino acid sequence of the polypeptide GmNP8 is shown in SEQ ID NO.

1.

2. The nucleic acid encoding the polypeptide GmNP8 according to claim 1, characterized in that The sequence of the nucleic acid is shown in SEQ ID NO.

2.

3. A method for inhibiting soybean phytophthora ( Phytophthora sojae ) A composition for infecting soybean, characterized in that The active ingredient of the composition includes the polypeptide GmNP8 according to claim 1 or the nucleic acid according to claim 2.

4. The composition according to claim 3, characterized in that The dosage form of the composition is any one of emulsifiable concentrate, microemulsion, aqueous emulsion, suspension, dispersible oil suspension, wettable powder, granule, water-dispersible granule, emulsifiable granule and tablet.

5. The polypeptide GmNP8 according to claim 1, the nucleic acid according to claim 2, or the composition according to claim 3 in inhibiting Phytophthora sojae ( Phytophthora sojae ) infecting soybeans.

6. The use according to claim 5, characterized in that The application comprises the following steps: combining the polypeptide GmNP8 according to claim 1, the nucleic acid according to claim 2, or the composition according to claim 3 with Phytophthora sojae ( Phytophthora sojae ) contact, acting on the cell membrane of zoospores to rupture them or acting on the mycelium to inhibit its growth.

7. A method for improving soybean resistance to Phytophthora sojae ( Phytophthora sojae ) resistance method, characterized in that, The method comprises the following steps: infiltrating or spraying soybean tissue or cells with the polypeptide GmNP8 according to claim 1, the nucleic acid according to claim 2, or the composition according to claim 3.

Images