RdDH3 gene and application thereof in preparation of product for inhibiting in-vivo virus replication of electro-optic leafhopper

By silencing the RdDH3 gene of electro-optic leafhopper and using specific dsRNA to interfere with RSMV replication, the problem of electro-optic leafhopper spreading rice stripe mosaic disease is solved, and effective prevention and control of rice stripe mosaic disease is achieved. dsRNA is used as a new generation of RNA pesticides in agricultural production.

CN120464630APending Publication Date: 2025-08-12SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510373628.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-27
Publication Date
2025-08-12

AI Technical Summary

Technical Problem

The prior art lacks effective RNA biopesticides to inhibit the transmission of rice stripe mosaic virus by electro-optic leafhopper, resulting in difficulties in preventing and controlling rice stripe mosaic disease.

Method used

By silencing the RdDH3 gene of electro-optic leafhopper, specific dsRNA is used to interfere with RSMV replication in electro-optic leafhopper, dsRNA is developed as a new generation of RNA pesticides to inhibit the replication of viruses in electro-optic leafhoppers and weaken its propagation ability.

Benefits of technology

It significantly reduces the RSMV replication level in the body of electro-optic leafhoppers and effectively prevents and treats rice stripe mosaic disease. dsRNA has the advantages of high specificity, environmentally friendly and harmless to humans, showing broad application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120464630A_ABST
    Figure CN120464630A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of agricultural biology, and particularly provides a gene RdDH3 of electro-optic leafhopper, and the nucleotide sequence of the gene RdDH3 is shown as SEQ ID NO.1. The invention proves that the replication level of the RSMV in the electro-optic leafhopper can be obviously reduced by silencing the electro-optic leafhopper RdDH3 gene, so that an important theoretical basis is provided for developing a molecular target for preventing and controlling the rice stripe mosaic disease. Besides, specific dsRNA is developed for the RdDH3 gene, and the dsRNA can remarkably inhibit replication of RSMV in the electro-optic leafhopper, so that the transmission capacity of the RSMV in the electro-optic leafhopper is weakened, and finally effective prevention and control of the rice stripe mosaic disease are achieved. The dsRNA disclosed by the invention has the advantages of high specificity, environmental friendliness and no toxicity or harm to human beings, can be applied to agricultural production as a new generation of RNA pesticide, and shows wide application prospects and important application values.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology, and more specifically relates to the RdDH3 gene and its application in preparing a product for inhibiting viral replication in the electric leafhopper. Background Art

[0002] Rice stripe mosaic virus (RSMV), caused by rice stripe mosaic virus, is a new rice disease that was first discovered in the rice-growing areas of southwestern Guangdong, my country in 2015. The virus belongs to the genus Cytoplasmic Rhabdovirus of the family Rhabdoviridae, and causes significant damage to rice plants after infection. Infected rice plants show a variety of abnormal symptoms: first, the height of the plants is significantly shorter than that of healthy plants; second, light yellow stripes or mosaic-like lesions appear on the leaves, and the tips of some leaves are twisted, and in severe cases, even deformed structures similar to "springs" are formed. In addition, the number of tillers in diseased plants increases abnormally. Although they can produce heading normally, the panicles are poorly developed, mostly manifested as necked panicles or shriveled white panicles, resulting in a significant decrease in the fruit set rate, which in turn seriously affects the overall rice yield.

[0003] The electric leafhopper (E. glaucoma) is the primary vector of RSMV transmission, employing a persistent, multiplying transmission mechanism. Under laboratory conditions, the average transmission efficiency of the leafhopper reached 57.1%, demonstrating that it is a key vector for the efficient spread of RSMV. Notably, both adults and nymphs of the leafhopper are capable of transmitting RSMV, but nymphs are more efficient at acquiring and transmitting the virus. Studies have shown that nymphs have higher rates of virus acquisition and transmission than adults. When feeding on infected rice, leafhoppers acquire the virus extremely quickly: within just three minutes, the virus transmission rates for adults and nymphs reach 19.2% and 24.4%, respectively. The virus acquisition rate increases significantly with longer feeding time, reaching a peak of 71.9% when feeding for more than three hours. Once the leafhoppers successfully acquire the virus and complete the cycle, they can rapidly spread the virus to healthy rice seedlings.

[0004] To fundamentally suppress the spread of RSMV, interrupting the transmission pathways of the electric leafhopper has become a key strategy. RNA biopesticides are an emerging biological control method. By preparing dsRNA that specifically targets key genes in insects or pathogens, they interfere with or inhibit the transcription of specific genes in the target organism, ultimately achieving the goal of protecting plants. Compared with traditional pesticides, RNA biopesticides have attracted much attention due to their high specificity, low development costs, and environmental friendliness. However, insect antiviral immune mechanisms are both evolutionarily conserved and species-specific. How to effectively inhibit the replication and transmission of RSMV in the electric leafhopper has become a technical challenge that needs to be addressed in the development of RNA biopesticides for the control of rice stripe mosaic disease. Summary of the Invention

[0005] The present invention aims to solve the problem of the lack of new RNA pesticides for rice stripe mosaic disease in the existing technology. It provides a gene of the electric leafhopper, and RNA interference is performed on the gene to inhibit the replication of RSMV of the electric leafhopper and prevent the electric leafhopper from spreading RSMV, thereby achieving the prevention and control of rice stripe mosaic disease.

[0006] The first object of the present invention is to provide a gene RdDH3 of the electric leafhopper and its application.

[0007] The second object of the present invention is to provide a product and its use in preventing and treating rice stripe mosaic disease.

[0008] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0009] The present invention demonstrates that silencing the RdDH3 gene of the electric leafhopper significantly reduces the replication level of rice stripe mosaic virus (RSMV) in the electric leafhopper, thereby preventing the electric leafhopper from spreading RSMV and achieving the effect of preventing and controlling rice stripe mosaic disease. Therefore, the present invention claims protection for the following solutions:

[0010] The present invention provides a gene RdDH3 of the electric leafhopper, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0011] The present invention provides the use of the above gene as a target in preparing a product for inhibiting viral replication in the electric leafhopper.

[0012] The present invention provides the use of the above gene as a target in preparing a product for inhibiting the replication of rice stripe mosaic virus in electric leafhoppers.

[0013] The present invention provides the use of the above gene as a target in preparing a product for preventing and treating rice stripe mosaic disease.

[0014] The present invention provides a product containing an expression inhibitor of the above gene, wherein the expression inhibitor includes a silencing, knocking-down, or knocking-out agent.

[0015] As an optional embodiment, the gene expression inhibitor is dsRNA, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.2.

[0016] As an optional embodiment, the dsRNA is prepared by amplifying the above gene using the primers shown in SEQ ID NO. 3 and SEQ ID NO. 4.

[0017] The present invention provides application of the above product in preparing a product for inhibiting the replication of rice stripe mosaic virus in electric leafhoppers.

[0018] The present invention provides application of the product in preventing and treating rice stripe mosaic disease.

[0019] The present invention provides application of the above product in preparing a product for preventing and treating rice stripe mosaic disease.

[0020] The present invention has the following beneficial effects:

[0021] The present invention uses bioinformatics methods to successfully extract a gene, named RdDH3, from the transcriptome of the electric leafhopper. The present invention demonstrates that silencing the RdDH3 gene significantly reduces the replication level of rice stripe mosaic virus (RSMV) in the leafhopper. This invention demonstrates for the first time that interfering with the RdDH3 gene of the electric leafhopper can effectively inhibit RSMV replication in the leafhopper, providing a new theoretical basis for in-depth analysis of the interaction mechanism between insect vectors and plant viruses, and also provides an important theoretical basis for the development of molecular targets for the prevention and control of rice stripe mosaic disease.

[0022] Furthermore, the present invention has developed a dsRNA specific for the RdDH3 gene. This dsRNA significantly inhibits the replication of RSMV in the electric leafhopper, thereby weakening the RSMV's ability to spread and ultimately achieving effective control of rice stripe mosaic disease. The dsRNA developed by the present invention boasts high specificity, is environmentally friendly, and is non-toxic to humans. It has the potential to be used as a next-generation RNA pesticide in agricultural production, demonstrating broad application prospects and significant value. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The results of RdDH3 gene expression level detection in the treatment group and the control group (Figure A shows the results of RdDH3 gene expression level detection 2 days after RSMV infection; Figure B shows the results of RdDH3 gene expression level detection 4 days after RSMV infection; in the figures, * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.0001).

[0024] Figure 2 These are the results of RSMV expression level detection in the electric leafhoppers in the treatment and control groups (Figure A shows the RSMV expression level detection results 2 days after RSMV infection; Figure B shows the RSMV gene expression level detection results 4 days after RSMV infection; in the figures, * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.0001).

[0025] Figure 3 These are the results of RSMV protein expression level detection in the treatment and control groups of the electric leafhopper. DETAILED DESCRIPTION

[0026] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0027] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0028] In the following examples, the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0029] The rice variety used in the following examples is the indica rice Taichung Zailai No. 1 (TN1), the seeds of which are propagated and preserved in this laboratory.

[0030] The rice variety used was the indica rice Taichung Zailai No. 1 (TN1), and its seeds were propagated and preserved in our laboratory.

[0031] T7 RiboMAXTM Express RNAi System, brand: Promega, product number: P1700.

[0032] Gel Extraction Kit, brand: Vazyme, item number: DC301-01.

[0033] TaKaRa Trizol kit, brand: Vazyme, item number: R401-01.

[0034] M-MLV reverse transcriptase, brand: Vazyme, product number: R312-01.

[0035] -T&B Zero Cloning Kit, brand: Beijing Quanshijin Biotechnology; product number: CTB501-01.

[0036] Clon IIOne Step Cloning Kit, brand: Vazyme; item number: C112.

[0037] Example 1 Obtaining the full-length sequence of the RdDH3 gene of the electric leafhopper

[0038] Based on the transcriptome database of the leafhopper (E. elegans), a bioinformatics approach was used to search for hormone-related genes in the leafhopper. Sequence analysis, combined with genome sequence assembly and alignment, yielded a gene sequence from the leafhopper, tentatively named RdDH3. Upstream and downstream primers for the RdDH3 gene were designed using Primer Premier 5.0 software.

[0039] Healthy, uniformly sized female and male leafhoppers were selected and frozen in liquid nitrogen. Five leafhoppers were used as a biological replicate, and total RNA was extracted from them using the TaKaRa Trizol kit, with four biological replicates.

[0040] The total RNA was reverse transcribed into first-strand cDNA using M-MLV reverse transcriptase, which was used as a template. Combined with the designed upstream and downstream primers, the full-length fragment of the RdDH3 gene was obtained by PCR amplification. The obtained product was purified and cloned. IIOne Step Cloning Kit (Vazyme), insert the target fragment into vector B zero ( -T&BZero Cloning Kit) was used to obtain the recombinant product, which was cloned and transformed into Escherichia coli DH5α (Shanghai Weidi Biotechnology Co., Ltd.). Single clones on the plates were picked for colony PCR. Positive transformants were confirmed and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the nucleotide sequence of the RdDH3 gene of the electric leafhopper is shown in SEQ ID NO.1 (5'-3'), SEQ ID NO.1:

[0041] GCATCTGACACCACCGCAGCGTCAAGAGGAGGAAAAGACCAACTTCCCCTCCAGTCCCATGACGATGCCCTCATCAGCTGTGGTCCTCAGCTCTTCTATCGTCCTGGTCCTGGTCGTCGTCCTCTCAGTTAGCCACGTCACACAGTCCCTGCCCTACTCGGGGCACAAGGGGTACCTGACAGACCTGGAGAATGACGCAGATCCAGA ACTGATGCTGGAGATTCTCACCCGACTGGGGCAGACCATCATGAGAGCCAACGACCTCGAAAATTCCAAGCGAGGCCTGGACCTCGGCCTGTCCCGTGGGTTCCCGGCTCCCAGGCAGCCAAGCACCTCATGGGTCTCGCCGCCGCCAACTACGCCGGGGGCCCGGGACGACGACGACGCGAGGCTTCCTCAACCCCTCACTGTATAA.

[0042] Example 2 dsRNA fragment series confirmation and primer design

[0043] (1) Design of dsRNA primers for the RdDH3 gene of the electric leafhopper

[0044] Based on the RdDH3 gene sequence of the electric leafhopper obtained in Example 1 (SEQ ID NO.1), the dsRNA fragment sequence of the RdDH3 gene was designed and confirmed. The dsRNA fragment sequence of the RdDH3 gene was recorded as dsRdDH3. The dsRdDH3 sequence is shown in SEQ ID NO.2. SEQ ID NO.2:

[0045] AACTTCATCCCTCCAGTCCCATGACGATGCCCTCATCAGCTGTGGTCCTCAGCTCTTCTATCGTCCTGGTCCTGGTCGTCGTCCTCTCAGTTAGCCACGTCACACAGTCCCTGCCCTACTCGGGGCACAAGGGGTACCTGACAGACCTGGAGAATGACGCAGATCCAGAACTGATGCTGGAGATTCTCACCCGACTGGGGCAGACCATCATGAGAGCCAA.

[0046] Primer premier5.0 software was used to design dsRNA primers. The dsRdDH3 primer contained an upstream primer and a downstream primer, both of which carried T7 promoter sequences.

[0047] The upstream primer sequence of dsRdDH3 is shown in SEQ ID NO.3:

[0048] TAATACGACTCACTATAGGGAACTTCATCCCTCCAGTCCC.

[0049] The dsRdDH3 downstream primer sequence is shown in SEQ ID NO.4, SEQ ID NO.4:

[0050] TAATACGACTCACTATAGGGTTGGCTCTCATGATGGTCTG.

[0051] (2) Design of GFP gene dsRNA primers

[0052] The GFP gene sequence is shown in SEQ ID NO.5 (5'-3'), SEQ ID NO.5:

[0053] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG。

[0054] The GFP gene was used as a control group, and the dsRNA fragment sequence of the GFP gene was designed and confirmed. The dsRNA fragment sequence of the GFP gene was denoted as dsGFP, and the dsGFP sequence is shown in SEQ ID NO.6, SEQ ID NO.6:

[0055] AAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTA TATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCG.

[0056] Primer premier5.0 software was used to design dsRNA primers. The dsGFP primers contained an upstream primer and a downstream primer, both of which carried T7 promoter sequences.

[0057] The dsGFP upstream primer sequence is shown in SEQ ID NO.7, SEQ ID NO.7:

[0058] TAATACGACTCACTATAGGGAAGCAGCACGACTTCTTCAAG.

[0059] The dsGFP downstream primer sequence is shown in SEQ ID NO.8, SEQ ID NO.8:

[0060] TAATACGACTCACTATAGGGCGAACTCCAGCAGGACCAT.

[0061] Example 3 Specific dsRNA Synthesis

[0062] Using the RdDH3 gene as a template (SEQ ID NO. 1), PCR amplification was performed using the dsRdDH3 upstream primer and downstream primer of Example 2 to obtain a PCR amplification product.

[0063] Using the GFP gene as a template (SEQ ID NO. 5), PCR amplification was performed using the dsGFP upstream primer and downstream primer of Example 2 to obtain a PCR amplification product.

[0064] The PCR amplification product was purified by Gel Extraction Kit and then TM The dsRNA of the RdDH3 gene and the dsRNA of the GFP gene were synthesized by in vitro transcription according to the method described in the instructions of the ExpressRNAi System kit.

[0065] The dsRNA was quantified using NaNoDrop 2000 (Thermo scientific) to a final concentration of 1 μg / μL and stored in a -80°C freezer until use.

[0066] Example 4: dsRNA of the RdDH3 gene in electrophoretic leaves down-regulates RSMV replication

[0067] 1. Preparation of RSMV Virus Crude Extract

[0068] Prepare the RSMV crude extract from freshly ground rice leaves. Place two 3 cm x 1 cm RSMV-positive rice leaves (approximately 0.6 g) at the tillering stage in a 2 mL sterile centrifuge tube. Add 200 μL of 1× PBS (pH 7.6). Use a sterile pipette to extract the juice. Centrifuge at 5000 rpm at 4°C for 1 minute (repeat 2-3 times). Use the supernatant as the RSMV crude extract.

[0069] 2. Injection of dsRNA of RdDH3 gene of electric leafhopper

[0070] dsRNA (dsRdDH3 and dsGFP) was prepared according to the method of Example 3.

[0071] Sixty healthy, uniform-sized, fourth-instar nymphs of the electric leafhopper were selected for the experiment. A treatment group and a control group were set up, with 30 fourth-instar nymphs in each group.

[0072] Treatment group (dsRdDH3 group): 5 μL of dsRdDH3 (1 μg / μL) was mixed with RSMV virus crude extract in a 1:1 volume ratio to obtain a mixture. Each fourth-instar nymph of the electric leafhopper was injected with 27.6 nL of the mixture. The mixture was gently injected into the second and third abdominal segments of the lateral abdomen of the electric leafhopper nymph along the direction of the body fluid using a microsyringe.

[0073] Control group (dsGFP group): 5 μL of dsGFP (1 μg / μL) and RSMV virus crude extract were mixed in a 1:1 volume ratio to obtain a mixture. Each fourth-instar nymph of the electric leafhopper was injected with 27.6 nL of the mixture. The mixture was gently injected into the lateral abdomen between the second and third abdominal segments of the electric leafhopper nymph along the direction of the body fluid using a microsyringe.

[0074] The electric leafhopper nymphs of the treatment group and the control group were raised in a 30°C constant temperature biochemical incubator (light: dark time = 14h:10h, temperature 30±2°C, humidity 60%) and fed with fresh TN1 rice every day.

[0075] 3. Detection of the expression levels of the RdDH3 gene and RSMV in the electric leafhopper

[0076] Sixteen nymphs injected with dsGFP and dsRdDH3 at 2 dpi (day post infection) and 4 dpi were collected and quickly frozen in liquid nitrogen for total RNA extraction and reverse transcribed into first-strand cDNA. Eight biological replicates were set up in each group, with two nymphs in each biological replicate. The relative expression levels of the target genes (RdDH3, RSMV) and the internal reference gene (β-actin) were detected by RT-qPCR. The primers for RT-qPCR are shown in Table 1.

[0077] Table 1 RT-qPCR primers

[0078] Primer name Primer sequence (5'-3') RdDH3 qPCR-F ACCTGACAGACCTGGAGAATG(SEQ ID NO.9) RdDH3 qPCR-R CGAGACCCATGAGGTGCTT(SEQ ID NO.10) β-actin qPCR-F CGTTCTGGACTCTGGTGATGG(SEQ ID NO.11) β-actin qPCR-R CTCAGCAGTGGTTGTGAAGGA(SEQ ID NO.12) RSMV qPCR-F GGATCCTCACAATGGGTACTGC(SEQ ID NO.13) RSMV qPCR-R GTCACCAGAGCAGACCTCAG(SEQ ID NO.14)

[0079] The results of RdDH3 gene expression detection were as follows Figure 1 As shown, the results showed that the expression level of the RdDH3 gene in the dsRdDH3-injected electric leafhopper nymphs was extremely significantly reduced compared with the control group (dsGFP group).

[0080] The results of RSMV expression determination were as follows Figure 2 As shown, the results showed that the RSMV expression level of electric leafhopper nymphs injected with dsRdDH3 was significantly reduced compared with the control group (dsGFP group).

[0081] Example 5 Western blot detection of RSMV protein levels

[0082] 1. Experimental Methods

[0083] Five electric leafhoppers from each of the two treatments (dsRdDH3 group and dsGFP group) of Example 4 were taken and quick-frozen in liquid nitrogen and ground at 50 Hz for 1 min. Subsequently, 20 μL of RIPA lysis buffer was added, the mixture was allowed to stand on ice for 15 min, 20 μL of 2× loading buffer was added, the mixture was boiled in boiling water for 5 min, cooled on ice for 2 min, and centrifuged at 4°C and 12,000 rpm for 10 min. The supernatant was used as the total protein of the electric leafhopper.

[0084] The total protein of the electric leafhopper was used for Western blot analysis. The primary antibody used was RSMV-N at a concentration of 1:5000; the secondary antibody used was mouse anti-antibody at a concentration of 1:8000.

[0085] 2. Experimental Results

[0086] Western blot test results Figure 3 As shown, the results showed that the RSMV virus content at the protein level in the electric leafhopper nymphs injected with dsRdDH3 was reduced compared with the control group (dsGFP group).

[0087] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A gene RdDH3 of the electric leafhopper, characterized in that The nucleotide sequence is shown in SEQ ID NO.

1.

2. Use of the gene according to claim 1 as a target in the preparation of a product for inhibiting viral replication in the electric leafhopper.

3. Use of the gene according to claim 1 as a target in the preparation of a product for inhibiting the replication of rice stripe mosaic virus in the electric leafhopper.

4. Use of the gene according to claim 1 as a target in the preparation of a product for preventing and treating rice stripe mosaic disease.

5. A product, characterized in that An expression inhibitor comprising the gene according to claim 1, wherein the expression inhibitor comprises a silencing, knocking-down, or knocking-out agent.

6. The product according to claim 5, characterized in that: The gene expression inhibitor according to claim 1 is dsRNA, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.

2.

7. The product according to claim 6, characterized in that The dsRNA is prepared by amplifying the gene according to claim 1 using the primers shown in SEQ ID NO. 3 and SEQ ID NO.

4.

8. Use of the product according to any one of claims 5 to 7 in the preparation of a product for inhibiting the replication of rice stripe mosaic virus in electric leafhoppers.

9. Use of the product according to any one of claims 5 to 7 in preventing and treating rice stripe mosaic disease.

10. Use of the product according to any one of claims 5 to 7 in the preparation of a product for preventing and treating rice stripe mosaic disease.