Specific primer for distinguishing rice and barnyard grass and application thereof

Abstract

The invention discloses a specific primer for distinguishing rice and barnyard grass and application of the specific primer, and belongs to the technical field of biological species identification. The sequences of the specific primers are as shown in SEQ ID NO. 1 and SEQ ID NO. 2. The specific primer is designed according to the nuclear gene ITS sequence of the rice, the specific primer can accurately identify the rice through PCR, the identification method is stable, the detection time is short, the specificity is high, the detection limit is low, the identification method is not affected by material characters, rapid and accurate identification of the rice and barnyard grass can be achieved, and the identification efficiency is high. The problem that a method for effectively and rapidly distinguishing rice and barnyard grass does not exist at present is solved.

Description

Technical Field

[0001] The invention relates to the technical field of biological species identification, and in particular to a specific primer for distinguishing rice from barnyard grass and an application thereof. Background Art

[0002] Rice is the staple food of nearly half the world's population. Rice cultivation is crucial for ensuring national food security and promoting economic development. Barnyardgrass (Echinochloa crusgalli) is a common field weed and a major target of global research for its control. In rice fields, barnyardgrass, as a dominant or subdominant weed population, competes with the dominant or subdominant populations to deplete the paddy's environmental resources, inhibiting rice growth and development, leading to reduced yields. Barnyardgrass seedlings are morphologically very similar to rice seedlings and are often mistaken for rice. Therefore, correctly distinguishing between barnyardgrass and rice in farmland management is crucial to ensuring food production.

[0003] Currently, the distinction between rice and barnyard grass relies solely on empirical judgment, and no research has been reported on how to quickly distinguish between rice and barnyard grass at the molecular level. Summary of the Invention

[0004] In order to solve the above technical problems, the purpose of the present invention is to provide a specific primer for distinguishing rice from barnyard grass and its application, so as to solve the problem of lack of effective and rapid method for distinguishing rice from barnyard grass.

[0005] The technical solution of the present invention to solve the above technical problems is as follows:

[0006] The first object of the present invention is to provide a specific primer for distinguishing rice from barnyard grass, the sequences of the specific primers are shown in SEQ ID NO.1 and SEQ ID NO.2;

[0007] Forward primer SEQ ID NO. 1: 5′-CGCGATACCACGAGTTAAATCCA-3′;

[0008] Reverse primer SEQ ID NO. 2: 5′-GTGCACTGCGGCCTAGAG-3′.

[0009] The second object of the present invention is to provide a kit for distinguishing rice from barnyard grass, comprising the above-mentioned specific primers.

[0010] The third object of the present invention is to provide the use of the above-mentioned specific primers or kit in distinguishing rice from barnyard grass.

[0011] A fourth object of the present invention is to provide a method for distinguishing rice from barnyard grass, comprising the following steps:

[0012] S1: Extract DNA from the plant to be tested;

[0013] S2: using the DNA obtained in S1 as a template, performing PCR amplification using the specific primers described in claim 1;

[0014] S3: Perform electrophoresis on the PCR amplification product obtained in S2. If a 348 bp fragment appears in the electrophoresis product, the plant to be tested is rice; otherwise, it is not rice.

[0015] Furthermore, the PCR amplification system includes: 2×Papid Taq Master Mix, specific primers, DNA template and sterile water.

[0016] Furthermore, the PCR amplification system was a 25 μL system, including: 12.5 μL of 2×Papid Taq Master Mix, 0.25 μL each of forward / reverse specific primers, 1 μL of DNA template, and the balance was sterile water.

[0017] Furthermore, the concentrations of the forward / reverse specific primers were both 0.05-0.2 μmol / L.

[0018] Furthermore, the PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 min; then denaturation at 94°C for 30 s, annealing at 58-64°C for 30 s, and extension at 72°C for 30 s, for 20-35 cycles; and finally extension at 72°C for 5 min.

[0019] The present invention has the following beneficial effects:

[0020] The present invention designs specific primers based on the ITS sequence of the nuclear gene of rice. The specific primers can accurately identify rice through PCR. The identification method is stable, has a short detection time, strong specificity, a low detection limit, and is not affected by material properties. It can achieve rapid and accurate identification of rice and barnyard grass. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a comparison diagram of the ITS gene sequences of rice and barnyard grass in Example 1;

[0022] Figure 2 This is a graph showing the quality of DNA extracted from rice samples in Example 2, where A and B are two groups of samples;

[0023] Figure 3 This is a graph showing the quality of DNA extracted from barnyardgrass samples in Example 2, where A and B represent two groups of samples.

[0024] Figure 4 This is a graph showing investigation of PCR reactions at different annealing temperatures in Example 2;

[0025] Figure 5Graph showing investigation of PCR reactions at different cycle numbers in Example 2;

[0026] Figure 6 This is a graph showing the PCR detection limit in Example 2;

[0027] Figure 7 This is a diagram showing the adaptability of the samples in Example 2. DETAILED DESCRIPTION

[0028] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples are only used to explain the present invention and are not intended to limit the scope of the invention. In the embodiments, if specific conditions are not specified, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.

[0029] Example 1: Specific primer design

[0030] The ITS sequences of rice (Oryza sativa L.) and barnyard grass (Echinochloa crus-galli) were downloaded from the NCBI gene bank. The accession numbers are as follows: Figure 1 The ITS sequence of rice is shown as SEQ ID NO. 3, and the ITS sequence of barnyard grass is shown as SEQ ID NO. 4, and they were imported into Geneious Prime for alignment. The sequences were compared to find the differential sites.

[0031] SEQ ID NO.3:TCGTGACCCTGACCAAAACAGACCGCGAACGCGT CACCCCTGCCCGCCGAGCGCTCGCGCGCGAGGCAACCGAGGGCCCCGGGCCGCAACAGAACCCACGGCGCCGACGGCGTCAAGGAACACAGCGATACGCCCCGCGCCGGCCCGGTCGGCCCTGGCCGTCCGGCGGCGCGGCGCGATACCACGAGTTAAATCCACACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACCTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCAAAAGACGCTCCGCGCGCCCCCCCTATCCGGGAGGGCGCGGGGACGCGGTGTCTGGCCCCCCGCGCCTCGCGGCGCGGTGGGCCGAAGCTCGGGCTGCCGGCGAAGCGTGCCGGGCACAGCGCATGGTGGACAGCTCACGCTGGCTCTAGGCCGCAGTGCACCCCGGCGCGCGGCCGGCGCGGTGGCCCCTCAGGACCCAAACGCACCGAGAGCGAACGCCTCGGACC;

[0032] SEQ ID NO.4: GCGAACGTGTCTCCAATGCTGCCGGGCTTCGGTCC GGTAAAGGCTCCCGACCTTCGTTTCGAGGGGGAGGAGCCGCAAAAGAACCCACGGCGCCGAAGGCGTCAAGGAACACTAATATTGCCTTGCTCGGGACCGTGGCTGGCTTGCCAGCCACTGCCCGTGCAGCGATGCTATACTAATCCACACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACCTGGTGTGAATTGCAGAATCCCGCGAACCATC GAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCAAAAAGACACTCCCACCCCATCATCGTGTGTAGGATGTGGCGTTTGGCTCCCCGTGCCTGAAGGTGCGGTGGGCCGAAGTTGGGGCTGCCGGCATACCGTGTCGGGCACAGCACGTGGTGGGCGACTACAAGTTGTTCTCGGTGCAGCGTCCCGGCACGCAGCTAGCTTGATGGCCCT.

[0033] The rice reference gene accession number is DQ355266.1, of which nucleotide 191 is G, nucleotide 194 is A, nucleotide 196 is A, nucleotide 198 is C, nucleotide 199 is G, nucleotide 205 is C or T, nucleotide 534 is C, nucleotide 538 is A, and nucleotide 542 is C.

[0034] The accession number of the barnyardgrass reference gene is MF063573.1, and its nucleotide 191 is C, nucleotide 194 is G, nucleotide 196 is G, nucleotide 198 is G, nucleotide 199 is A, nucleotide 205 is G, nucleotide 534 is T, nucleotide 538 is C, and nucleotide 542 is T.

[0035] Based on the above differential sites, specific primers were designed to amplify only rice.

[0036] The sequences of the specific primers are as follows:

[0037] Forward primer SEQ ID NO. 1: 5′-CGCGATACCACGAGTTAAATCCA-3′;

[0038] Reverse primer SEQ ID NO. 2: 5′-GTGCACTGCGGCCTAGAG-3′.

[0039] Example 2: A method for distinguishing rice from barnyard grass based on specific primers

[0040] 1. The differentiation method includes the following steps:

[0041] S1: Take rice seedlings and barnyard grass seedlings as test samples.

[0042] S2: Genomic DNA Extraction

[0043] The surface of the sample obtained in S1 was wiped with 75% ethanol and DNA was extracted using a plant genomic DNA extraction kit. The specific steps are as follows:

[0044] (1) Take about 20 mg of rice or barnyard grass leaves and grind them thoroughly in liquid nitrogen;

[0045] (2) The powder ground in step (1) was quickly transferred to a centrifuge tube pre-filled with 700 μL of 65°C preheated buffer GP1 (mercaptoethanol was added to the preheated GP1 before the experiment to make its final mass concentration 0.1%), and after rapid inversion to mix evenly, the centrifuge tube was placed in a 65°C water bath for 20 min. During the water bath, the centrifuge tube was inverted several times to mix the sample.

[0046] (3) Add 700 μL of chloroform to the sample after water bath in step (2), mix well, and then centrifuge at 12000 rpm for 5 min;

[0047] (4) Carefully transfer the upper aqueous phase obtained by centrifugation in step (3) to a new centrifuge tube, add 700 μL of buffer GP2, and mix thoroughly;

[0048] (5) Transfer the mixed liquid from step (4) to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, and discard the waste liquid;

[0049] (6) Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube;

[0050] (7) Add 600 μL of rinse solution PW to the adsorption column CB3 obtained in step (6), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube;

[0051] (8) Repeat step (7);

[0052] (9) Place the adsorption column CB3, which has been rinsed twice in step (8), back into the collection tube, centrifuge at 12,000 rpm for 2 min, discard the waste liquid, and then place the adsorption column CB3 at room temperature for several minutes to completely dry the remaining rinse liquid in the adsorption material;

[0053] (10) The adsorption column CB3 dried in step (8) was transferred to a clean centrifuge tube, and 100 μL of elution buffer TE was added dropwise to the middle part of the adsorption membrane. The mixture was placed at room temperature for 4 min, centrifuged at 12000 rpm for 2 min, and the solution was collected in a centrifuge tube.

[0054] S3: PCR amplification and screening and optimization of PCR conditions

[0055] PCR amplification was performed using the specific primers obtained in Example 1 as amplification primers and the DNA sample obtained in S2 as a DNA template.

[0056] The initial PCR reaction conditions were:

[0057] PCR reaction system: 25 μL system, 2×Papid Taq Master Mix 12.5 μL, forward / reverse specific primers 0.25 μL each, DNA template 1 μL (30 ng), and the balance is sterile water.

[0058] The PCR reaction program was as follows: pre-denaturation at 95°C for 3 min, followed by denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles, and finally extension at 72°C.

[0059] After the PCR reaction was completed, 2.5 μL of the PCR product was taken, mixed, and then subjected to 2.0% agarose gel electrophoresis, and observed and imaged in a gel imaging system.

[0060] Condition optimization: The annealing temperature (60℃ and 58℃), number of cycles (30 and 35 times) and DNA template concentration (2.5, 1.25, 0.5, 0.25 and 0.05 ng / μL) were investigated to determine the optimal PCR reaction conditions.

[0061] 2. Results Analysis

[0062] (1) DNA quality testing

[0063] The quality of DNA extracted from rice and barnyard grass samples was investigated using Nano Drop 2000 UV-Vis spectrophotometer. Figure 2 and Figure 3 As shown, the test sample Figure 2 Numbers A and B are rice DNA, Figure 3 A and B are barnyard grass DNA, DNA solution in A260 There is a higher peak at A 260 / A 280 The ratio is around 1.8, A 260 / A 230 The ratio is around 2.0, indicating that the DNA quality is good and can be used for subsequent PCR experiments.

[0064] (2) Annealing temperature investigation

[0065] The present invention uses two annealing temperatures of 60°C and 58°C for PCR reaction comparison. The experimental results are as follows Figure 4 As shown in the figure, sample numbers 1 and 2 are rice, sample numbers 3 and 4 are barnyard grass, N is sterile water, and M is a 100-2000 bp DNA marker. It can be seen that when the annealing temperature is 60°C or 58°C, rice has a clear single band around 348 bp, while barnyard grass has no band, indicating that both 60°C and 58°C can be used as the annealing temperature for the PCR reaction of the present invention.

[0066] (3) Cycle number investigation

[0067] The PCR reaction program of the present invention uses 30 and 35 cycles to compare the PCR reactions. The experimental results are as follows: Figure 5 As shown in the figure, the test samples No. 1 and 2 are rice, No. 3 and No. 4 are barnyard grass, N is sterile water, and M is a 100-2000bp DNA marker. It can be seen that when the number of cycles is 30 or 35, rice can amplify specific bands, while barnyard grass has no bands. Therefore, in order to quickly identify and save detection time, 30 cycles can be selected as the optimal cycle number of the present invention.

[0068] (4) Investigation of DNA detection limit

[0069] In the initial reaction system, the DNA template DNA mass was about 5ng, which was diluted 1-fold, 5-fold, 10-fold, 20-fold and 100-fold for investigation. Figure 6 As shown in the figure, the samples represented by sample numbers are: 1 for 2.5 ng, 2 for 1.0 ng, 3 for 0.5 ng, 4 for 0.25 ng, 5 for 0.05 ng, N for sterile water, and M for 100-2000 bp DNA Marker. The results show that when the template DNA is diluted 1-100 times, the corresponding specific bands can be amplified. However, after being diluted 100 times, the bands are relatively faint at the concentration of 0.05 ng / μL. Therefore, the detection limit of DNA is set to 0.05 ng.

[0070] (5) Adaptability assessment

[0071] All DNA templates obtained from S2 were amplified by PCR using the optimal PCR reaction conditions (annealing temperature 58°C, 30 cycles) to verify the adaptability of the method.

[0072] The results are as follows Figure 7 As shown, lanes 1-3 are rice, lanes 4-6 are barnyard grass, N is sterile water, and M is 100-2000bp DNA Marker. The results show that rice DNA can amplify the corresponding specific band at 348bp, while barnyard grass has no band.

[0073] In summary, the specific primers designed according to the rice nuclear gene ITS sequence in the present invention can accurately identify rice in PCR detection, and can achieve rapid and accurate differentiation between rice seedlings and barnyard grass seedlings.

[0074] The optimal PCR reaction conditions are:

[0075] PCR reaction system: 25 μL system, 2×Papid Taq Master Mix 12.5 μL, forward / reverse specific primers 0.25 μL each, DNA template 1 μL (30 ng), and the balance is sterile water.

[0076] PCR reaction program: pre-denaturation at 95°C for 3 min, followed by denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, for a total of 30 cycles, and finally extension at 72°C.

[0077] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A specific primer for distinguishing rice from barnyard grass, characterized in that: The sequences of the specific primers are shown in SEQ ID NO.1 and SEQ ID NO.

2.

2. A kit for distinguishing rice from barnyard grass, characterized in that: The method comprises the specific primer according to claim 1.

3. Use of the specific primer according to claim 1 or the kit according to claim 2 in distinguishing rice from barnyard grass.

4. A method for distinguishing rice from barnyard grass, characterized in that: The following steps are involved: S1: Extract DNA from the plant to be tested; S2: using the DNA obtained in S1 as a template, performing PCR amplification using the specific primers described in claim 1; S3: Perform electrophoresis on the PCR amplification product obtained in S2. If a 348 bp fragment appears in the electrophoresis product, the plant to be tested is rice; otherwise, it is not rice.

5. The method for distinguishing rice from barnyard grass according to claim 4, wherein: The PCR amplification system includes: 2×Papid Taq Master Mix, specific primers, DNA template and sterile water.

6. The method for distinguishing rice from barnyard grass according to claim 5, characterized in that: The PCR amplification system is a 25 μL system, including: 12.5 μL of 2×Papid Taq Master Mix, 0.25 μL of each of forward / reverse specific primers, 1 μL of DNA template, and the balance is sterile water.

7. The method for distinguishing rice from barnyard grass according to claim 6, wherein: The concentrations of the forward / reverse specific primers are both 0.05-0.2 μmol / L.

8. The method for distinguishing rice from barnyard grass according to claim 4, wherein: The PCR amplification conditions are as follows: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 30 s, annealing at 58-64°C for 30 s, extension at 72°C for 30 s, for 20-35 cycles; and finally extension at 72°C for 5 min.

Images