LAMP-DA3-ITS-based kit for visually detecting sesamum parvifolium and application of LAMP-DA3-ITS-based kit

By developing a visual detection method based on LAMP-DA3-ITS, the rapidity and accuracy of DA3 detection of rice shisha leaf spot bacteria was solved, efficient field detection was achieved, early prevention and control was supported, and rice yield was improved.

CN120485419APending Publication Date: 2025-08-15HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510705743.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-29
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

The existing technology lacks a fast and accurate DA3 detection method for rice stitch leaf spot bacteria, which makes it difficult to effectively prevent and treat it in the early stage of the disease, affecting rice yield.

Method used

Develop a visual detection method based on LAMP-DA3-ITS. By designing specific LAMP primer compositions and kits, using DA3-ITS as a target, we can achieve rapid and accurate detection of rice sturgeon leaf spot bacteria.

Benefits of technology

It provides a detection method with simple operation, short detection cycle, high accuracy and high sensitivity. It is suitable for field on-site inspection and is suitable for promotion and use by grassroots plant protection departments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485419A_ABST
    Figure CN120485419A_ABST
Patent Text Reader

Abstract

The invention discloses a LAMP-DA3-ITS-based visual detection kit for rice flaxseed spot and application thereof, relates to the technical field of detection equipment, and aims to separate and identify rice flaxseed spot DA3 from field rice diseased leaves. The invention further develops a specific detection target DA3-ITS for rapidly and accurately identifying the rice flaxseed spot DA3. The invention further develops an LAMP primer, a kit and a detection method based on a DA3-ITS detection target. The detection method of the rice cochliobolus miyabeanus DA3, provided by the invention, has relatively high accuracy, sensitivity, effectiveness and specificity, is convenient to operate and good in practicability, and can realize accurate and rapid detection of the rice cochliobolus miyabeanus DA3. The primer pair can be used for identifying the cochliobolus miyabeanus and early detection of diseases caused by the cochliobolus miyabeanus when symptoms do not appear, and is further applied to monitoring of the distribution range of the pathogenic bacteria and the caused rice diseases, and the purpose of timely prevention is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical field:

[0001] The present invention relates to the technical field of detection equipment, and in particular to a kit for visually detecting rice flax leaf spot pathogen based on LAMP-DA3-ITS and an application thereof. Background technology:

[0002] As one of my country's key grain crops, rice plays a crucial role in ensuring national food security. Brown spot disease (Rice) is a common rice disease that can occur throughout the rice plant's growth cycle and, in severe cases, can significantly reduce yields. The pathogen responsible for brown spot disease, Cochliobolus miyabeanus, reproduces rapidly and has strong adaptability, leading to widespread disease outbreaks when conditions are favorable for its onset. The key to preventing and controlling this disease is applying pesticides in the early stages of the disease, making understanding the early stages of disease in the field crucial. The optimal time to prevent and control the disease is before symptoms develop after infection. Detecting brown spot disease on rice leaves in rice fields allows for proactive preventive measures to reduce the incidence of brown spot disease, which is crucial for rice production.

[0003] LAMP technology (loop-mediated isothermal amplification technology) is a new type of nucleic acid amplification technology disclosed by Japanese scholar Notomi in 2000 (Notomi T, Okayama H, Masubuchi H, et al. Loop-mediated isothermal amplification of DNA [J]. Nucleic Acids Research, 2000, 28 (12): e63.). It achieves chain displacement amplification under constant temperature conditions by designing four special primers targeting six regions of DNA. This technology has the technical advantages of high efficiency, specificity and convenience. It only requires a constant temperature environment of 64°C and 80°C, completes the detection in 1 hour, and the results can be observed with the naked eye. LAMP technology has been widely used in the field of pathogen detection. Summary of the invention:

[0004] The purpose of the present invention is to overcome the shortcomings of the above-mentioned existing technologies and provide a kit for detecting rice leaf spot pathogen based on LAMP-DA3-ITS visualization and its application. The kit can isolate and identify the pathogenic bacteria, rice leaf spot pathogen DA3, from diseased rice plants in the field. Currently, there is a lack of rapid detection methods for this pathogen. The present invention aims to develop a LAMP primer combination and a detection kit through research on detection targets and specific detection primers for rice leaf spot pathogen DA3, and further provide a method for detecting rice leaf spot pathogen DA3 with strong specificity, high sensitivity, convenience and rapidity.

[0005] In order to solve the problems existing in the background technology, the present invention adopts the following technical solution: the application includes the following parts:

[0006] The first part identified a pathogen causing rice leaf spot. After isolation, morphological identification, molecular growth identification, and pathogenic inoculation, the pathogen was identified as Cochliobolus miyabeanus. Its sexual form is called Cochliobolus miyabeanus.

[0007] In the second part, the ITS gene sequencing results of the isolated DA3 strain of rice leaf spot pathogen were analyzed, and it was found that the gene sequence was quite different from that of closely related species, thus providing a specific detection target DA3-ITS for rice leaf spot pathogen DA3;

[0008] The third part provides a LAMP primer composition based on DA3-ITS, which comprises: a forward outer primer F3 as shown in SEQ NO.2 (5-ACATTGCGCCCTTTGGTAT-3), a reverse outer primer B3 as shown in SEQ NO.3 (5-CCTACCTGATCCGAGGTCAA-3), a forward inner primer FIP as shown in SEQ NO.4 (5-GCGAGTCTCCCAGAAAGAGGGATGCCTGTTCGAGCGTCAT-3), and a reverse inner primer BIP as shown in SEQ NO.5 (5-GCAGCCGGCCTACTGGTTTCTCTTGATGGAGTACCGTCCT-3);

[0009] Specific LAMP primers were designed using the specific sequence DA3-ITS of the rice leaf spot pathogen DA3 as the target. The LAMP reaction can achieve specific recognition of six independent regions on the target sequence through four primers (i.e., F3, B3, FIP, and BIP).

[0010] The fourth part provides an application of the above-mentioned DA3-ITS-based LAMP primer combination in detecting DA3, a pathogen of rice leaf spot pathogen;

[0011] The fifth part provides a use of the above-mentioned DA3-ITS-based LAMP primer combination in preparing a DA3-ITS-based LAMP kit;

[0012] Part 6 provides a DA3-ITS-based LAMP kit, wherein the LAMP kit includes the above-mentioned DA3-ITS-based LAMP primer composition, and the LAMP kit also includes dNTPs, Tris-HCl, KCl, (NH4)2SO4, MgSO4 and Bst DNA polymerase;

[0013] Part 7 provides the application of the DA3-ITS-based LAMP kit in Part 6 in detecting DA3, a pathogen causing rice leaf spot;

[0014] The eighth part provides a LAMP detection method for DA3 of rice leaf spot pathogen;

[0015] The ninth part provides a method for rapidly extracting genomic DNA from rice leaves and spore suspensions after rice is inoculated with pathogenic bacteria.

[0016] The second part, the DNA sequence of the specific detection target DA3-ITS of rice leaf spot pathogen DA3 is:

[0017] .

[0018] In the fourth part, the target band is amplified by the rice sesame leaf spot pathogen DA3.

[0019] In the third and sixth parts of the DA3-ITS-based LAMP kit, the final concentrations of each reagent are: 0.25 μM forward outer primer F3 20 μL, 0.25 μM reverse outer primer B3 20 μL, 0.84 μM forward inner primer FIP 80 μL, 0.84 μM reverse inner primer BIP 80 μL, 1.4 mM dNTPs 140 μL, 10×Bst Reaction Buffer 100 μL, 8 mM MgSO4 60 μL, 0.32 U / L Bst DNA polymerase 40 μL, 120 μM HNB 40 μL, and sterile ultrapure water is used to prepare 1 mL of detection solution.

[0020] The eighth part, the LAMP detection method comprises the following steps: extracting the genome of the microorganism of the sample to be tested, performing a LAMP amplification reaction using the DA3-ITS-based LAMP primer composition or the DA3-ITS-based LAMP kit, adding a dye, observing the fluorescent signal, and judging the result.

[0021] The added dye is hydroxynaphthol blue (HNB).

[0022] The temperature of the LAMP amplification reaction is 62-68° C., and the time is 40-50 minutes.

[0023] The ninth section, rapid extraction method: using DNA-EZ Re-agents V All-DNA-Fast-Out universal one-step extraction solution, 5 μL of spore suspension was mixed with 50 μL of extraction solution, incubated in an 80°C water bath for 5 minutes, and vortexed to mix. The extract can be directly used as template DNA for LAMP detection.

[0024] The beneficial effects of the present invention are as follows: compared with conventional PCR detection of rice leaf spot pathogenic bacteria, the LAMP detection method of rice leaf spot pathogenic bacteria DA3 provided by the present invention has the advantages of simple operation, short detection cycle, high accuracy, high sensitivity, strong specificity, and suitability for promotion.

[0025] The details are as follows:

[0026] 1) Conventional PCR detection of plant pathogenic microorganisms has many inconveniences, such as the need for multiple equipment (e.g., thermal cyclers, gel electrophoresis equipment, gel imaging equipment, etc.), the need for experienced experimental operators, long amplification cycles, cumbersome detection, and poor detection specificity. The detection method of the present invention requires simple experimental conditions and does not require complex instruments such as PCR instruments and gel electrophoresis equipment. Under constant temperature conditions, it can accurately, quickly, and efficiently detect rice sesame leaf spot pathogens, which can better meet the field detection requirements of rice sesame leaf spot pathogens and is suitable for promotion and use by grassroots plant protection departments.

[0027] 2) The present invention discovered the specific target gene DA3-ITS through genome sequencing and alignment, and designed a specific LAMP primer combination using DA3-ITS as the target. The LAMP reaction uses four primers (F3, B3, FIP, BIP) to specifically recognize six independent regions on the target sequence, with relatively high specificity;

[0028] 3) The LAMP detection method for DA3 of rice leaf spot pathogen established in the present invention has a very high sensitivity, which can reach 10 fg / μL DNA, indicating that this detection method is sufficient to accurately and quickly detect DA3 of rice leaf spot pathogen at very low DNA concentrations.

[0029] This study isolated and identified the pathogenic rice leaf spot pathogen DA3 from rice leaves and developed a specific detection target, DA3-ITS, for rapid and accurate identification of DA3. LAMP primers, a kit, and a detection method were then developed based on this. This study can provide guidance for understanding the distribution, damage, and evolution of the pathogen, as well as disease identification, and lay the foundation for effective prevention and control of rice leaf spot disease. Description of the drawings:

[0030] Figure 1 The invention relates to DA3 colonies, conidia and conidiophores of the rice flax leaf spot pathogen;

[0031] Figure 2 This is a diagram showing symptoms of disease after the flax leaf spot pathogen DA3 is inoculated into rice leaves in Example 1 of the present invention;

[0032] Figure 3 This is the phylogenetic tree constructed in the molecular biology study of the water flax leaf spot pathogen DA3 in Example 1 of the present invention;

[0033] Figure 4 This is a reaction effect diagram of the LAMP detection primer design for water flax leaf spot pathogen DA3 in Example 2 of the present invention

[0034] Figure 5This is a comparison chart of the sensitivity results of different DNA template concentrations when performing LAMP detection on the water flax leaf spot pathogen DA3 in Example 3 of the present invention;

[0035] Figure 6 This is a graph showing the specificity results of LAMP detection of DA3, a pathogenic bacteria of the water flax leaf spot, in Example 4 of the present invention;

[0036] Figure 7 The present invention is a detection effect of the LAMP reaction system on samples taken at different times after inoculation with the rice flax leaf spot pathogen DA3. Specific implementation method:

[0037] With reference to the figures, the present invention specifically adopts the following implementation mode: the application includes the following parts:

[0038] The first part identified a pathogen causing rice leaf spot. After isolation, morphological identification, molecular growth identification, and pathogenic inoculation, the pathogen was identified as Cochliobolus miyabeanus. Its sexual form is called Cochliobolus miyabeanus.

[0039] In the second part, the ITS gene sequencing results of the isolated DA3 strain of rice leaf spot pathogen were analyzed, and it was found that the gene sequence was quite different from that of closely related species, thus providing a specific detection target DA3-ITS for rice leaf spot pathogen DA3;

[0040] The third part provides a LAMP primer composition based on DA3-ITS, which comprises: a forward outer primer F3 as shown in SEQ NO.2 (5-ACATTGCGCCCTTTGGTAT-3), a reverse outer primer B3 as shown in SEQ NO.3 (5-CCTACCTGATCCGAGGTCAA-3), a forward inner primer FIP as shown in SEQ NO.4 (5-GCGAGTCTCCCAGAAAGAGGGATGCCTGTTCGAGCGTCAT-3), and a reverse inner primer BIP as shown in SEQ NO.5 (5-GCAGCCGGCCTACTGGTTTCTCTTGATGGAGTACCGTCCT-3);

[0041] Specific LAMP primers were designed using the specific sequence DA3-ITS of the rice leaf spot pathogen DA3 as the target. The LAMP reaction can achieve specific recognition of six independent regions on the target sequence through four primers (i.e., F3, B3, FIP, and BIP).

[0042] The fourth part provides an application of the above-mentioned DA3-ITS-based LAMP primer combination in detecting DA3, a pathogen of rice leaf spot pathogen;

[0043] The fifth part provides a use of the above-mentioned DA3-ITS-based LAMP primer combination in preparing a DA3-ITS-based LAMP kit;

[0044] Part 6 provides a DA3-ITS-based LAMP kit, wherein the LAMP kit includes the above-mentioned DA3-ITS-based LAMP primer composition, and the LAMP kit also includes dNTPs, Tris-HCl, KCl, (NH4)2SO4, MgSO4 and Bst DNA polymerase;

[0045] Part 7 provides the application of the DA3-ITS-based LAMP kit in Part 6 in detecting DA3, a pathogen causing rice leaf spot;

[0046] The eighth part provides a LAMP detection method for DA3 of rice leaf spot pathogen;

[0047] The ninth part provides a method for rapidly extracting genomic DNA from rice leaves and spore suspensions after rice is inoculated with pathogenic bacteria.

[0048] The second part, the DNA sequence of the specific detection target DA3-ITS of rice flax leaf spot pathogen DA3 is shown in SEQ NO.1, and SEQ NO.1 is specifically:

[0049] AATATGAAGGCCTGGCTTTCGCGGCCGGCTGAAGTATTTTTTTCACCCATGTCTTTTGCGCACTTGTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACCTTTTTTTCTTATGCAGTTTCCATCAGCGTCAGTAAAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGCGTTTTTTTGTCTCCCTCTTTCTGGGAGACTCGCCTTAAAACGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACATTTTTTGCGCTTTGTATCAGGAGAAAAGGACGGTACTCCATCAAGACTCTACATTTTTCACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA。

[0050] For the fourth part described above, the target band was amplified from the rice brown leaf spot pathogen DA3.

[0051] In the third and sixth parts of the DA3-ITS-based LAMP kit, the final concentrations of each reagent are: 0.25 μM forward outer primer F3 20 μL, 0.25 μM reverse outer primer B3 20 μL, 0.84 μM forward inner primer FIP 80 μL, 0.84 μM reverse inner primer BIP 80 μL, 1.4 mM dNTPs 140 μL, 10×Bst Reaction Buffer 100 μL, 8 mM MgSO4 60 μL, 0.32 U / L Bst DNA polymerase 40 μL, 120 μM HNB 40 μL, and sterile ultrapure water is used to prepare 1 mL of detection solution. For example, in the DA3-ITS-based LAMP kit, 20 μL of 0.25 μM forward outer primer F3, 20 μL of 0.25 μM reverse outer primer B3, 80 μL of 0.84 μM forward inner primer FIP, 80 μL of 0.84 μM reverse inner primer BIP, 140 μL of 1.4 mM dNTPs, 100 μL of 10×Bst Reaction Buffer, 60 μL of 8 mM MgSO4, 40 μL of 0.32 U / L Bst DNA polymerase, and 40 μL of 120 μM HNB were prepared into 1 mL of detection solution using sterile ultrapure water.

[0052] The eighth part, the LAMP detection method includes the following steps: extracting the genome of the sample microorganism to be tested, performing LAMP amplification reaction using the DA3-ITS-based LAMP primer composition or the DA3-ITS-based LAMP kit, adding dye, observing the fluorescent signal, and judging the result. The added dye is hydroxynaphthol blue (HNB). The temperature of the LAMP amplification reaction is 62-68°C, and the time is 40-50 minutes. The ninth part, the rapid extraction method: using DNA-EZ Re-agents V All-DNA-Fast-Out universal one-step extraction solution for extraction, taking 5μL of spore suspension and mixing with 50μL of extraction solution, bathing in 80°C water for 5 minutes, shaking and mixing, the extract can be directly used as template DNA for LAMP detection.

[0053] For example, the selected dye may be hydroxynaphthol blue (HNB), and the present invention is described using hydroxynaphthol blue (HNB) as an example. The color change of the reaction solution includes the following two judgment results:

[0054] In the first case, when the color of the reaction solution changes from purple to blue, it is determined that the sample is positive for the flax leaf spot pathogen DA3;

[0055] In the second case, when the color of the reaction solution does not change and remains purple, it is determined that the sample is positive for the pathogen DA3 of flax leaf spot pathogen.

[0056] For example, the DNA of the microorganism to be tested is extracted from the sample, 1 to 3 μL (20 ng / μL) of DNA solution is taken as a reaction template, 10 to 20 μL of the detection solution in the LAMP kit is added to perform LAMP reaction at 64°C for 50 minutes to obtain an amplified product; since a large amount of DNA amplification product is produced during the reaction, the amplified product is combined with hydroxynaphthol blue (HNB) dye and the color change can be observed with the naked eye to determine whether the LAMP reaction is positive.

[0057] In order to better illustrate the embodiments of the present invention, further examples are given below.

[0058] Example 1: Isolation, identification and preservation of DA3, a pathogen causing rice leaf spot

[0059] In this example, the pathogen causing rice leaf spot disease was isolated and named DA3. In September 2022, the inventors isolated diseased rice tissue from rice fields in Daqing City, Heilongjiang Province, and verified that it can cause symptoms of rice leaf spot disease. The morphological characteristics and molecular biology of DA3 are as follows:

[0060] (1) Morphological characteristics of rice leaf spot pathogen DA3

[0061] Reference Figure 1 , A and B are the colony morphology of DA3 of water flax leaf spot pathogen in PDA medium; C and D are the conidia and conidiophore morphology of DA3 of water flax leaf spot pathogen in PDA medium.

[0062] In PDA medium, colony morphology observation showed that ( Figure 1 A. Figure 1 B): The colony is dark brown with a raised center and covered with grayish-white flocculent aerial hyphae, which present a fluffy, hairy structure. The conidia are brown, stick-shaped or long-cylindrical, with a smooth surface and 5-10 septa. They exist in two forms: upright and slightly curved. The conidiophores are brown, with knee-like bends at the top and some branches visible ( Figure 1 C. Figure 1 D). After the isolate was inoculated on rice leaves, the rice leaves showed small oval lesions with dark brown centers, brown edges and irregular yellow halos ( Figure 2 ).

[0063] (2) Molecular Biology of Flax Leaf Spot Pathogen DA3

[0064] The total DNA of DA3 pathogen of flax leaf spot was extracted, and the ITS fragment was amplified using primers ITS1 / ITS4. The ITS fragment was sequenced and compared with BLAST to construct a phylogenetic tree ( Figure 3 ).

[0065] Based on preliminary BLAST alignment results, the strain belongs to the sexual state of Bipolaris oryzae (Cochliobolus miyabeanus). Based on the ITS gene sequence, a phylogenetic tree was constructed using the Neighbor-Joining (NJ) method for cluster analysis. The test strain (DA3) was most closely related to the sexual state of C. miyabeanus. Combined with the results of molecular biological identification, the pathogen was ultimately determined to be B. oryzae. The bootstrap support rate was 93%. The ITS similarity between the identified strain and the KC315929.1 C. miyabeanus model strain was only 100% (identity 553 / 553bp).

[0066] The morphological characteristics of DA3, a pathogen causing rice leaf spot, are similar to those of C. miyabeanus, such as colony, conidia, and sporangium morphology. Molecular biological analysis combined with comparative inoculation of morphological characteristics confirmed that DA3 is C. miyabeanus.

[0067] Example 2, a specific detection target DA3-ITS for DA3, a pathogen of rice leaf spot pathogen

[0068] The present invention provides a specific detection target DA3-ITS for rice flax leaf spot pathogen DA3 by genome resequencing and comparison analysis of the differences in genome sequences between rice flax leaf spot pathogen DA3 and other closely related bacteria. The DNA sequence of the detection target is shown in SEQ NO.1, and SEQ NO.1 is specifically:

[0069] Example 3 A LAMP primer composition based on DA3-ITS

[0070] This embodiment provides a LAMP primer combination based on DA3-ITS. The specific contents are as follows:

[0071] The present invention designs a LAMP primer composition based on the target DA3-ITS, which comprises: a forward outer primer F3 as shown in SEQ NO.2, a reverse outer primer B3 as shown in SEQ NO.3, a forward inner primer FIP as shown in SEQ NO.4, and a reverse inner primer BIP as shown in SEQ NO.5.

[0072] SEQ NO. 2 to 5 are as follows:

[0073] SEQ NO.2: 5-ACATTGCGCCCTTTGGTAT-3;

[0074] SEQ NO.3: 5-CCTACCTGATCCGAGGTCAA-3

[0075] SEQ NO.4: 5-GCGAGTCTCCCAGAAAGAGGGATGCCTGTCGAGCGTCAT-3

[0076] SEQ NO. 5: 5-GCAGCCGGCCTACTGGTTTCTCTTGATGGAGTACCGTCCT-3.

[0077] Example 4, Determination of the effectiveness of LAMP primers based on DA3-ITS sequence

[0078] In this example, LAMP primers based on the DA3-ITS sequence of the rice leaf spot pathogen were designed for the subsequent LAMP detection reaction. LAMP primers were designed using the NEB online tool, and PCR-specific primers were designed using Primer Explorer V5 software. All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The rice leaf spot pathogen DNA (100 ng / μL) was used as a template, and the reaction was incubated at 64°C for 1 hour. The test was repeated three times, and the results were judged using the following two methods: Figure 4 ):

[0079] The first method is to judge the effectiveness of the primer based on the color reaction:

[0080] In the first case, when the color of the reaction solution changes from purple to blue, it is judged that the rice flax leaf spot pathogen DA3 in the sample is positive, indicating that the primers can effectively amplify;

[0081] In the second case, when the color of the reaction solution remains purple after the reaction, it is determined that the sample is negative for DA3 of the rice leaf spot pathogen, indicating that the primers cannot effectively amplify;

[0082] The second method is to judge the effectiveness of primers based on electrophoresis patterns:

[0083] In the first case, when obvious ladder-shaped bands appear in the electrophoresis results, the sample is judged to be positive for DA3 of the rice leaf spot pathogen, indicating that the primers can effectively amplify the gene;

[0084] In the second case, when no obvious ladder-shaped bands appear in the electrophoresis results, the sample is judged to be negative for the rice sesame leaf spot pathogen DA3, indicating that the primers cannot effectively amplify the gene.

[0085] Reference Figure 4As can be seen, tube A1 is a negative control with water added, and the result is purple. Tubes A2-4 are the results of three replicates of the experiment using genomic DNA of the rice leaf spot pathogen DA3 as a template. Tubes A2-4 all appear blue, indicating that the designed primers can effectively amplify the target gene. Lane B1 shows no ladder-shaped bands, while lanes B2-4 show distinct ladder-shaped bands, also indicating that the designed primers can effectively amplify the target gene.

[0086] Example 5, a LAMP kit based on DA3-ITS

[0087] This example provides a DA3-ITS-based LAMP kit, wherein the concentrations and amounts of the reagents in the kit are as follows: 100 μM forward outer primer F3 1.5 μL, 100 μM reverse outer primer B3 1.5 μL, 100 μM forward inner primer FIP 4.5 μL, 100 μM reverse inner primer BIP 4.5 μL, 10 mM dNTPs 20 μL, 200 mM Tris-HCl 100 μL, 500 mM KCl 100 μL, 20 mM (NH4)2SO4 100 μL, 40 mM MgSO4 50 μL, 8 U / μL Bst DNA polymerase 40 μL, and sterile ultrapure water is used to prepare 1 mL of the detection solution.

[0088] Example 6, a LAMP detection method for rice flax leaf spot pathogen DA3

[0089] The embodiment provides a LAMP detection method for DA3 of rice leaf spot pathogen, and investigates the sensitivity and specificity of the detection method. The details are as follows.

[0090] (1) This embodiment provides a LAMP detection method for DA3, a pathogen of rice leaf spot pathogen, comprising the following steps:

[0091] S1. Extract DNA from the microorganisms in the sample using the CTAB method. Take 2 μL of the extracted DNA solution at a concentration of 20 ng / μL as a reaction template, add 18 μL of the detection solution in the DA3-ITS-based LAMP kit provided in Example 5, and perform a LAMP reaction to obtain an amplified product. The LAMP reaction conditions are: temperature 65°C, reaction time 50 min;

[0092] S2. Observe the color change of the reaction solution and judge the result. The judgment result specifically includes the following two situations:

[0093] In the first case, when the color of the reaction solution changes from purple to yellow-blue, it is determined that the sample is positive for the flax leaf spot pathogen DA3;

[0094] In the second case, when the color of the reaction solution does not change and remains purple, it is determined that the sample is negative for the pathogen DA3 of flax leaf spot pathogen.

[0095] (2) This example investigates the sensitivity and specificity of the LAMP detection method, as follows:

[0096] A. Sensitivity test

[0097] In order to determine the sensitivity of the LAMP detection method provided above, the known bacterial DNA extracted by the CTAB method was used to prepare template DNA of different concentrations using a spectrophotometer using a stepwise dilution method (the template DNA concentrations were 100ng / μL, 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL, 1pg / μL, 100fg / μL, and 10fg / μL, respectively). As LAMP and PCR templates, 2μL of the diluted DNA solution of each concentration was taken as a template and added to 18μL of the detection solution in the DA3-ITS-based LAMP kit provided in Example 5 to perform a LAMP reaction to obtain an amplified product; wherein, the LAMP reaction conditions are: reaction temperature 60°C, reaction time 50min. The results of different DNA template concentrations are compared as shown in the figure below. Figure 5 As shown. Among them, Figure 5 Figure A: LAMP amplification product observation results; B: LAMP amplification agarose gel electrophoresis analysis results; C: PCR amplification agarose gel electrophoresis analysis results; 1-8: Template DNA concentrations: 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL; 9: dd H2O; M: Marker. The study also used ITS1 / ITS4 primers to amplify the above template DNA at different concentrations, and observed the amplification results by agarose gel electrophoresis to compare sensitivity.

[0098] Depend on Figure 5 It can be seen that when the DNA template concentrations of DA3, the pathogen of rice leaf spot, were 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL, and 100 ag / μL, the solutions in the corresponding reaction tubes all turned blue, indicating a positive reaction. However, when dd HO was added, the solutions in the corresponding reaction tubes remained purple, indicating a negative reaction. The results show that the sensitivity of the LAMP detection primers of the present invention for detecting DA3, the pathogen of rice leaf spot, reached 10 fg / μL. Conventional PCR can only detect a DNA template concentration of 100 pg / μL.

[0099] Specificity test:

[0100] According to the LAMP detection method for rice leaf spot pathogen established in part (1) of this embodiment, LAMP detection was performed on seven test samples, including Ustilaginoidea virens (Uv), Curvularia lunata (Cl), Alternaria alternata (Aa), Fusarium graminearum (Fg), Rhizoctonia solani (Rs), Magnaporthe oryzae (Mo), and Cochliobolus miyabeanus (Cm). At the same time, a synchronous experiment was carried out using sterile double-distilled water as a negative control template. The specificity test results are shown in Figure 2. Figure 6 shown.

[0101] Depend on Figure 6 It can be seen that: A, visual view of LAMP reaction results; B, agarose gel electrophoresis diagram of LAMP reaction results; 1, ddH2O; 2, C. miyabeanus; 3, U. virens; 4, C. lunata; 5, A. alternata; 6, F. graminearum; 7, R. solani; 8, M. oryzae; M: Marker.

[0102] Only the color in the reaction tube for sample Cm changed from orange to yellow-green, indicating a positive result; the other six samples and the negative control all tested negative. This result demonstrates that the LAMP primer combination provided by the present invention has high specificity for DA3, the pathogen of rice leaf spot, and can effectively distinguish it from other pathogens, resulting in accurate detection results.

[0103] Example 7, LAMP detection method for rice flax leaf spot pathogen DA3

[0104] This example provides a LAMP detection method for DA3, a pathogenic bacteria of rice, and investigates the specificity of the detection method. The details are as follows.

[0105] This embodiment provides a LAMP detection method for DA3 of rice leaf spot pathogen, which comprises the following steps:

[0106] S1. Extract DNA from the microorganisms in the sample to be tested. Take 5 μL of the DNA solution as a reaction template and add 20 μL of the detection solution in the DA3-ITS-based LAMP kit provided in Example 5 to perform a LAMP reaction to obtain an amplified product. The LAMP reaction conditions are: 65°C for 50 min.

[0107] S2. Observe the color change of the reaction solution and the electrophoresis pattern after PCR amplification to determine the results. Specifically, there are two methods:

[0108] The first method is to judge specificity based on color reaction:

[0109] In the first case, when the color of the Cm reaction solution changes from purple to yellow-blue, and the other test bacteria do not change color, it is judged that the detection method is specific for the detection of DA3 of rice sesame leaf spot pathogen;

[0110] In the second case, when the color of the Cm reaction solution is still purple after the reaction, which is the same as the reaction solutions of other bacteria, it is judged that the detection method has no specificity for the detection of rice sesame leaf spot pathogen DA3.

[0111] The second method is to judge specificity based on the electropherogram:

[0112] In the first case, when the electrophoresis results of adding Cm genomic DNA template show obvious ladder bands, while adding other bacterial DNA templates does not show ladder bands, the detection method is judged to be positive for DA3 of rice sesame leaf spot pathogen, indicating that it has specificity;

[0113] In the second case, when no obvious ladder-shaped bands appear in the electrophoresis results after adding the Cm genomic DNA template, and no ladder-shaped bands appear after adding other bacterial DNA templates, or bands appear, it is judged that the detection method is positive for the rice sesame leaf spot pathogen DA3 and has no specificity.

[0114] The sensitivity test of the detection method provided in this embodiment can achieve similar results to the method provided in Example 6.

[0115] Depending on the concentration of Pseudomonas aeruginosa DA3 in the sample, the LAMP reaction temperature, the amount of detection solution added, etc., the LAMP detection method for Pseudomonas aeruginosa DA3 provided in this embodiment can show a positive result in 50 minutes.

[0116] Reference Figure 7 It can be seen that:

[0117] A: Visual view of LAMP reaction results;

[0118] B: Agarose gel electrophoresis of LAMP reaction results;

[0119] 1: treatment 0h; 2: control 0h; 3: treatment 2h; 4: control 2h; 5: treatment 4h; 6: control 4h; 7: treatment 6h; 8: control 6h; 9: treatment 8h; 10: control 8h; 11: treatment 12h; 12: control 12h; 13: treatment 24h; 14: control 24h; 15: treatment 48h; 16: control 48h; 17: treatment 72h; 18: control 72h; 19: treatment 96h; 20: control 96h; M: Marker.

[0120] Example 8, Application of DA3-ITS-based LAMP Primer Composition in Pathogen DA3 of Rice and Sesame Leaf Spot

[0121] The LAMP detection method for DA3 of rice leaf spot pathogen provided in Example 4 or Example 5 has good sensitivity and high specificity. Based on the common sense of those skilled in the art, rice diseased leaves suspected of having rice leaf spot pathogenicity can be extracted, and genomic DNA in the leaves can be extracted using the DNA-EZ Reagents V All-DNA-Out universal one-step method. The above detection method can be used to detect rice leaf spot pathogenicity in areas affected by rice leaf spot pathogenicity.

[0122] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

[0123] In summary, this LAMP-DA3-ITS-based visual detection kit for rice leaf spot pathogen and its application isolated and identified the pathogenic rice leaf spot pathogen DA3 from rice leaves, and developed a specific detection target DA3-ITS for rapid and accurate identification of rice leaf spot pathogen DA3. Based on this, LAMP primers, kits and detection methods were further developed. The present invention can provide guidance information for the distribution, harm and evolution of the pathogen, disease identification, etc., and also lay the foundation for the effective prevention and control of rice leaf spot disease. Compared with conventional PCR detection of rice leaf spot pathogen, the LAMP detection method for rice leaf spot pathogen DA3 provided by the present invention has the advantages of simple operation, short detection cycle, high accuracy, high sensitivity, strong specificity, and suitability for promotion.

Claims

1. A kit for visually detecting rice leaf spot pathogen based on LAMP-DA3-ITS and its application, characterized by: The application includes the following parts: The first part is to identify a pathogen that causes rice leaf spot. After isolation, morphological identification, molecular growth identification and pathogenic back-inoculation identification, the pathogen was determined to be Cochliobolus miyabeanus, and its sexual form is named Cochliobolus miyabeanus. In the second part, the ITS gene sequencing results of the isolated DA3 strain of rice leaf spot pathogen were analyzed, and it was found that the gene sequence was quite different from that of closely related species, thus providing a specific detection target DA3-ITS for rice leaf spot pathogen DA3; The third part provides a LAMP primer composition based on DA3-ITS, comprising: a forward outer primer F3 as shown in SEQ NO. 2 (5-ACATTGCGCCCTTTGGTAT-3), a reverse outer primer B3 as shown in SEQ NO. 3 (5-CCTACCTGATCCGAGGTCAA-3), a forward inner primer FIP as shown in SEQ NO. 4 (5-GCGAGTCTCCCAGAAAGAGGGATGCCTGTTCG AGCGTCAT-3), and a reverse inner primer BIP as shown in SEQ NO. 5 (5-GCAGCCGGCCTACTGGTTTCTCTTGATGGAGTACCGTCCT-3); Specific LAMP primers were designed using the specific sequence DA3-ITS of the rice leaf spot pathogen DA3 as the target. The LAMP reaction can achieve specific recognition of six independent regions on the target sequence through four primers (i.e., F3, B3, FIP, and BIP). The fourth part provides an application of the above-mentioned DA3-ITS-based LAMP primer combination in detecting DA3, a pathogen of rice leaf spot pathogen; The fifth part provides a use of the above-mentioned DA3-ITS-based LAMP primer combination in preparing a DA3-ITS-based LAMP kit; Part 6 provides a DA3-ITS-based LAMP kit, wherein the LAMP kit includes the above-mentioned DA3-ITS-based LAMP primer composition, and the LAMP kit also includes dNTPs, Tris-HCl, KCl, (NH4)2SO4, MgSO4 and Bst DNA polymerase; Part 7 provides the application of the DA3-ITS-based LAMP kit in Part 6 in detecting DA3, a pathogen causing rice leaf spot; The eighth part provides a LAMP detection method for DA3 of rice leaf spot pathogen; The ninth part provides a method for rapidly extracting genomic DNA from rice leaves and spore suspensions after rice is inoculated with pathogenic bacteria.

2. The kit for visually detecting rice flax leaf spot pathogen based on LAMP-DA3-ITS according to claim 1 and its application, characterized in that: The second part, the DNA sequence of the specific detection target DA3-ITS of rice leaf spot pathogen DA3 is: .

3. The kit for visual detection of rice flax leaf spot pathogen based on LAMP-DA3-ITS according to claim 1 and its application, characterized in that: In the fourth part, the target band is amplified by the rice sesame leaf spot pathogen DA3.

4. The kit for visually detecting rice flax leaf spot pathogen based on LAMP-DA3-ITS according to claim 1 and its application, characterized in that: In the third and sixth parts of the DA3-ITS-based LAMP kit, the final concentrations of each reagent are: 0.25 μM forward outer primer F3 20 μL, 0.25 μM reverse outer primer B3 20 μL, 0.84 μM forward inner primer FIP 80 μL, 0.84 μM reverse inner primer BIP 80 μL, 1.4 mM dNTPs 140 μL, 10×Bst Reaction Buffer 100 μL, 8 mM MgSO4 60 μL, 0.32 U / L Bst DNA polymerase 40 μL, 120 μM HNB 40 μL, and sterile ultrapure water is used to prepare 1 mL of detection solution.

5. The kit for visually detecting rice flax leaf spot pathogen based on LAMP-DA3-ITS according to claim 1 and its application, characterized in that: The eighth part, the LAMP detection method comprises the following steps: extracting the genome of the microorganism of the sample to be tested, performing a LAMP amplification reaction using the DA3-ITS-based LAMP primer composition or the DA3-ITS-based LAMP kit, adding a dye, observing the fluorescent signal, and judging the result.

6. The kit for visually detecting rice flax leaf spot pathogen based on LAMP-DA3-ITS according to claim 6 and its application, characterized in that: The dye added was hydroxynaphthol blue (HNB).

7. The kit for visually detecting rice flax leaf spot pathogen based on LAMP-DA3-ITS according to claim 6 and its application, characterized in that: The temperature of the LAMP amplification reaction is 62-68°C and the time is 40-50 minutes.

8. The kit for visually detecting rice flax leaf spot pathogen based on LAMP-DA3-ITS according to claim 1 and its application, characterized in that: The ninth section, rapid extraction method: using DNA-EZ Re-agents V All-DNA-Fast-Out universal one-step extraction solution, 5 μL of spore suspension was mixed with 50 μL of extraction solution, incubated in an 80°C water bath for 5 minutes, and vortexed to mix. The extract can be directly used as template DNA for LAMP detection.