Soybean 1-aminocyclopropane-1-carboxylic acid synthase single enzyme mutant based on multipoint deletion

Abstract

The invention is applicable to the technical field of plant genetic engineering, and provides a soybean 1-aminocyclopropane-1-carboxylic acid synthase single enzyme mutant based on multipoint deletion, and the soybean 1-aminocyclopropane-1-carboxylic acid synthase single enzyme activity mutant is # imgabs0 #; the protein sequence of the # imgabs1 # is as shown in SEQ ID NO. 1. A functional site modification technology for a soybean ethylene synthesis key enzyme 1-aminocyclopropane-1-carboxylic acid synthase with double enzyme activity is utilized, and specific proline, serine and asparagine residues are deleted at fixed points, so that the soybean ethylene synthesis key enzyme 1-aminocyclopropane-1-carboxylic acid synthase with double enzyme activity is obtained, and the soybean ethylene synthesis key enzyme 1-aminocyclopropane-1-carboxylic acid synthase with double enzyme activity is obtained. The soybean 1-aminocyclopropane-1-carboxylic acid synthase mutant losing C-S lyase activity provides a novel gene resource for creation of new soybean stress-resistant varieties, and has a wide application prospect and an important economic value in stress-resistant soybean molecular breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to the modification of the dual-enzyme activity of soybean 1-aminocyclopropane-1-carboxylate synthase based on the deletion of multiple specific amino acid sites, thereby creating a soybean 1-aminocyclopropane-1-carboxylate synthase single-enzyme activity mutant. Background Art

[0002] The plant hormone ethylene plays a crucial role in multiple plant growth and development processes, including seed germination, cell elongation, root development, flowering, and fruit ripening. Ethylene also plays a crucial role in plant responses to various biotic and abiotic stresses. In seed plants, ethylene biosynthesis follows an ACC-dependent pathway, also known as the Yang cycle. The rate-limiting step in this pathway is the conversion of S-adenosylmethionine to 1-aminocyclopropane-1-carboxylate (1-ACP)—the direct precursor of ethylene—catalyzed by 1-ACP synthase. In recent years, the inventors' team have discovered that 1-ACP synthase in seed plants, in addition to its traditional 1-ACP activity, can also catalyze the production of ammonium ions, pyruvate, and thiocysteine ​​from cystine, indicating that it also possesses CS lyase activity. Among them, pyruvate is the end product of glycolysis and an energy substrate for the mitochondrial tricarboxylic acid cycle, while thiocysteine ​​can further generate hydrogen sulfide. Pyruvate and hydrogen sulfide play important roles in plant growth and development and in resisting various stresses. The discovery of the dual enzyme activity of 1-aminocyclopropane-1-carboxylate synthase in higher plants has made it a key intersection of two distinct yet closely related life processes: promoting plant development, fruit ripening, and stress resistance. Balancing and regulating its dual enzyme activity is a key target for crop transformation using biotechnology. In-depth analysis of the key structural domains and key sites of the dual enzyme activity of 1-aminocyclopropane-1-carboxylate synthase in higher plants will not only provide new insights into the biological functions of this unique dual enzyme but also provide important genetic resources for the development of high-yielding and stress-resistant varieties, with significant theoretical and practical significance.

[0003] Soybean (Glycine max) is an important dual-purpose grain, oil, and feed crop in my country, playing a strategic role in national economic development. The plant hormone ethylene and the gaseous signaling molecule hydrogen sulfide play important roles in soybean growth and development and in responses to environmental stresses. However, to date, the identification of the key sites and domains involved in the 1-aminocyclopropane-1-carboxylate synthase and CS lyase activities in the soybean 1-aminocyclopropane-1-carboxylate synthase protein, their mechanisms of action, and their regulation and utilization remain unknown. Summary of the Invention

[0004] The purpose of the embodiments of the present invention is to provide a soybean 1-aminocyclopropane-1-carboxylic acid synthase single enzyme mutant based on multiple deletions, aiming to solve the problems raised in the above background technology.

[0005] The embodiment of the present invention is achieved by a single enzyme mutant of soybean 1-aminocyclopropane-1-carboxylic acid synthase based on multiple deletions, wherein the single enzyme activity mutant of soybean 1-aminocyclopropane-1-carboxylic acid synthase is ;

[0006] described The 1-aminocyclopropane-1-carboxylate synthase homologous gene located at bases 15273601 to 15275841 on soybean chromosome Gm07, whose function has not been reported, is temporarily named GmAH3 ( G lycine m ax 1- a minocyclopropane-1-carboxylate synthase h The 15274761~15274769th position in its genome, the 720th~728th position in its mRNA sequence, or the 621st~629th position in its CDS sequence were deleted, so that the three amino acids between positions 206 and 210 of the encoded soybean GmAH3 protein were missing, namely proline (Pro), serine (Ser) and asparagine (Asn). The mutated GmAH3 protein (named ) only has 1-aminocyclopropane-1-carboxylic acid synthase activity and loses CS lyase activity. The amino acid sequence is shown in SEQ ID NO.1.

[0007] The soybean 1-aminocyclopropane-1-carboxylic acid synthase single enzyme mutant based on multiple point deletions provided in an embodiment of the present invention utilizes the functional site modification technology of 1-aminocyclopropane-1-carboxylic acid synthase, a key enzyme in soybean ethylene synthesis, to site-specifically delete specific proline (Pro), serine (Ser), and asparagine (Asn) residues to obtain a soybean 1-aminocyclopropane-1-carboxylic acid synthase single enzyme mutant that retains only 1-aminocyclopropane-1-carboxylic acid synthase activity and loses CS lyase activity. This provides a new target and gene resource for the creation of soybean stress-resistant varieties, and has broad application prospects and important economic value in the molecular breeding of stress-resistant soybeans. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1 for Protein quantitative SDS-PAGE electrophoresis;

[0009] Figure 2 GmAH3 and Detection of 1-aminocyclopropane-1-carboxylate synthase and CS lyase activities. DETAILED DESCRIPTION

[0010] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0011] The specific implementation of the present invention is described in detail below with reference to specific embodiments.

[0012] One embodiment of the present invention provides a soybean 1-aminocyclopropane-1-carboxylic acid synthase single enzyme mutant based on multiple point deletions, wherein the soybean single enzyme activity mutant is ;

[0013] described The 1-aminocyclopropane-1-carboxylate synthase homologous gene located at bases 15273601 to 15275841 on soybean chromosome Gm07, whose function has not been reported, is temporarily named GmAH3 ( G lycine m ax 1- a minocyclopropane-1-carboxylate synthase h The 15274761~15274769th position in its genome, the 720th~728th position in its corresponding mRNA sequence, or the 621st~629th position in its corresponding CDS sequence were deleted, so that the encoded GmAH3 protein lacked the three amino acids between positions 206 and 210, namely proline (Pro), serine (Ser) and asparagine (Asn). The mutated GmAH3 protein (named ) only has 1-aminocyclopropane-1-carboxylic acid synthase activity and loses CS lyase activity. The amino acid sequence is shown in SEQ ID NO.1.

[0014] As a preferred embodiment of the present invention, the The preparation method is as follows:

[0015] Step 1: Primer design;

[0016] Design primers AF and BR at the beginning and end of the gene:

[0017] 07AF:ATGGGTATTGAGATGGAGCA

[0018] 07BR: CTAAACGCTTTCTGTCCTTATTCG;

[0019] Design primers at the missing base, taking about 15bp above and below, for a total of about 30bp

[0020] 07-MF:GAGTTCTAATCACAAACCCATTAGGTGTAACAATTCC

[0021] 07-MR: GGAATTGTTACACCTAATGGGTTTGTGATTAGAACTC;

[0022] Step 2: PCR product amplification;

[0023] Step 2.1: Amplification of fragments A and B

[0024] A fragment amplification primers:

[0025] 07AF:ATGGGTATTGAGATGGAGCA

[0026] 07-MR:GGAATTGTTACACCTAATGGGTTTGTGATTAGAACTC

[0027] 638bp;

[0028] Primers for fragment B amplification:

[0029] 07-MF:GAGTTCTAATCACAAACCCATTAGGTGTAACAATTCC

[0030] 07BR:CTAAACGCTTTCTGTCCTTATTCG

[0031] 731bp;

[0032] In a 50 μl reaction system, a plasmid containing the wild-type GmAH3 gene was used as a template, 1 μl of each 10 μM primer was added, and HiFi Hot Start was used as the DNA polymerase. The amplification conditions were: 95°C for 5 min; 98°C for 20 s; 58°C for 15 s; 72°C for 1 min; and 72°C for 10 min, for a total of 25 cycles.

[0033] Step 2.2: Fusion of fragments A and B:

[0034] 07F: CAGCAAATGGGTCGCGGATCCATGGGTATTGAGATGGAGCAACCTTGTGT

[0035] 07R: TGGTGGTGCTCGAGTGCGGCCGCCTAAACGCTTTCTGTCCTTATTCGTTC;

[0036] The amplification reaction system is as follows: in a 50 μl reaction system, the volume of A and B fragments to be added is calculated according to the concentration and length of A and B fragments, respectively, according to the principle of a total volume of 15 μl, and HiFi Hot Start is used as DNA polymerase; the amplification conditions are: 95°C 5 min; 98°C 20s; 58°C 15s; 72°C 2 min; 72°C 10 min; a total of 11 cycles, then, the purified product obtained in this step is used as a template, HiFi Hot Start is used as DNA polymerase, and GmAH3 upstream and downstream 07F and 07R are used as primers to obtain the respective fusion PCR products. Target product.

[0037] Step 3: protein expression and purification in vitro;

[0038] After the above PCR product was purified, the product was ligated into the pMD_18-T vector using the pMD_18-T Vector Cloning Kit. After sequencing verification, the pMD_18-T vector and the expression vector pET28a were double-digested with BamH I and Not I, and the target fragment was ligated into pET28a to obtain nucleotide sequence. After sequencing verification, 20 ng of the vector was transformed into BL21 competent cells, plated on LB plates containing ampicillin, and cultured overnight at 37°C. Single colonies were picked the next day. Transformed cells were cultured and collected, and purified using a His-Trap FF column (GE Healthcare, Cat. No. 17-5255-01) according to the instructions. Single enzyme.

[0039] As a preferred embodiment of the present invention, the method for determining the activities of 1-aminocyclopropane-1-carboxylate synthase and CS lyase is as follows:

[0040] The purified single enzyme mutant protein was subjected to dual enzyme activity assays of 1-aminocyclopropane-1-carboxylate synthase and CS lyase according to the following method:

[0041] The activity of 1-aminocyclopropane-1-carboxylic acid synthase was determined by incubating the purified 1-aminocyclopropane-1-carboxylic acid synthase mutant protein or the corresponding positive and negative controls (GmAH3, protein extracts from the strain transformed with the empty vector pET28a in the same procedure), 1-aminocyclopropane-1-carboxylic acid synthase reaction buffer (50 mM EPPS, pH 8.5, 10 μM PLP, 2 mM DTT), and S-adenosylmethionine. The reaction was terminated with 100 mM HgCl2, and freshly prepared ACC assay solution [saturated NaOH: sodium hypochlorite = 2:1 (v:v)] was added to convert the generated 1-aminocyclopropane-1-carboxylic acid synthase into ethylene. The amount of ethylene produced was analyzed and calculated using a gas chromatograph (Agilent 7890A).

[0042] The basic reaction system for the CS lyase activity assay involves incubating purified ACS mutant protein or corresponding positive and negative controls with a substrate such as L-cystine, 0.1M potassium phosphate buffer (pH 7.8), 10 mM PLP, and 2 mM DTT. Chloroform is then added to extract the protein. The reaction product, pyruvate, is measured spectrophotometrically by measuring the amount of pyruvate-2,4-dinitrophenylhydrazone, which is formed by the reaction of pyruvate with 2,4-dinitrophenylhydrazine.

[0043] In the embodiment of the present invention, GmAH3 and Protein quantitative SDS-PAGE electrophoresis diagram Figure 1 As shown, the activity assay results refer to Figure 2 .in, Figure 2 The picture in A is the pyruvic acid color reaction of GmAH3, and the bar graph is based on the OD value of the mixed solution after the reaction. 520 Quantification of the CS lyase activity and 1-aminocyclopropane-1-carboxylate synthase activity of GmAH3 using the null pET28a vector as a negative control. Error bars represent the standard error of three biological replicates. Figure 2 The picture in B is The pyruvic acid color reaction, the bar graph is based on the OD of the mixed solution after the reaction 520 The value pair The CS lyase activity of GmAH3 was quantified, as was the 1-aminocyclopropane-1-carboxylate synthase activity. The pET28a empty vector was used as a negative control. The error bars represent the standard error of three biological replicates. It only has 1-aminocyclopropane-1-carboxylic acid synthase activity and no CS lyase activity.

[0044] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A soybean 1-aminocyclopropane-1-carboxylic acid synthase single enzyme mutant based on multiple deletions, characterized in that: The soybean 1-aminocyclopropane-1-carboxylic acid synthase single enzyme activity mutant is prepared by deleting multiple specific amino acid sites. ; described The amino acid sequence is shown in SEQ ID NO.1.

Images