Exosome spherical nucleic acid nano motor NM-ESNA for resisting skin aging as well as preparation method and application of exosome spherical nucleic acid nano motor NM-ESNA
By combining gas-producing functional molecules and spherical nucleic acid nanosystems, the exosome surface is asymmetrically modified to form a gas motor structure, which solves the problem of transdermal difficulty of exosomes and achieves non-invasive and controllable deep delivery and anti-aging effects.
Patent Information
- Application Number
- CN202510656669.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-21
- Publication Date
- 2025-08-29
AI Technical Summary
In the prior art, exosomes are difficult to penetrate the skin stratum corneum, have poor transdermal effect, and are difficult to control nanomotor motion, making it impossible to achieve non-invasive and controllable deep delivery.
The gas-producing functional molecules are combined with spherical nucleic acid nanosystems, and the exosome surface is modified asymmetrically to form a gas motor structure, and a highly dense nucleic acid layer is formed using siRNA modification, combining light control technology to achieve independent movement and deep delivery of exosomes.
It realizes non-invasive, controllable and deep-level delivery of exosomes in the skin, enhances the transdermal effect, synergistically exerts anti-aging effects, and improves collagen regeneration and anti-inflammatory effects.
Smart Images

Figure CN120550133A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an exosome spherical nucleic acid nanomotor NM-ESNA for anti-skin aging, and a preparation method and application thereof. Background Art
[0002] The morphological manifestations of aging skin include epidermal thinning, abnormal dermal fibroblast proliferation, loss of fibrin structure, and decreased collagen content, leading to a loosening of the connection between the epidermis and dermis, ultimately causing wrinkles. It can be argued that the primary problem with skin aging originates in the dermis. The barrier function of the stratum corneum limits the application of most anti-aging drugs. Various approaches have been used to overcome the stratum corneum barrier, but most struggle to balance transdermal performance and safety. Physical methods such as microneedling and electroporation can temporarily disrupt the stratum corneum barrier to increase drug access, but this can cause skin damage. Nanocarriers such as liposomes are relatively safe, but their transdermal efficacy is suboptimal. Exosomes are paracrine vesicles with a diameter of 30 to 200 nm and a double-layer lipid membrane structure. They are rich in active substances such as lipids, proteins, nucleic acids, and metabolites. Multiple studies have demonstrated that exosomes can delay and improve skin aging through paracrine effects. However, individual exosomes have poor penetration and lack the ability to move autonomously within the skin. Their poor self-transdermal efficacy makes them difficult to penetrate deeper into the skin, limiting their further application.
[0003] Spherical nucleic acid is a nanostructure composed of highly oriented, high-density nucleotide layers with a spherical three-dimensional geometric structure. Studies have shown that its three-dimensional structure gives the spherical nucleic acid nanosystem excellent transdermal effects and resistance to nuclease degradation.
[0004] Gas nanomotors are a type of micro-nanomotor. Their primary mechanism is to generate bubbles around the micro-nanomotor through certain reactions. The reverse thrust of the bubbles then propels the motor forward, similar to a rocket launch. The movement of nanomotors is often irregular, and controlling their direction remains a major challenge. Furthermore, existing nanomotors have some mobility in inflammatory and reactive oxygen species environments, but their effectiveness is limited by the inflammatory status and reactive oxygen species levels at the lesion site, and their tissue penetration is somewhat limited.
[0005] Therefore, it is of great significance to develop a new transdermal technology to endow mesenchymal stem cell exosomes with autonomous movement properties in the skin and achieve non-invasive, controllable and deep delivery of exosomes in the skin. Summary of the Invention
[0006] Purpose of the invention: In response to the problems existing in the prior art, the present invention provides an exosome spherical nucleic acid nanomotor NM-ESNA for anti-skin aging. The gas propulsion technology of the present invention is combined with the spherical nucleic acid nanosystem to enhance the transdermal effect of exosomes by dual penetration promotion. It aims to solve the problems of mesenchymal stem cell exosomes themselves being difficult to overcome the stratum corneum barrier, difficulty in transdermal delivery, poor autonomous movement performance, and poor stability. It realizes the non-invasive and deep delivery of mesenchymal stem cell exosomes in the skin, retains the activity of exosomes while effectively improving skin aging.
[0007] The present invention also provides a preparation method and application of exosome spherical nucleic acid nanomotor NM-ESNA for resisting skin aging.
[0008] Technical solution: In order to achieve the above-mentioned purpose, the present invention discloses an anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA, which includes mesenchymal stem cell exosomes, a gas-producing functional molecule, siRNA, and an anti-aging active ingredient. The gas-producing functional molecule is a product formed by the connection between an NO donor molecule and cholesterol. The gas-producing functional molecule is asymmetrically modified on one side of the exosome to form a gas motor structure; the siRNA is modified on the surface of the exosome to form a highly dense nucleic acid layer, i.e., a spherical nucleic acid structure; the anti-aging active ingredient is encapsulated in the mesenchymal stem cell exosomes.
[0009] The structure of the gas-producing functional molecule is shown below:
[0010]
[0011] Wherein, the gas-generating functional molecules release gas in response to visible light irradiation;
[0012] Among them, the siRNA is linked to cholesterol and modified on the surface of exosomes, and its sequence is not limited to the anti-skin aging target sequence and can be designed according to different skin care needs.
[0013] The siRNA sequence is one of the following: sense strand AAAATTACACGCCAGATTTGCC, antisense strand GGTGTGACATTACTCCAGAGTTG;
[0014] Sense chain CTCTGGAGTAATGTCACACCTCT, antisense chain TGTTGGTCCACCTTTCATCTTC; sense chain GGGGCTTTGATGTACCCTAGC, antisense chain TGTCACACGCTTTTGGGGTTT;
[0015] Sense chain AGTCTTCCAATCCTACTGTTGCT, antisense chain TCCCCGTCACCTCCAATCC;
[0016] Sense chain CTGGACTCCGACACTCTGGA, antisense chain CAGGAAAGGTTCTGAAGTGACC;
[0017] Sense chain CGGTTCCGCCTGTCTCAAG, antisense chain CGCCAAAAGTGCCTGTCTT;
[0018] Sense chain AGACCTGGGCAGATTCCAAAC, antisense chain CGGCAAGTCTTCCGAGTAGT;
[0019] Sense chain GGGACGCAGACATCGTCATC, antisense chain TCGTCATCGTCGAAATGGGC;
[0020] Sense strand CTTTGGCTTAGAGGTGACTGG, antisense strand AGGCACTCCACATCTTGGTTT;
[0021] Sense chain CTATCCCTTGATGCCATTACCAG, antisense chain ATCCACATGGTTGGGAAGTTC; sense chain CTTCTTCTTGTTGAGCTGGACTC, antisense chain CTGTGGAGGTCACTGTAGACT;
[0022] Sense strand TTAAAGACAGGCACTTTTGGCG, antisense strand CCCTCGTATAGCCCAGAACT;
[0023] Sense chain TCTGGGCTATACGAGGGCAC, antisense chain ACCCTTGAGTCAACACCTGGA;
[0024] Sense chain ACATGGAGACTTTGTCCCTTTTG, antisense chain TTGGCTGAGTGGTAGAGTCCC;
[0025] Sense chain GGACCCGAAGCGGACATTG, antisense chain CGTCGTCGAAATGGGCATCT;
[0026] Sense strand GCGTCGTGATCCCCACTTAC, antisense strand CAGGCCGAATAGGAGCGTC;
[0027] The sense chain is CTGGACAGCCAGACACTAAAG, and the antisense chain is CTCGCGGCAAGTCTTCAGAG.
[0028] The anti-aging active ingredients include any one of small molecule peptides, bosera, ceramide, hydroxypinacolone retinoic acid ester, and vitamin A / C / E.
[0029] The small molecule peptide includes at least one of nonapeptide-1, acetyl hexapeptide-8, dipeptide snake toxin, glutathione, and palmitoyl tripeptide-1.
[0030] The method for preparing the anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA of the present invention comprises the following steps:
[0031] (1) Extraction and separation of mesenchymal stem cell exosomes: The culture medium of human umbilical cord-derived mesenchymal stem cells was collected, and exosomes derived from mesenchymal stem cells were extracted by ultracentrifugation;
[0032] (2) Preparation of mesenchymal stem cell exosomes loaded with anti-aging active ingredients: reacting the mesenchymal stem cell exosomes prepared in step (1) with the anti-aging active ingredients, and purifying them by ultracentrifugation to obtain mesenchymal stem cell exosomes loaded with anti-aging active ingredients;
[0033] (3) Preparation of gas-producing functional molecules: NO donor and cholesterol CHOL are connected through condensation reaction, reductive amination reaction, and nitrosation reaction to prepare gas-producing functional molecules;
[0034] (4) Preparation of exosome ESNA with a spherical nucleic acid structure: The exosomes loaded with active ingredients obtained in step (2) are co-incubated with siRNA-CHOL, and ESNA is obtained after separation and purification;
[0035] (5) Preparation of exosome-based spherical nucleic acid nanomotor NM-ESNA: Molecular imprinting technology is used to spatially shield one side of the exosome ESNA with a spherical nucleic acid structure obtained in step (4), and the gas-producing functional molecule prepared in step (3) is asymmetrically modified on the unshielded side of the ESNA to construct an exosome spherical nucleic acid nanomotor with anti-skin aging effect.
[0036] The concentration of exosomes in step (2) is 1×10 7 -7×10 7 / mL, the concentration of the anti-aging active ingredient is 0.1-5 mg / mL; the reaction method includes at least one of repeated freeze-thaw cycles, co-extrusion, co-ultrasound, and co-incubation, the reaction temperature is 4-37°C, and the reaction time is 4-24h.
[0037] The method for preparing the gas-generating functional molecule in step (3) comprises the following steps:
[0038] a. Compound 1 is obtained by condensing p-formylbenzoic acid and cholesterol (CHOL)
[0039]
[0040] b. 7-amino-4-methylcoumarin and compound 1 Reductive amination was performed to obtain compound 3
[0041] c. Compound 2 Reacts with nitrosating reagent to generate compound 3 That is, the gas-producing functional molecule.
[0042] Wherein, the condensation reagent in step a includes DMAP (4-dimethylaminopyridine), EDCI (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride) or DCCI (dicyclohexylcarbodiimide); the reaction solvent includes dichloromethane and / or tetrahydrofuran, the reaction temperature is 25-40°C, and the reaction time is 12-48h; the reaction conditions in step b include: reacting in the presence of light, a catalyst, and a reductive amination reagent; wherein the catalyst is glacial acetic acid, and the reductive amination reagent is acetic acid. The nitrosating agent is at least one of sodium borohydride, sodium triacetoxyborohydride, and sodium cyanoborohydride, the reaction solvent includes 1,2-dichloroethane, tetrahydrofuran or acetonitrile, the reaction temperature is 30°C-80°C, and the reaction time is 8-24h; in step c, the nitrosating agent is sodium nitrite (NaNO2) or tert-butyl nitrite (TBN), the reaction solvent includes any one or more of tetrahydrofuran, acetic acid, and acetonitrile, the reaction temperature is 25-80°C, and the reaction time is 0.5-6h.
[0043] Wherein, the exosome concentration in step (4) is 1×10 7 -7×10 7 / mL, the concentration of the siRNA-CHOL is 0.1-20 μM; the co-incubation reaction temperature is 4-37° C., and the reaction time is 4-24 h.
[0044] The preparation of the anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA in step (5) comprises the following steps:
[0045] a. Preparation of amino-well plates: After the 96-well plate was exposed to UV light, an amino reagent 3-aminopropyltriethoxysilane (APTES) was added to react to obtain an amino-well plate;
[0046] b. Molecular imprinting: Exosomes are attached to the bottom of an amino-treated 96-well plate as template molecules. Functional monomer 3-aminotripropylethoxysilane (APTES) and crosslinker tetraethyl orthosilicate (TEOS) are added for cross-linking. The functional monomer and crosslinker form a molecularly imprinted polymer (MIP) on the surface of the template molecules. The thickness of the imprinted MIP layer is controlled by controlling the concentration of the functional monomer and crosslinker, as well as the reaction time and temperature, so that the MIP accumulates on one side of the exosomes, thereby shielding the imprinted side of the exosomes.
[0047] c. Preparation of anti-skin aging exosome spherical nucleic acid nanomotors NM-ESNA: Add gas-producing functional molecules to the well plate from step b to react with the unmasked side of the exosomes. After the reaction, elute and collect the eluate for ultracentrifugation. The precipitate is the anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA.
[0048] Preferably, in step a, the wavelength of the UV lamp is 365 nm, the irradiation time is 2 h, the concentration of APTES added to each well is 0.2%, the volume is 100 μL, and the reaction is carried out at room temperature for 4 h;
[0049] Preferably, in step b, the crosslinking agent TEOS is first added for reaction, and then the functional monomer APTES is added for reaction, and the APTES and TEOS are used to form an imprinting layer to achieve spatial shielding of the nanocarrier; the reaction conditions are: the amount of TEOS is 10-100 μL, the reaction temperature is 20-37° C., the reaction time is 2-10 h, the amount of APTES is 10-100 μL, the reaction temperature is 20-37° C., and the reaction time is 8-24 h;
[0050] The exosome concentration in step c is 1×10 7 -7×10 7 / mL, the concentration of the gas-producing functional molecule is 0.1-20 μM, the reaction method is co-incubation, the incubation temperature is 4-37°C, and the incubation time is 4-24h;
[0051] Furthermore, the elution solvent used in step c is one of purified water, physiological saline, and phosphate buffered saline (PBS (pH 7.4)).
[0052] Wherein, the exosome concentration in step (5) is 1×10 7 -7×10 7 / mL, the concentration of the siRNA-CHOL is 0.1-20 μM; the co-incubation reaction temperature is 4-37° C., and the reaction time is 4-24 h.
[0053] The siRNA sequence is not limited to anti-skin aging target sequences and can be designed according to different skin care needs.
[0054] The invention relates to the use of the anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA in the preparation of anti-skin aging drugs or reagents.
[0055] The exosomes described in this invention are derived from mesenchymal stem cells and obtained by ultracentrifugation. The gas-producing functional molecule is formed by the linkage of an NO donor molecule and CHOL, asymmetrically modified on one side of the exosome to form a gas motor structure. The siRNA is modified with CHOL on the surface of the exosomes, forming a highly dense nucleic acid layer, i.e., a spherical nucleic acid structure. The exosomes encapsulate anti-aging active ingredients. The siRNA sequence is not limited to anti-aging target sequences and can be designed according to different skin care needs. By further optimizing and adjusting the reaction conditions of each step, the present invention achieves efficient reaction and high yield.
[0056] The anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA provided by the present invention can release gas molecules in a controllable, efficient and stable manner under light triggering, while the activity and structure of the exosomes are not affected. Due to the asymmetric modification, the generated gas molecules converge on one side of the exosomes, and the resulting concentration gradient difference helps promote the autonomous movement of the exosomes and their delivery to deep skin tissues, further enhancing the cosmetic effect of the exosomes.
[0057] This invention is the first to directly asymmetrically modify the surface of exosomes to construct a non-invasive, light-controlled exosome transdermal system with strong tissue penetration. The invention combines spherical nucleic acid nanotechnology and gas nanomotor technology to enhance the transdermal effect of exosomes. First, CHOL, a component of biological membranes, is used as a linker between the gas-producing molecule and the exosome membrane surface. A cholesterol-linked gas-producing functional molecule is synthesized, which releases gas in a controllable manner in response to visible light. Next, the exosomes are asymmetrically modified by utilizing the property of molecular imprinting technology, where functional monomers and crosslinkers can form molecularly imprinted polymers (MIPs) on the surface of template molecules. The researchers used exosomes as template imprinting molecules, 3-aminotripropylethoxysilane (APTES) as a functional monomer, and tetraethyl orthosilicate (TEOS) as a crosslinker. By controlling the reaction time and temperature to control the thickness of the imprinting layer (MIP), the MIP accumulated on one side of the exosomes, creating a spatial shielding effect. The gas-producing functional molecules were then modified on the unimprinted side. After washing with a suitable solvent, the asymmetrically modified exosomes with gas-producing molecules fell off the imprinting cavity. Furthermore, using the "like dissolves like" principle, CHOL-modified siRNA was attached to the exosome surface, forming a highly dense spherical nucleic acid structure.
[0058] The anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA provided by the present invention, on the one hand, siRNA is modified on the surface of the exosome by the CHOL group, and is arranged to form a highly dense, 3D three-dimensional spherical nucleic acid structure. This three-dimensional structure can effectively enhance the skin cell penetration ability of the exosome, and protect the exosomes and siRNA from degradation, enhance stability, and facilitate storage; on the other hand, the gas-producing molecule is asymmetrically modified on one side of the exosome by CHOL. This asymmetric modification causes a gas gradient to be generated on one side of the exosome under visible light irradiation. This gas gradient provides a source of power for the nanomotor to move, which is expected to increase the penetration depth of the exosome in the skin. In addition, the direction of movement of the nanomotor can be regulated by the polarity difference between the gas-producing molecules and siRNA and the different water content of each layer of the skin. Specifically, the water content of the skin is from top to bottom: stratum corneum (20%-30%), active epidermis (50%-70%), and dermis (more than 80%). Therefore, once the exosome-shaped spherical nucleic acid nanomotor enters the skin, the side modified with the lipid-soluble gas-producing molecule automatically faces the stratum corneum (where water content is lower), while the water-soluble siRNA faces the dermis (where water content is higher), achieving precise control of its movement from the stratum corneum to the dermis. This nanomotor has a reliable source, a simple overall preparation process, excellent stability, and high safety, and has broad application prospects in the field of medical cosmetics and skincare.
[0059] The core of the present invention is to combine the dual penetration-enhancing strategy of spherical nucleic acids with 3D structures and nanomotors, thereby enhancing the non-invasive, light-controlled, and deep transdermal effect of exosomes. Compared with traditional non-invasive transdermal methods such as naked exosomes and DNA tetrahedrons, the anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA provided by the present invention exhibits excellent light-controlled motion performance and significantly enhanced tissue penetration performance, and its penetration depth can be regulated by light. In addition, NM-ESNA combines the paracrine effect of exosomes and the gene therapy effect of siRNA, and can synergistically exert anti-aging effects after delivery to the dermis. As a non-invasive, controllable, and deep-level skin delivery system, NM-ESNA provides a new strategy for the future development of non-destructive transdermal technology based on exosomes.
[0060] The key to this invention lies in the asymmetric modification and formation of a spherical nucleic acid structure. The asymmetric modification ensures the formation of a nanomotor structure, enhancing the active motility of the vector. The spherical nucleic acid structure is a three-dimensional structure. This invention combines nanomotor technology with spherical nucleic acid technology in exosomes to enhance their transdermal transdermal effect.
[0061] Beneficial effects: Compared with the prior art, the present invention has the following advantages:
[0062] 1. Synergistic penetration-enhancing effect: The anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA of the present invention undergoes dual modification of exosomes with siRNA and gas-producing molecules. Compared with the characteristic that exosomes only stay on the surface of the skin when applied alone, the modified exosome spherical nucleic acid nanomotor NM-ESNA has significantly enhanced transdermal effect and motility. This dual penetration-enhancing strategy enables exosomes to penetrate deep into the skin tissue under non-destructive and light-controlled conditions, better reaching the target site to exert their effect.
[0063] 2. Synergistic Anti-Aging Effect: The anti-aging exosome spherical nucleic acid nanomotor NM-ESNA, designed by this invention, effectively reaches the dermis and, through its paracrine action, synergizes with the gene therapy of SNA to achieve anti-aging effects. Exosomes promote collagen regeneration and have anti-inflammatory and antioxidant properties, while spherical nucleic acids effectively reduce collagen degradation by inhibiting the expression of MMP1. This synergistic effect significantly reduces wrinkles, increases collagen content, and effectively improves the appearance of aging skin.
[0064] 3. The anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA of the present invention can achieve light-controlled motion effects. By controlling the illumination time and illumination intensity, the penetration depth and penetration intensity of the nanosystem in the skin can be controlled.
[0065] 4. The anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA of the present invention is modified with both fat-soluble gas-producing molecules and water-soluble siRNA. By utilizing the difference in water content among different layers of the skin, the nanosystem can achieve directional movement from the epidermis with lower water content to the dermis with higher water content in the skin under visible light.
[0066] 5. In the present invention, siRNA with CHOL terminal modification is modified on the surface of exosomes to form a highly dense and directional nucleic acid layer. This spherical three-dimensional structure can not only enhance the skin penetration ability of exosomes, but also protect siRNA and exosomes from enzymatic degradation, thereby enhancing the stability of the carrier.
[0067] 6. The siRNA sequence in the present invention can be designed according to different needs. The required sequence can be flexibly designed for single or multiple targets, and even nonsense sequences can be used. It has wide applicability, strong adjustability, and is safe and controllable.
[0068] 7. In the present invention, by connecting the NO donor with the CHOL molecule, the NO donor molecule is directly and efficiently assembled on the surface of the exosomes. The process is simple and avoids the influence of the introduction of other polymers on the activity and stability of the exosomes.
[0069] 8. The gas-generating functional molecules in the present invention are responsive to visible light, the gas release is controllable, and the response rate is high, thus avoiding damage to the skin caused by the introduction of ultraviolet light or infrared light.
[0070] 9. Existing reaction mechanisms, such as Mg + 2H2O → Mg(OH)2 + H2↑, introduce unnecessary metals and solid waste. Other reactions, such as H2O2 + Ni / Pt → H2O + O2↑, require metal catalysis and have a strong demand for H2O2 in the reaction system, making them unsuitable for widespread application. In the present invention, endogenous gas molecules NO are used as the driving force source, which does not introduce non-physiological gases, waste metals and other solid wastes, is independent of the physiological environment, and has wide applicability. In addition, NO itself has anti-inflammatory and tissue permeability-enhancing effects, which can help enhance the therapeutic effect of exosomes.
[0071] 10. In the present invention, molecular imprinting technology is used to achieve asymmetric modification of exosomes. The exosome template molecules asymmetrically modified with the obtained gas-producing molecules can be easily eluted from the imprinting cavity, making it easy to collect without damaging the structure of the exosomes.
[0072] 11. The preparation method of the present invention has mild conditions and is easy to operate. The prepared anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA has good biocompatibility, high safety and a wide range of applications. BRIEF DESCRIPTION OF THE DRAWINGS
[0073] Figure 1 is the H NMR spectrum of the gas-producing functional molecule ( 1 HNMR) spectra;
[0074] Figure 2 is the NMR carbon spectrum of the gas-producing functional molecule ( 13 CNMR) images;
[0075] Figure 3 Western blot was used to detect the characteristic proteins of mesenchymal stem cell exosomes and exosomal spherical nucleic acid nanomotor NM-ESNA;
[0076] Figure 4 Schematic diagram of the morphological characterization of mesenchymal stem cell exosomes and exosomal spherical nucleic acid nanomotors NM-ESNA using transmission electron microscopy;
[0077] Figure 5 To investigate the stability of exosome spherical nucleic acid nanomotors in PBS (pH 7.4);
[0078] Figure 6 To investigate the stability of exosome spherical nucleic acid nanomotors in FBS;
[0079] Figure 7for the characterization of asymmetric modification of exosomes by transmission electron microscopy (AuNPs replacing gas-producing molecules);
[0080] Figure 8 Characterization of the spherical nucleic acid structure of exosomes by SDS-PAGE gel electrophoresis;
[0081] Figure 9 The movement behavior of the exosome spherical nucleic acid nanomotor NM-ESNA before and after light exposure;
[0082] Figure 10 This is the result of determination of the content of lipid peroxide malondialdehyde (MDA) in mouse skin tissue;
[0083] Figure 11 This is the result of determination of glutathione (GSH) content in mouse skin tissue;
[0084] Figure 12 This is the result of the determination of superoxide dismutase (SOD) content in mouse skin tissue;
[0085] Figure 13 The results are for the determination of catalase (CAT) content in mouse skin tissue. DETAILED DESCRIPTION
[0086] The present invention will be further described below with reference to specific embodiments and accompanying drawings.
[0087] The experimental methods described in the examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.
[0088] Human keratinocytes (HaCaT) and fibroblasts (HSF), and human umbilical cord-derived mesenchymal stem cells were purchased from the Shanghai ATCC cell bank; cholesterol (CHOL) was purchased from Shanghai Avite Pharmaceutical Technology Co., Ltd.; superoxide dismutase (SOD), malondialdehyde (MDA), glutathione (GSH), catalase (CAT), type I collagen COL-I, type III collagen COL-III, and matrix metalloproteinase MMP-1 detection kits were all purchased from Nanjing Jiancheng Biotechnology Co., Ltd.; ordinary siRNA, cholesterol-modified siRNA (siRNA-CHOL), and Cy3 fluorescent and cholesterol-CHOL-modified siRNA (Cy3-siRNA-CHOL) were all purchased from Shanghai Shenggong Biotechnology Co., Ltd. (siRNA sequence in the embodiment: sense chain CTTCTTCTTGTTGAGCTGGACTC, antisense chain CTGTGGAGGTCACTGTAGACT); DCCI, DMAP, EDCI, TBN, NaNO2 were purchased from Shanghai Bid Pharmaceutical Technology Co., Ltd.; APTES, TEOS were purchased from Anage Pharmaceutical Chemical Co., Ltd.; Griess kit was purchased from Shanghai Biyuntian Biotechnology Co., Ltd.; AuNP-PEG2000-CHOL was purchased from Xi'an Qiyue Biological; bosine, ceramide, hydroxypinacolone retinoic acid ester, vitamin A / C / E, nonapeptide-1, acetyl hexapeptide-8, dipeptide snake toxin, glutathione, palmitoyl tripeptide-1 were purchased from Zhongguang Biotechnology Co., Ltd.
[0089] Other reagents and raw materials are commercially available.
[0090] Example 1
[0091] Preparation of gas-producing functional molecules connected with CHOL. The synthetic route is as follows:
[0092]
[0093] The reaction conditions of a are as follows: p-formylbenzoic acid (150.13 mg, 1 equivalent) and CHOL (386.66 mg, 1 equivalent) are weighed, and a condensing agent DCCI (412.66 mg, 2 equivalents) and DMAP (97.68 mg, 20% of the total equivalents) are added. The solvent is 25 mL of dichloromethane, and the mixture is stirred at 30° C. for 24 h. After completion of the reaction, the mixture is purified by silica gel column chromatography (300-400 mesh) with ethyl acetate:petroleum ether = 5:1 as the eluent. The mixture is dried in vacuo to obtain compound 1, weighing 467.44 mg with a yield of 87.08%.
[0094] The reaction conditions of b are as follows: 7-amino-4-methylcoumarin (175.18 mg, 1 equivalent), compound 1 (518.79 mg, 1 equivalent), and glacial acetic acid (6 mg, 0.1 equivalent) were weighed, 15 mL of 1,2-dichloroethane was added as the reaction solvent, and the mixture was refluxed at 80°C for 1 hour (protected from light). After cooling to room temperature, sodium triacetoxyborohydride (635.82 mg, 3 equivalents) was added, and the mixture was reacted at 30°C for 12 hours. The mixture was purified by silica gel column chromatography (300-400 mesh) with ethyl acetate:petroleum ether = 10:1 as the eluent, and dried in vacuo to obtain compound 2, weighing 447.82 mg, with a yield of 64.53%;
[0095] The reaction conditions of c are as follows: compound 2 (338.99 mg, 0.5 equivalent) is dissolved in 10 mL of tetrahydrofuran: glacial acetic acid (1:1), and an aqueous solution of NaNO2 (68.99 mg, 1 equivalent) is slowly added dropwise. The reaction is carried out at 25°C for 6 h. After the reaction is completed, a large amount of water is added to the reaction solution to precipitate the precipitate, which is filtered and dried to obtain the product, which is the CHOL-linked gas-producing functional molecule. The yield is 315.87 mg, and the yield is 93.18%.
[0096] 1 H NMR(300MHz,Chloroform-d)δ7.97(d,J=7.9Hz,2H),7.64(d,J=4.0Hz,2H),7.41(s, 1H),7.12(d,J=7.9Hz,2H),6.29(s,1H),5.40(s,1H),5.31(s,2H),4.85(d,J=15.1H z,1H),2.43(d,J=8.4Hz,5H),2.06–1.79(m,5H),1.74–1.44(m,7H),1.34(d,J=8.2H z,3H),1.26–1.10(m,7H),1.05(s,6H),0.89(dd,J=16.0,6.2Hz,10H),0.68(s,3H).
[0097] 13C NMR (75MHz, CDCl3) δ165.33,160.24,151.74,139.57,138.38,130.62,130.36,126. 69,125.93,122.88,118.54,114.91,114.20,106.33,74.82,56.71,56.14,50.05,48 .62,45.86,42.34,39.75,39.54,38.19,37.02,36.66,36.20,35.82,31.95,31.89,28.26,28.05,27.86,24.32,23.85,22.86,22.60,21.07,19.40,18.75,18.65,11.89.
[0098] The H-NMR spectrum and C-NMR spectrum of the gas-producing functional molecules are as follows: Figure 1 and Figure 2 As shown, it proves that the gas-generating molecule was successfully synthesized.
[0099] Example 2
[0100] Preparation of an anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA:
[0101] (1) Preparation of gas-producing functional molecules connected with CHOL. The synthetic route is the same as in Example 1. The specific reaction conditions are as follows:
[0102] The reaction conditions of a are as follows: p-formylbenzoic acid (150.13 mg, 1 equivalent) and CHOL (386.66 mg, 1 equivalent) are weighed, condensing agent EDCI (383.40 mg, 2 equivalents) and DMAP (97.68 mg, 20% total equivalents) are added, the solvent is 25 mL of tetrahydrofuran, and the mixture is stirred at 25°C for 36 hours. After completion of the reaction, the mixture is purified by silica gel column chromatography (300-400 mesh) with ethyl acetate:petroleum ether = 5:1 as the eluent and dried in vacuo to obtain compound 1, weighing 436.52 mg with a yield of 81.32%;
[0103] The reaction conditions of b are as follows: 7-amino-4-methylcoumarin (175.18 mg, 1 equivalent), compound 1 (518.79 mg, 1 equivalent), and glacial acetic acid (6 mg, 0.1 equivalent) were weighed, 15 mL of acetonitrile was added as the reaction solvent, and the mixture was refluxed at 80°C for 1 h (protected from light). After cooling to room temperature, sodium borohydride (75.66 mg, 3 equivalents) was added, and the mixture was reacted at 50°C for 20 h. The mixture was purified by silica gel column chromatography (300-400 mesh) with ethyl acetate:petroleum ether = 10:1 as the eluent, and dried in vacuo to obtain compound 2, weighing 480.50 mg, with a yield of 69.24%;
[0104] The reaction conditions of c are as follows: compound 2 (338.99 mg, 0.5 equivalent) was dissolved in 10 mL of tetrahydrofuran, and an aqueous solution of NaNO2 (68.99 mg, 1 equivalent) was slowly added dropwise. The mixture was reacted at 37°C for 2 h. After the reaction, a large amount of water was added to the reaction solution to precipitate the product, which was filtered and dried to obtain the product, weighing 285.26 mg with a yield of 84.15%.
[0105] (2) Preparation of mesenchymal stem cell exosomes:
[0106] Human umbilical cord-derived mesenchymal stem cells were cultured in MEM medium containing 10% fetal bovine serum and 1% double-antibody at 37°C and 5% CO2. They were passaged to the fifth generation and, when the cells adhered to the culture dish to 90%, switched to serum-free MEM medium for another 24 hours. The culture medium was collected and subjected to ultracentrifugation to extract exosomes. The specific conditions were as follows: centrifugation at 2000g for 10 minutes at 4°C to remove cell debris. The supernatant was sterilized through a 0.22 μm filter and then centrifuged at 120,000g for 60 minutes at 4°C. The precipitate was collected and resuspended in PBS (pH 7.4) to obtain exosomes, which were then stored at -80°C for later use.
[0107] (3) Preparation of exosomes loaded with anti-aging active ingredients:
[0108] Mesenchymal stem cell exosomes were mixed with active ingredients (nonapeptide-1, ceramide, and phosphatase, equal concentrations, volume ratio 1:1:1) in PBS (pH 7.4) to make the final concentration of exosomes 1×10 7 / mL, the final concentration of the active ingredient is 0.1 mg / mL, after incubation at room temperature (25°C) for 12 hours, ultrasonication for 1 hour (frequency 40 Hz), centrifugation at 120000g for 60 minutes at 4°C, and the precipitate is collected to obtain mesenchymal stem cell exosomes containing anti-aging active ingredients.
[0109] (4) Preparation of exosomes ESNA with spherical nucleic acid structure: siRNA-CHOL and the exosomes loaded with active ingredients obtained in step (3) were dissolved in PBS (pH 7.4) and mixed to make the final concentration of exosomes 1×10 7 / mL, the final concentration of siRNA-CHOL was 0.1μM, and the cells were incubated at 4℃ for 24h. The cells were purified by centrifugation at 4℃, 120000g for 60min, and the precipitated exosomes with spherical nucleic acid structure were collected and resuspended in PBS (pH 7.4) to a final concentration of 1×10 7 pieces / mL.
[0110] (5) Preparation of exosome spherical nucleic acid nanomotors NM-ESNA for anti-skin aging:
[0111] a. Preparation of amino plate: Place a 96-well plate under 365nm UV light for 2h, add 100μL of 0.2% APTES (solvent is anhydrous ethanol) amino reagent to each well and react for 4h.
[0112] b. Molecular imprinting: 200 μL of the exosome ESNA with a spherical nucleic acid structure obtained in step (4) was attached to the bottom of an amino-treated 96-well plate as a template molecule. The liquid in the well was carefully concentrated using a nitrogen blower to ensure that the ESNA settled at the bottom of the well plate. Then, 10 μL of a cross-linker 0.1% TEOS (solvent: anhydrous ethanol) was added to the well plate and reacted at 20°C for 4 h. Then, 20 μL of a functional monomer 0.1% APTES (solvent: anhydrous ethanol) was added and reacted at 20°C for 10 h. APTES and TEOS were used to form an imprinting layer to achieve spatial shielding of the nanocarrier.
[0113] c. Preparation of NM-ESNA: CHOL-modified gas-producing functional molecules were added to the well plate in step b to react with the unshielded side of the exosomal spherical nucleic acid ESNA. The solvent was PBS (pH 7.4). The final concentration of the gas-producing functional molecules was 0.1 μM and the final concentration of the exosomal spherical nucleic acid ESNA was 1×10 7 / mL, incubate at 4°C for 24 hours, carefully remove the supernatant, add purified water for elution, collect the eluate, centrifuge at 120,000g for 60 minutes at 4°C, and collect the precipitate to obtain exosomes asymmetrically modified with gas-producing functional molecules, namely, exosome spherical nucleic acid nanomotor NM-ESNA with anti-skin aging properties.
[0114] Example 3
[0115] Preparation of an anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA:
[0116] (1) Preparation of gas-producing functional molecules connected with CHOL. The synthetic route is the same as in Example 1. The specific reaction conditions are as follows:
[0117] The reaction conditions of a are as follows: p-formylbenzoic acid (150.13 mg, 1 equivalent) and CHOL (386.66 mg, 1 equivalent) are weighed, and a condensing agent EDCI (383.40 mg, 2 equivalents) and DMAP (97.68 mg, 20% total equivalents) are added. The solvent is 25 mL of tetrahydrofuran, and the mixture is stirred at 40° C. for 12 h. After completion of the reaction, the mixture is purified by silica gel column chromatography (300-400 mesh) with ethyl acetate:petroleum ether = 5:1 as the eluent. The compound 1 is dried in vacuo to obtain 428.47 mg of compound 1 with a yield of 79.82%.
[0118] The reaction conditions of b are as follows: 7-amino-4-methylcoumarin (175.18 mg, 1 equivalent), compound 1 (518.79 mg, 1 equivalent), and glacial acetic acid (6 mg, 0.1 equivalent) were weighed, 15 mL of 1,2-dichloroethane was added as the reaction solvent, and the mixture was refluxed at 80°C for 1 h (protected from light). After cooling to room temperature, sodium cyanoborohydride (188.52 mg, 3 equivalents) was added, and the mixture was reacted at 80°C for 8 h. The mixture was purified by silica gel column chromatography (300-400 mesh) with ethyl acetate:petroleum ether = 10:1 as the eluent, and dried in vacuo to obtain compound 2, weighing 570.24 mg, with a yield of 82.17%;
[0119] The reaction conditions of c are as follows: compound 2 (338.99 mg, 0.5 equivalent) was dissolved in 20 mL of acetonitrile, tert-butyl nitrite (515.60 mg, 10 equivalent) aqueous solution was added, and the mixture was reacted at 80°C for 0.5 h. After the reaction, a large amount of water was added to the reaction solution to precipitate the product, which was filtered and dried to obtain the product, weighing 292.65 mg with a yield of 86.33%.
[0120] (2) Preparation of mesenchymal stem cell exosomes: Same as Example 2.
[0121] (3) Preparation of exosomes loaded with anti-aging active ingredients:
[0122] Mesenchymal stem cell exosomes were mixed with active ingredients (hydroxypinacolone retinoate, acetyl hexapeptide-8, equal concentrations, volume ratio 3:1) in PBS (pH 7.4) to make the final concentration of exosomes 2×10 7 / mL, the final concentration of the active ingredient is 0.2 mg / mL, incubated at 37°C for 4 hours, then quickly frozen at -80°C and thawed at room temperature, frozen and thawed three times, centrifuged at 120,000g for 60 minutes at 4°C, collected the precipitate and resuspended it in 0.5mL PBS (pH 7.4) to obtain mesenchymal stem cell exosomes carrying anti-aging active ingredients.
[0123] (4) Preparation of exosomes ESNA with spherical nucleic acid structure: siRNA-CHOL and the exosomes loaded with active ingredients obtained in step (3) were dissolved in PBS (pH 7.4) and mixed to make the final concentration of exosomes 2×10 7 The cells were incubated at 25°C for 12 h, and then centrifuged at 120,000 g for 60 min at 4°C to purify the precipitated exosomes with a spherical nucleic acid structure. The precipitated exosomes ESNA were resuspended in PBS (pH 7.4) to a final concentration of 2 × 10 7 pieces / mL.
[0124] (5) Preparation of exosome spherical nucleic acid nanomotors NM-ESNA for anti-skin aging:
[0125] a. Preparation of amino plate: Place a 96-well plate under 365nm UV light for 2h, add 0.2% APTES (solvent is anhydrous ethanol) as the amino reagent to each well and react for 4h.
[0126] b. Molecular imprinting: 200 μL of the exosome ESNA with a spherical nucleic acid structure obtained in step (4) was attached to the bottom of an amino-treated 96-well plate as a template molecule. The liquid in the wells was carefully concentrated using a nitrogen blower to ensure that the ESNA settled at the bottom of the well plate. Then, 30 μL of a cross-linker 0.1% TEOS (solvent: anhydrous ethanol) was added to the well plate and reacted at 37°C for 2 h. Then, 40 μL of a functional monomer 0.1% APTES (solvent: anhydrous ethanol) was added and reacted at 25°C for 8 h. APTES and TEOS were used to form an imprinting layer to achieve spatial shielding of the nanocarrier.
[0127] c. Preparation of NM-ESNA: Add CHOL-modified gas-producing functional molecules to the well plate of step b to react with the unshielded side of the exosomal spherical nucleic acid ESNA. The solvent is PBS (pH 7.4). The final concentration of the gas-producing functional molecules is 5 μM and the final concentration of the exosomal spherical nucleic acid ESNA is 2×10 7 / mL, incubate at 37°C for 4 hours, carefully remove the supernatant, add purified water for elution, collect the eluate, and centrifuge at 120,000g for 60 minutes at 4°C to collect the precipitate to obtain exosomes asymmetrically modified with gas-producing functional molecules, namely, exosome spherical nucleic acid nanomotor NM-ESNA with anti-skin aging properties.
[0128] Example 4
[0129] Preparation of an anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA:
[0130] (1) Preparation of gas-producing functional molecules connected with CHOL:
[0131] The reaction conditions of a are as follows: p-formylbenzoic acid (150.13 mg, 1 equivalent) and CHOL (386.66 mg, 1 equivalent) are weighed, and a condensing agent DCCI (412.66 mg, 2 equivalents) and DMAP (97.68 mg, 20% of the total equivalents) are added. The solvent is 25 mL of dichloromethane, and the mixture is stirred at 37° C. for 48 h. After completion of the reaction, the mixture is purified by silica gel column chromatography (300-400 mesh) with ethyl acetate:petroleum ether = 5:1 as the eluent. The mixture is dried in vacuo to obtain compound 1, weighing 441.67 mg, with a yield of 82.28%;
[0132] The reaction conditions of b are as follows: 7-amino-4-methylcoumarin (175.18 mg, 1 equivalent), compound 1 (518.79 mg, 1 equivalent), and glacial acetic acid (6 mg, 0.1 equivalent) were weighed, 15 mL of 1,2-dichloroethane was added as the reaction solvent, and the mixture was reacted at 30°C for 24 h (protected from light). After cooling to room temperature, sodium triacetoxyborohydride (635.82 mg, 3 equivalents) was added, and the mixture was reacted at 30°C for 24 h. The mixture was purified by silica gel column chromatography (300-400 mesh) with ethyl acetate:petroleum ether = 10:1 as the eluent, and dried in vacuo to obtain compound 2, weighing 483.28 mg, with a yield of 69.64%;
[0133] The reaction conditions of c are as follows: compound 2 (338.99 mg, 0.5 equivalent) is dissolved in 10 mL of tetrahydrofuran: glacial acetic acid (1:1), and an aqueous solution of NaNO2 (68.99 mg, 1 equivalent) is slowly added dropwise. The reaction is carried out at 37°C for 4 hours. After the reaction is completed, a large amount of water is added to the reaction solution to precipitate the precipitate, which is filtered and dried to obtain the product, which is the CHOL-linked gas-producing functional molecule. The yield is 305.57 mg, and the yield is 90.14%.
[0134] (2) Preparation of mesenchymal stem cell exosomes: Same as Example 2.
[0135] (3) Preparation of exosomes loaded with anti-aging active ingredients:
[0136] Mesenchymal stem cell exosomes and active ingredients (vitamin A, dipeptide snake toxin, equal concentration, volume ratio 5:1) were dissolved in PBS (pH 7.4) and mixed to make the final concentration of exosomes 4×10 7 / mL, the final concentration of the active ingredient is 1 mg / mL, incubated at 4°C for 24 hours, centrifuged at 120,000g for 60 minutes at 4°C, and the precipitate was collected to obtain mesenchymal stem cell exosomes containing anti-aging active ingredients.
[0137] (4) Preparation of exosomes ESNA with spherical nucleic acid structure: siRNA-CHOL and the exosomes loaded with active ingredients obtained in step (3) were dissolved in PBS (pH 7.4) and mixed to make the final concentration of exosomes 4×10 7 The final concentration of siRNA-CHOL was 8 μM, and the cells were incubated at 37°C for 4 h. The cells were purified by centrifugation at 120,000 g for 60 min at 4°C. The precipitated exosomes with spherical nucleic acid structures were collected and resuspended in PBS (pH 7.4) to a final concentration of 4 × 10 7 pieces / mL.
[0138] (5) Preparation of exosome spherical nucleic acid nanomotors NM-ESNA for anti-skin aging:
[0139] a. Preparation of amino plate: Place a 96-well plate under 365nm UV light for 2h, add 0.2% APTES (solvent is anhydrous ethanol) as the amino reagent to each well and react for 4h.
[0140] b. Molecular imprinting: 200 μL of the exosome ESNA with a spherical nucleic acid structure obtained in step (4) was attached to the bottom of an amino-treated 96-well plate as a template molecule. The liquid in the wells was carefully concentrated using a nitrogen blower to ensure that the ESNA settled at the bottom of the well plate. Then, 50 μL of a cross-linker 0.1% TEOS (solvent: anhydrous ethanol) was added to the well plate and reacted at 25°C for 10 h. Then, 50 μL of a functional monomer 0.1% APTES (solvent: anhydrous ethanol) was added and reacted at 25°C for 24 h. APTES and TEOS were used to form an imprinting layer to achieve spatial shielding of the nanocarrier.
[0141] c. Preparation of NM-ESNA: Add CHOL-modified gas-producing functional molecules to the well plate of step b to react with the unshielded side of the exosomal spherical nucleic acid ESNA. The solvent is PBS (pH 7.4). The final concentration of the gas-producing functional molecules is 10 μM and the final concentration of the exosomal spherical nucleic acid ESNA is 4×10 7 / mL, incubate at 25°C for 12 hours, carefully remove the supernatant, add purified water for elution, collect the eluate, centrifuge at 120,000g for 60 minutes at 4°C, and collect the precipitate to obtain exosomes asymmetrically modified with gas-producing functional molecules, namely, exosome spherical nucleic acid nanomotor NM-ESNA with anti-skin aging properties.
[0142] Example 5
[0143] Preparation of an anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA:
[0144] (1) Preparation of CHOL-linked gas-producing functional molecules. The synthesis route and specific reaction conditions are the same as those in Example 1.
[0145] (2) Preparation of mesenchymal stem cell exosomes: Same as Example 2.
[0146] (3) Preparation of exosomes loaded with anti-aging active ingredients:
[0147] Mesenchymal stem cell exosomes and active ingredients (nonapeptide-1, palmitoyl tripeptide-1, equal concentrations, volume ratio 1:1) were dissolved in PBS (pH 7.4) and mixed to make the final concentration of exosomes 6×10 7 / mL, the final concentration of the active ingredient was 4 mg / mL, and the extruder (NanoAble-150, USA) was used to pass through a 200 nm polycarbonate membrane at room temperature (25°C), repeatedly extruded 12 times, and centrifuged at 120,000 g for 60 minutes at 4°C to collect the precipitate to obtain mesenchymal stem cell exosomes containing anti-aging active ingredients.
[0148] (4) Preparation of exosomes ESNA with spherical nucleic acid structure: siRNA-CHOL and the exosomes loaded with active ingredients obtained in step (3) were dissolved in PBS (pH 7.4) and mixed to make the final concentration of exosomes 6×10 7 The final concentration of siRNA-CHOL was 8 μM, and the cells were incubated at 25°C for 24 h. The cells were purified by centrifugation at 120,000 g for 60 min at 4°C. The precipitated exosomes with spherical nucleic acid structures were collected and resuspended in PBS (pH 7.4) to a final concentration of 6 × 10 7 pieces / mL.
[0149] (5) Preparation of exosome spherical nucleic acid nanomotors NM-ESNA for anti-skin aging:
[0150] a. Preparation of amino plate: Place a 96-well plate under 365nm UV light for 2h, add 0.2% APTES (solvent is anhydrous ethanol) as the amino reagent to each well and react for 4h.
[0151] b. Molecular imprinting: 200 μL of the exosome ESNA with a spherical nucleic acid structure obtained in step (4) was attached to the bottom of an amino-treated 96-well plate as a template molecule. The liquid in the wells was carefully concentrated using a nitrogen blower to ensure that the ESNA settled at the bottom of the well plate. Then, 100 μL of a cross-linker 0.1% TEOS (solvent: anhydrous ethanol) was added to the well plate and reacted at 25°C for 8 h. Then, 100 μL of a functional monomer 0.1% APTES (solvent: anhydrous ethanol) was added and reacted at 25°C for 8 h. APTES and TEOS were used to form an imprinting layer to achieve spatial shielding of the nanocarrier.
[0152] c. Preparation of NM-ESNA: Add CHOL-modified gas-producing functional molecules to the well plate of step b to react with the unshielded side of the exosomal spherical nucleic acid ESNA. The solvent is PBS (pH 7.4). The final concentration of the gas-producing functional molecules is 6 μM and the final concentration of the exosomal spherical nucleic acid ESNA is 6×10 7 / mL, incubate at 20°C for 24 hours, carefully remove the supernatant, add purified water for elution, collect the eluate, centrifuge at 120,000g for 60 minutes at 4°C, and collect the precipitate to obtain exosomes asymmetrically modified with gas-producing functional molecules, namely, exosome spherical nucleic acid nanomotor NM-ESNA with anti-skin aging properties.
[0153] Example 6
[0154] Preparation of an anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA:
[0155] (1) Preparation of CHOL-linked gas-producing functional molecules. The synthesis route and specific reaction conditions are the same as those in Example 1.
[0156] (2) Preparation of mesenchymal stem cell exosomes: Same as Example 2.
[0157] (3) Preparation of exosomes loaded with anti-aging active ingredients:
[0158] Mesenchymal stem cell exosomes and active ingredients (vitamin E, nonapeptide-1, equal concentration, volume ratio 4:1) were dissolved in PBS (pH 7.4) and mixed to make the final concentration of exosomes 7×10 7 / mL, the final concentration of the active ingredient is 5 mg / mL, and the extruder is used to pass through a 200 nm polycarbonate membrane at room temperature (25°C), repeatedly extruded 12 times, and centrifuged at 120,000g for 60 minutes at 4°C to collect the precipitate to obtain mesenchymal stem cell exosomes containing anti-aging active ingredients.
[0159] (4) Preparation of exosomes ESNA with spherical nucleic acid structure: siRNA-CHOL and the exosomes loaded with active ingredients obtained in step (3) were dissolved in PBS (pH 7.4) and mixed to make the final concentration of exosomes 7×10 7 The final concentration of siRNA-CHOL was 10 μM, and the cells were incubated at 4°C for 24 h. The cells were purified by centrifugation at 4°C and 120,000 g for 60 min. The precipitated exosomes with spherical nucleic acid structures were collected and resuspended in PBS (pH 7.4) to a final concentration of 7 × 10 7 pieces / mL.
[0160] (5) Preparation of exosome spherical nucleic acid nanomotors NM-ESNA for anti-skin aging:
[0161] a. Preparation of amino plate: Place a 96-well plate under 365nm UV light for 2h, add 0.2% APTES (solvent is anhydrous ethanol) as the amino reagent to each well and react for 4h.
[0162] b. Molecular imprinting: 200 μL of the exosome ESNA with a spherical nucleic acid structure obtained in step (4) was attached to the bottom of an amino-treated 96-well plate as a template molecule. The liquid in the wells was carefully concentrated using a nitrogen blower to ensure that the ESNA settled at the bottom of the well plate. Then, 48 μL of a cross-linker 0.1% TEOS (solvent: anhydrous ethanol) was added to the well plate and reacted at 25°C for 2 h. Then, 36 μL of a functional monomer 0.1% APTES (solvent: anhydrous ethanol) was added and reacted at 25°C for 12 h. APTES and TEOS were used to form an imprinting layer to achieve spatial shielding of the nanocarrier.
[0163] c. Preparation of NM-ESNA: Add CHOL-modified gas-producing functional molecules to the well plate of step b to react with the unshielded side of the exosomal spherical nucleic acid ESNA. The solvent is PBS (pH 7.4). The final concentration of the gas-producing functional molecules is 10 μM and the final concentration of the exosomal spherical nucleic acid ESNA is 7×10 7 / mL, incubate at 4°C for 24 hours, carefully remove the supernatant, add purified water for elution, collect the eluate, centrifuge at 120,000g for 60 minutes at 4°C, and collect the precipitate to obtain exosomes asymmetrically modified with gas-producing functional molecules, namely, exosome spherical nucleic acid nanomotor NM-ESNA with anti-skin aging properties.
[0164] Example 7
[0165] Preparation of an anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA:
[0166] (1) Preparation of CHOL-linked gas-producing functional molecules, as in Example 3.
[0167] (2) Preparation of mesenchymal stem cell exosomes: Same as Example 2.
[0168] (3) Preparation of exosomes loaded with anti-aging active ingredients:
[0169] Mesenchymal stem cell exosomes were mixed with active ingredients (vitamin C, glutathione, equal concentration, volume ratio 3:1) in PBS (pH 7.4) to make the final concentration of exosomes 5×10 7 / mL, the final concentration of the active ingredient was 3 mg / mL. After incubation at 37°C for 1 hour, the extruder (NanoAble 150, USA) was used to pass through a 200 nm polycarbonate membrane at room temperature, repeatedly extruded 12 times, and centrifuged at 120,000 g for 60 minutes at 4°C. The precipitate was collected to obtain mesenchymal stem cell exosomes containing anti-aging active ingredients.
[0170] (4) Preparation of exosomes ESNA with spherical nucleic acid structure: siRNA-CHOL and the exosomes loaded with active ingredients obtained in step (3) were dissolved in PBS (pH 7.4) and mixed to make the final concentration of exosomes 5×10 7 The final concentration of siRNA-CHOL was 20 μM, and the cells were incubated at 25°C for 24 h. The cells were purified by centrifugation at 120,000 g for 60 min at 4°C. The precipitated exosomes with spherical nucleic acid structures were collected and resuspended in PBS (pH 7.4) to a final concentration of 5 × 10 7 pieces / mL.
[0171] (5) Preparation of exosome spherical nucleic acid nanomotors NM-ESNA for anti-skin aging:
[0172] a. Preparation of amino plate: Place a 96-well plate under 365nm UV light for 2h, add 0.2% APTES (solvent is anhydrous ethanol) as the amino reagent to each well and react for 4h.
[0173] b. Molecular imprinting: 200 μL of the exosome ESNA with a spherical nucleic acid structure obtained in step (4) was attached to the bottom of an amino-treated 96-well plate as a template molecule. The liquid in the wells was carefully concentrated using a nitrogen blower to ensure that the ESNA settled at the bottom of the well plate. Then, 64 μL of a cross-linker 0.1% TEOS (solvent: anhydrous ethanol) was added to the well plate and reacted at 37°C for 4 h. Then, 72 μL of a functional monomer 0.1% APTES (solvent: anhydrous ethanol) was added and reacted at 25°C for 20 h. APTES and TEOS were used to form an imprinting layer to achieve spatial shielding of the nanocarrier.
[0174] c. Preparation of NM-ESNA: Add CHOL-modified gas-producing functional molecules to the well plate of step b to react with the unshielded side of the exosomal spherical nucleic acid ESNA. The solvent is PBS (pH 7.4). The final concentration of the gas-producing functional molecules is 15 μM and the final concentration of the exosomal spherical nucleic acid ESNA is 5×10 7 / mL, incubate at 25°C for 24 hours, carefully remove the supernatant, add purified water for elution, collect the eluate, centrifuge at 120,000g for 60 minutes at 4°C, and collect the precipitate to obtain exosomes asymmetrically modified with gas-producing functional molecules, namely, exosome spherical nucleic acid nanomotor NM-ESNA with anti-skin aging properties.
[0175] Comparative Example 1
[0176] This is a single exosome group without any modification. The difference from Example 6 is that the exosomes (7×10 7 / mL) were co-extruded to encapsulate siRNA-CHOL (10μM) at the same concentration as NM-ESNA.
[0177] Comparative Example 2
[0178] The difference from Example 6 is that the combination of the gas-producing functional molecules and siRNA-CHOL with the mesenchymal stem cell exosomes is a simple physical mixing, and the surface of the mesenchymal stem cell exosomes is not modified in any way.
[0179] (1) Preparation of mesenchymal stem cell exosomes: same as Example 6.
[0180] (2) Preparation of exosomes loaded with anti-aging active ingredients: same as Example 6.
[0181] (3) Preparation of a physical mixture of gas-producing functional molecules, siRNA-CHOL, and mesenchymal stem cell exosomes:
[0182] Mesenchymal stem cell exosomes (7×10 7 Physically mix the siRNA-CHOL (10 μM) and the gas-generating functional molecule (10 μM) (the ratio is the same as in Example 6) and pipette gently vortex 5 times to mix evenly. This reagent is prepared before use.
[0183] Comparative Example 3
[0184] The difference from Example 6 is that the modification of the gas-generating functional molecule is a symmetrical modification.
[0185] (1) Preparation of CHOL-linked gas-producing functional molecules, as in Example 6.
[0186] (2) Preparation of mesenchymal stem cell exosomes: same as Example 6.
[0187] (3) Preparation of exosomes loaded with anti-aging active ingredients: same as Example 6.
[0188] (4) Preparation of exosome ESNA with spherical nucleic acid structure: Same as Example 6.
[0189] (5) Preparation of exosomes modified with gas-producing functional molecules:
[0190] The solvent was PBS (pH 7.4), and the final concentration of the gas-producing functional molecules prepared in step (1) (10 μM) and the exosome ESNA with a spherical nucleic acid structure prepared in step (4) (7×10 7 / mL) were mixed, incubated at 4°C for 24h, centrifuged at 120000g for 60min at 4°C, and the precipitate was collected to obtain the exosome spherical nucleic acid nanosystem symmetrically modified with gas-producing functional molecules.
[0191] Test Example 1
[0192] Western blot was used to detect the expression of CD9, CD81 and CD63, the characteristic proteins of the exosomes of mesenchymal stem cells prepared in step (2) of Example 6 and the exosome spherical nucleic acid nanomotor NM-ESNA prepared in step (4). According to the instructions of the kit, a separation gel and a concentrated gel with a concentration of 15% were prepared, and the amount of protein loaded was 30 μL per well. Electrophoresis was performed in Tris buffer at 80V, 20min and 150V, 90min. Then, a 0.45μm PVDF membrane was used for transfer in an ice bath at 200mV for 45min. After blocking with 5% BSA for 2h at room temperature, the primary antibody (dilution ratio 1:1000) was incubated, incubated overnight at 4°C, washed 3 times with TBST, 10min each time, incubated with secondary antibody (dilution ratio 1:5000) at room temperature, washed 3 times with TBST, 10min each time, and developed using ECL chemiluminescent solution. The results are as follows. Figure 3 shown.
[0193] The morphology of the mesenchymal stem cell exosome samples prepared in step (2) of Example 6 and the exosome spherical nucleic acid nanomotor NM-ESNA prepared in step (4) was characterized by transmission electron microscopy. 10 μL of each sample was spotted on a 320-mesh copper mesh, allowed to stand for 10 minutes, and then gently blotted dry with filter paper. Then, 10 μL of 2% phosphotungstic acid was added to the same mesh for staining for 10 minutes. The filter paper was blotted dry and the sample was placed under an electric heating lamp for 1 minute to dry. The morphology of the sample was photographed using a transmission electron microscope. The results are shown in FIG. Figure 4 As shown in the figure, the prepared exosomes have complete morphological structure and clear outline, and the surface modification of the exosomes has no obvious effect on their structure.
[0194] Temperature stability: The mesenchymal stem cell exosome samples prepared in step (2) of Example 6 of the present invention and the exosome spherical nucleic acid nanomotor NM-ESNA prepared in step (4)d were placed at 4°C, 25°C and 37°C, respectively. Samples were taken at 0, 7, 14, 21 and 28 days, and the particle size distribution was measured using a Malvern particle size analyzer to investigate their stability at different temperatures. The results are as follows: Figure 5-Figure 6 As shown in the figure, the particle size of unmodified exosomes increased at 25℃ and 37℃, while the particle size of exosomal spherical nucleic acid nanomotor NM-ESNA did not change significantly at 4℃, 25℃, and 37℃, indicating good stability.
[0195] Test Example 2
[0196] The exosome gas motor prepared in step (4) c of Example 6 was used to characterize the asymmetric modification of the gas-producing functional molecules on the exosomes using a transmission electron microscope. Since the gas-producing functional molecules themselves cannot be observed under a transmission electron microscope, gold nanoparticles with obvious imaging were used instead of the gas-producing functional molecules to modify the exosomes (the CHOL-modified gold nanoparticles AuNP-PEG2000-CHOL were asymmetrically modified in the same manner as in Example 6), which more intuitively presented the modification effect. The results are shown in FIG. Figure 7 As shown, gold nanoparticles are evenly distributed on one side of the exosome membrane, proving that the method of step (4) c of Example 6 can achieve asymmetric modification of the exosome surface.
[0197] Test Example 3
[0198] The formation of the spherical nucleic acid ESNA structure was verified by polyacrylamide gel electrophoresis (SDS-PAGE). 25 μL of the exosome spherical nucleic acid ESNA and free siRNA prepared in step (4) d of Example 6 were taken respectively, and 5 μL of loading buffer was added to each. After mixing evenly, the sample was loaded. The separation gel concentration was 15% (prepared according to the kit method). Electrophoresis was performed at 120V in TBE buffer (89mM Tris (pH7.6), 89mM boric acid, 2mM EDTA) for 90 minutes. The image was then collected and exposed using a luminescence imaging system (Gel EZ Imager). The results are shown in Figure 2. Figure 8 As shown, compared with free siRNA (right band), exosomal spherical nucleic acid ESNA (left band) has a larger overall molecular weight and is therefore slower during electrophoresis. The band is located above the siRNA with a smaller molecular weight, proving the successful modification of siRNA on exosomes, namely the formation of the exosomal spherical nucleic acid ESNA structure.
[0199] Test Example 4
[0200] In this experiment, the MTT method was used to investigate the survival rate of the exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 on human skin keratinocytes and human skin fibroblasts, and to preliminarily evaluate the safety of the exosome spherical nucleic acid nanomotor NM-ESNA. The experimental steps are as follows:
[0201] (a) Seed plate: Cells grown to the logarithmic phase were harvested and seeded into 96-well plates at a density of 6000 cells / well. 100 μL of complete medium was added to each well. Five replicates were set up for each group. The cells were cultured at 37°C with 5% CO2 for 24 h.
[0202] (b) Administration: The culture medium was aspirated and 100 μL of different concentrations (1, 2, 3, 4, 5, 6, 7 × 10 7Cells / mL) of exosome spherical nucleic acid nanomotors NM-ESNA (prepared in Example 6, with DMEM as the solvent) were added. A control group (i.e., a drug-free, live cell group, with DMEM as the solvent) and a zeroing group (i.e., a zeroing well without cells or culture medium, with PBS (pH 7.4) as the solvent) were also set up. The cells were cultured for 24 h at 5% CO2 and 37°C.
[0203] (c) Detection: The culture medium was aspirated and 120 μL of DMEM medium containing 0.5 mg / mL MTT was added to each well. After incubation for 4 h, the supernatant was aspirated and 150 μL of DMSO solution was added to each well. The cells were shaken at 500 rpm for 10 min. The absorbance (A) of each well was measured at 490 nm using a microplate reader.
[0204] (d) The survival rate of cells in each group was calculated according to the following formula:
[0205] Survival rate (%) = (A 加药组 -A 调零组 ) / (A 对照组 -A 调零组 );
[0206] The results are shown in Tables 1 and 2. The exosomal spherical nucleic acid nanomotor NM-ESNA provided in Example 6 does not affect the survival rate of human skin keratinocytes and human skin fibroblasts. On the contrary, it promotes cell proliferation to a certain extent, demonstrating that the exosomal spherical nucleic acid nanomotor NM-ESNA has good safety for human skin keratinocytes and human skin fibroblasts.
[0207] Table 1 Survival rate of human skin keratinocytes
[0208]
[0209] Table 2 Survival rate of human skin fibroblasts
[0210]
[0211] Test Example 5
[0212] Experimental animals: Healthy male ICR mice (20±2 g) were purchased from Nanjing Qinglongshan Animal Farm.
[0213] This study used a Franz transdermal diffusion tester, using Cy3-siRNA-CHOL as a model drug, to preliminarily evaluate the in vitro transdermal efficacy of the exosomal spherical nucleic acid nanomotor NM-ESNA described herein. Twenty-four healthy male ICR mice with intact skin were anesthetized with an intraperitoneal injection of 2% chloral hydrate, and their abdominal hair was removed. After sacrifice, the abdominal skin was peeled, and excess fat was carefully removed. The mice were then stored at -20°C until further use. Exosomal spherical nucleic acid nanomotor NM-ESNA was prepared according to the method in Example 6, with blank PBS (pH 7.4) serving as a blank control. Five experimental groups were set up (exosome spherical nucleic acid nanomotor NM-ESNA, prepared according to the method of Example 6, except that Cy3-siRNA-CHOL was used instead of siRNA-CHOL; a single exosome group, prepared according to the method of Comparative Example 1, except that Cy3-siRNA-CHOL was used instead of siRNA-CHOL; a physical mixture group of exosomes, gas-producing molecules and siRNA-CHOL, prepared according to the method of Comparative Example 2, except that Cy3-siRNA-CHOL was used instead of siRNA-CHOL; an exosome spherical nucleic acid nanosystem symmetrically modified with gas-producing molecules, prepared according to Comparative Example 3, except that Cy3-siRNA-CHOL was used instead of siRNA-CHOL; a free Cy3-siRNA-CHOL group; and a blank control group (PBS (pH 7.4)). The concentration of Cy3-siRNA-CHOL in each group was kept consistent, all at 10 μM.
[0214] After thawing at room temperature, the ex vivo mouse skin was fixed in a Franz diffusion cell with the stratum corneum facing upwards. The drug administration area was 2.2 cm 2 The receiving chamber was filled with 8 mL of enzyme-free PBS (pH 7.4), and 0.2 mL of each preparation was added to the donor chamber. In vitro transdermal experiments were performed at 37°C and 300 rpm. 0.2 mL of samples were taken at 1, 2, 4, 6, 8, 10, and 12 h, and immediately supplemented with an equal volume of fresh blank receiving solution at the same temperature. The cumulative permeation per unit area (Q) over 12 h was measured by a fluorescence spectrophotometer. 12 ). The calculation formula is as follows:
[0215]
[0216] Where C n is the drug concentration at the nth sampling point (pmol / mL), C i is the drug concentration at the i-th sampling point (pmol / mL), A is the effective drug delivery area, and V is the volume of the receiving solution (mL). The calculation results are shown in Table 3.
[0217] Table 3 Transdermal penetration parameters of different groups
[0218]
[0219] Note: Compared with the exosome spherical nucleic acid nanomotor NM-ESNA, * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.
[0220] As shown in Table 3, the Cy3-siRNA-CHOL measured in the blank group skin within 12 hours is almost zero, which eliminates the influence of the skin containing Cy3-siRNA-CHOL itself. Free Cy3-siRNA-CHOL is almost difficult to penetrate the skin, probably because its molecular weight is about 2000Da, which is not suitable for transdermal administration. The permeation rate per unit area of the exosomes alone (Comparative Example 1) within 12 hours is only slightly increased, but the increase is not obvious. After the Cy3-siRNA-CHOL, gas-producing molecules and exosomes are physically mixed (Comparative Example 2), there is no significant difference in the transdermal effect of the exosomes alone. The permeation rate of Comparative Example 3 is significantly increased compared with Comparative Example 1 and Comparative Example 2, proving the effectiveness of gas-producing molecule modification and spherical nucleic acid structure, but it is still not ideal. The exosome spherical nucleic acid nanomotor NM-ESNA constructed by the present invention has the highest cumulative permeation rate per unit area within 12 hours, which is 2.10 times higher than the symmetrically modified group of the gas-producing molecules in Comparative Example 3, proving that the asymmetric modification of the gas-producing molecules is more conducive to the construction of gas motors.
[0221] Therefore, the exosome spherical nucleic acid nanomotor NM-ESNA prepared by the present invention can be used as an efficient penetration-enhancing means and is expected to be used to promote the efficient absorption and utilization of various effective ingredients in the skin.
[0222] Test Example 6
[0223] This experimental example studies the motion behavior of the exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 of the present invention at an oil-water interface and under light irradiation. The research method is as follows:
[0224] Take a 100 mL beaker and add appropriate amounts of edible vegetable oil and purified water respectively. After the oil-water interface is stable, carefully add the exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 of the present invention to the upper oil phase, and record the movement of the nanosystem in the oil-water interface before and after applying light. The results are as follows: Figure 9 As shown, before illumination, the exosome spherical nucleic acid nanomotor NM-ESNA (rose pink) prepared in Example 6 of the present invention mainly stayed in the upper oil phase and could not be transferred to the aqueous phase. After illumination, the nanosystem passed through the upper oil phase and entered the lower aqueous phase, indicating that the exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 of the present invention has excellent motility under illumination.
[0225] Test Example 7
[0226] Experimental animals: 30 healthy male ICR mice (20±2 g) were purchased from Nanjing Qinglongshan Animal Farm.
[0227] This experimental example studies the anti-aging effect of the exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 of the present invention on mouse skin. The research method is as follows:
[0228] 1. Modeling method and grouping:
[0229] (1) Model group: A skin aging model was established by daily UVB irradiation and subcutaneous injection of 5% D-galactose (10 mg / kg) on the back of the neck. The UVB lamp was placed 30 cm above the mice and irradiated 6 times a week for a total of 6 weeks. The radiation dose in the first and second weeks was 60 mJ / cm 2 The radiation dose in the third week was 120 mJ / cm 2 , 180mJ / cm in the 4th week 2 The radiation dose in the 5th and 6th weeks is 240mJ / cm 2 Six weeks after modeling, the rats were kept in normal conditions for two weeks without any drug treatment.
[0230] (2) Exosomes group (Comparative Example 1): After 6 weeks of modeling according to the method of the model group, 100 μL (7×10 7 / mL), apply for 2 weeks.
[0231] (3) Exosomes, gas-producing molecules and siRNA-CHOL physical mixture group (Comparative Example 2): After 6 weeks of modeling according to the method of the model group, exosomes (7×10 7 / mL), 100 μL of the physical mixture of gas-generating molecules (10 μM) and siRNA-CHOL (10 μM) was applied for 2 weeks.
[0232] (4) Exosome spherical nucleic acid nanosystem symmetrically modified with gas-producing molecules (Comparative Example 3): After 6 weeks of modeling according to the method of the model group, 100 μL of the exosome spherical nucleic acid nanosystem symmetrically modified with gas-producing molecules (Comparative Example 2) was applied to the back skin of the mice every day for 2 weeks.
[0233] (5) Exosome spherical nucleic acid nanomotor NM-ESNA: After 6 weeks of modeling according to the method of the model group, 100 μL (7×10 7 / mL), apply for 2 weeks.
[0234] (6) Blank control group: normal daily feeding for 6 weeks + 2 weeks.
[0235] 2. Detection indicators and detection methods:
[0236] (1) Wrinkle assessment: After modeling and drug administration, the wrinkle condition of the mouse back skin was scored using the macro-grade scoring method (see Table 4), with 0 points - normal skin with fine texture, 1 point - fine scratches on the skin; 2 points - a few shallow wrinkles on the skin; 3 points - more shallow wrinkles on the skin; 4 points - rough skin with deep wrinkles; 5 points - more rough wrinkles on the skin; 6 points - rough wrinkles on the skin with local damage. The scoring results are shown in Table 4. The model group mice had obvious rough wrinkles on the back skin, and the skin was rough and lost elasticity. After continuous application of the exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 of the present invention for 2 weeks, the rough wrinkles on the mouse skin surface were significantly improved, and the skin became smooth and elastic overall.
[0237] (2) Determination of transepidermal water loss (TEWL): After modeling and administration, the residual preparation at the administration site was wiped with a cotton swab, and the excess water was absorbed by filter paper. The Vapo Meter (Delfin, Finland) was placed in vertical contact with the administration site to detect the TEWL value at the modeling site. Each site was measured 6 times and the average value was taken. The measurement results are shown in Table 4. The TEWL value is one of the important indicators for detecting the skin barrier function. The higher the TEWL value, the higher the degree of water loss of the skin and the weaker the barrier function of the skin. As can be seen from Table 4, the TEWL value of the model group is significantly higher than the normal value, which proves that the modeling is successful. Although Comparative Examples 1, 2 and 3 can reduce the TEWL value to a certain extent, the repair effect on the skin barrier is obviously not as good as the exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 of the present invention, which shows that the exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 of the present invention has a positive effect on repairing damaged skin barrier, improving skin water loss and delaying skin aging.
[0238] (3) Skin thickness measurement: After modeling and drug administration, mice were killed by dislocating the neck. The skin at the drug administration site on the back of the mice, which had been wiped clean, was peeled off and excess fat was removed. The mice were fixed with 4% paraformaldehyde, routinely dehydrated, embedded, and paraffin sections were prepared. After HE staining, the skin was observed under an optical microscope and photographed. The skin thickness was measured using Case Viewer software. Each location was measured 5 times and the average value was taken. The measurement results are shown in Table 4. The skin in the model group was significantly thickened, which is consistent with the morphological characteristics of the skin after exposure to UVB. The exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 of the present invention can improve the abnormal thickening of the skin caused by UVB irradiation and restore the skin to normal thickness. Comparative Examples 1, 2, and 3 can slightly improve the abnormal thickening of the skin, but the effect is not obvious.
[0239] Table 4 Results of measurement of skin wrinkles, skin thickness and TEWL in mice
[0240]
[0241] Note: Compared with the exosome spherical nucleic acid nanomotor NM-ESNA, * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.
[0242] (4) Detection of collagen-related indicators: After modeling and drug administration, mice were killed by dislocating the neck, and the skin of the drug administration site on the back of the mice was peeled off and wiped clean. Excess fat was removed and minced, and the tissue was mixed in a ratio of tissue mass (g): normal saline (mL) = 1:9. The tissue was homogenized in an ice bath using a tissue homogenizer (frequency 90 Hz, working 5 s, interval 5 s). The supernatant was collected after centrifugation at 4000 rpm for 20 min at 4°C. The contents of collagen-related indicators (type I collagen Col-I, type III collagen Col-III, hydroxyproline Hyp) and matrix metalloproteinase 1 (MMP-1) in the skin tissue were determined according to the instructions of the kit. The determination was repeated three times and the average value was taken. The determination results are shown in Table 5.
[0243] The most obvious feature of skin aging is the reduced synthesis and increased degradation of collagen in the dermis, which in turn causes insufficient support of the dermis and an increase in wrinkles on the skin surface. Type I collagen and type III collagen are the main types of collagen that make up the skin. The main function of MMPs is to degrade collagen and elastin in the dermis. Among them, MMP-1, as a collagenase, is the most important enzyme for degrading type I and type III collagen. It accelerates skin aging by destroying the cross-linking between collagen molecules and the triple helical structure of collagen itself. As shown in Table 5, the exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 of the present invention can increase the content of Col-I, Col-III and Hyp on the one hand, and reduce the expression of MMP-1 on the other hand.
[0244] Table 5 Detection results of mouse skin collagen related indicators
[0245]
[0246] Note: Compared with the exosome spherical nucleic acid nanomotor NM-ESNA, * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.
[0247] (5) Detection of anti-inflammatory related indicators: After modeling and drug administration, mice were killed by dislocation of the neck, and the skin of the drug administration site on the back of the mice was peeled off and wiped clean. Excess fat was removed and minced into pieces according to the ratio of tissue mass (g): physiological saline (mL) = 1:9. The tissue was homogenized in an ice bath using a tissue homogenizer (frequency 90 Hz, working 5s, interval 5s). After centrifugation at 4000 rpm for 20 min at 4°C, the supernatant was collected and the contents of inflammatory factors (TNFα, IL 1β and IL 6) in the skin tissue were determined according to the instructions of the kit. The determination was repeated three times and the average value was taken. The determination results are shown in Table 6. Inflammatory factors in the skin can promote collagen degradation and further accelerate the aging process. As shown in the determination results in Table 6, the exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 of the present invention can significantly reduce the content of inflammatory factors in mouse skin and exert excellent anti-inflammatory effects.
[0248] Table 6 Detection results of inflammatory factor levels in mouse skin tissue
[0249]
[0250]
[0251] Note: Compared with the exosome spherical nucleic acid nanomotor NM-ESNA, * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001.
[0252] (6) Antioxidant index detection: After modeling and drug administration, mice were killed by dislocating the neck, and the skin of the drug administration site on the back of the mice was peeled off and wiped clean. Excess fat was removed and minced, and the tissue was mixed in a ratio of tissue mass (g): normal saline (mL) = 1:9. The tissue was homogenized in an ice bath using a tissue homogenizer (frequency 90 Hz, working 5 s, interval 5 s). After centrifugation at 4000 rpm for 20 min at 4°C, the supernatant was collected and the contents of oxidative stress indicators (superoxide dismutase SOD, catalase CAT, glutathione GSH, malondialdehyde MDA) in the skin tissue were determined according to the instructions of the kit. The determination was repeated 3 times and the average value was taken. The determination results are shown in Table 2. Figure 10-13 .
[0253] Oxidative stress is an important factor in skin aging. The deposition of free radicals caused by increased oxidative stress will accelerate the decomposition of collagen and reduce skin elasticity. SOD and CAT are important antioxidant enzymes in the human body. They play a role in scavenging free radicals in the body, thereby protecting cells from oxidative damage. GSH is a powerful antioxidant that can repair the sulfhydryl groups in damaged proteins and restore the active function of proteins. MDA is a marker product of lipid oxidation and is often used to characterize the oxidative status in the body. Figure 10-13 It can be seen that the exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 of the present invention can increase the activity of antioxidant enzymes SOD and CAT, improve the GSH content, and reduce the production of lipid oxidation product MDA, and has a good antioxidant effect.
[0254] In summary, the exosome spherical nucleic acid nanomotor NM-ESNA prepared in Example 6 of the present invention can effectively improve the skin aging of mice caused by ultraviolet radiation. Its mechanism may be related to reducing skin oxidative damage, increasing collagen content, reducing collagen decomposition, anti-inflammatory and antioxidant effects, and the effect is significant.
Claims
1. An anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA, characterized by: It includes mesenchymal stem cell exosomes, gas-producing functional molecules, siRNA, and anti-aging active ingredients. The siRNA is modified on the surface of the exosomes to form a highly dense nucleic acid layer, that is, a spherical nucleic acid structure; the gas-producing functional molecules are the product formed by the connection of visible light-responsive NO donor molecules and cholesterol. The gas-producing functional molecules are asymmetrically modified on one side of the exosomes to form a gas motor structure; the anti-aging active ingredients are wrapped inside the mesenchymal stem cell exosomes.
2. The anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA according to claim 1, characterized in that: The structure of the gas-producing functional molecule is shown below: The siRNA is linked to cholesterol and modified on the surface of the exosomes, and its sequence is an anti-skin aging target sequence or a skin care target sequence.
3. The anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA according to claim 1, characterized in that: The anti-aging active ingredients include any one of small molecule peptides, bosera, ceramide, hydroxypinacolone retinoate, and vitamins A / C / E, wherein the small molecule peptides preferably include at least one of nonapeptide-1, acetyl hexapeptide-8, dipeptide snake toxins, glutathione, and palmitoyl tripeptide-1.
4. A method for preparing the anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA according to claim 1, characterized in that: The steps include: (1) Extraction and separation of mesenchymal stem cell exosomes: The culture medium of mesenchymal stem cells was collected and the exosomes derived from mesenchymal stem cells were extracted by ultracentrifugation; (2) Preparation of mesenchymal stem cell exosomes loaded with anti-aging active ingredients: reacting the mesenchymal stem cell exosomes prepared in step (1) with the anti-aging active ingredients, and purifying them by ultracentrifugation to obtain mesenchymal stem cell exosomes loaded with anti-aging active ingredients; (3) Preparation of gas-producing functional molecules: NO donor and cholesterol CHOL are connected through condensation reaction, reductive amination reaction, and nitrosation reaction to prepare gas-producing functional molecules; (4) Preparation of exosome ESNA with a spherical nucleic acid structure: The exosomes loaded with active ingredients obtained in step (2) are co-incubated with siRNA-CHOL, and ESNA is obtained after separation and purification; (5) Preparation of exosome-based spherical nucleic acid nanomotor NM-ESNA: Molecular imprinting technology is used to spatially shield one side of the exosome ESNA with a spherical nucleic acid structure obtained in step (4), and the gas-producing functional molecule prepared in step (3) is asymmetrically modified on the unshielded side of the ESNA to construct an exosome spherical nucleic acid nanomotor with anti-skin aging effect.
5. The preparation method according to claim 4, characterized in that The concentration of exosomes in step (2) was 1×10 7 -7×10 7 / mL, the concentration of the anti-aging active ingredient is 0.1-5 mg / mL; the reaction method includes at least one of repeated freeze-thaw cycles, co-extrusion, co-ultrasound, and co-incubation, the reaction temperature is 4-37°C, and the reaction time is 4-24h.
6. The preparation method according to claim 5, characterized in that The method for preparing the gas-generating functional molecule in step (3) comprises the following steps: a. Condensation reaction of p-formylbenzoic acid and cholesterol CHOL to obtain compound 1 b. Reductive amination of 7-amino-4-methylcoumarin with compound 1 to obtain compound 2 c. Reaction of compound 2 with a nitrosating agent to generate compound 3 That is, the gas-producing functional molecule.
7. The preparation method according to claim 6, characterized in that The condensation reagent in step a includes DMAP (4-dimethylaminopyridine), EDCI (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride) or DCCI (dicyclohexylcarbodiimide); the reaction solvent includes dichloromethane and / or tetrahydrofuran, the reaction temperature is 25-40°C, and the reaction time is 12-48h; the reaction conditions in step b include: reacting in the presence of light, a catalyst, and a reductive amination agent; wherein the catalyst is glacial acetic acid, and the reductive amination agent is The reagent is at least one of sodium borohydride, sodium triacetoxyborohydride, and sodium cyanoborohydride, the reaction solvent includes 1,2-dichloroethane, tetrahydrofuran, or acetonitrile, the reaction temperature is 30°C-80°C, and the reaction time is 8-24h; in step c, the nitrosating reagent is sodium nitrite (NaNO2) or tert-butyl nitrite (TBN), the reaction solvent includes any one or more of tetrahydrofuran, acetic acid, and acetonitrile, the reaction temperature is 25-80°C, and the reaction time is 0.5-6h.
8. The preparation method according to claim 4, characterized in that The exosome concentration in step (4) is 1×10 7 -7×10 7 / mL, the concentration of the siRNA-CHOL is 0.1-20 μM; the co-incubation reaction temperature is 4-37° C., and the reaction time is 4-24 h.
9. The preparation method according to claim 4, characterized in that The preparation of the anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA in step (5) comprises the following steps: a. Preparation of amino-well plates: After the 96-well plate was exposed to UV light, an amino reagent 3-aminopropyltriethoxysilane (APTES) was added to react to obtain an amino-well plate; b. Molecular imprinting: Exosomes are attached to the bottom of an amino-treated 96-well plate as template molecules. Functional monomer 3-aminotripropylethoxysilane (APTES) and crosslinker tetraethyl orthosilicate (TEOS) are added for cross-linking. The functional monomer and crosslinker form a molecularly imprinted polymer (MIP) on the surface of the template molecules. The thickness of the imprinted MIP layer is controlled by controlling the concentration of the functional monomer and crosslinker, as well as the reaction time and temperature, so that the MIP accumulates on one side of the exosomes, thereby shielding the imprinted side of the exosomes. c. Preparation of anti-skin aging exosome spherical nucleic acid nanomotors NM-ESNA: Add gas-producing functional molecules to the well plate from step b to react with the unmasked side of the exosomes. After the reaction, elute and collect the eluate for ultracentrifugation. The precipitate is the anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA.
10. Use of the anti-skin aging exosome spherical nucleic acid nanomotor NM-ESNA according to claim 1 in the preparation of an anti-skin aging drug or reagent.