Efficient new transcript 5 '-end library building method

Abstract

The invention discloses an efficient new transcript 5'end library building method. According to the present invention, the new RNA transcription start site sequencing technology (NSS-seq) is developed, and the new RNA purification of the RNA-DNA-RNAII compound and the optimized template strand displacement are combined so as to be used for the 5'end capture of the new RNA; the NSS-seq obviously reduces the initial cell quantity required by the experiment, and the research can be carried out even if the biological material is limited. Meanwhile, the experiment method is simplified, so that the experiment can be completed in a standard molecular laboratory within one day. Therefore, the NSS-seq provides a more efficient experimental scheme for the research of the transcription start site of the new transcript.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a library construction method for efficiently capturing the 5' end of a nascent transcript. Background Art

[0002] Transcription is a dynamic process. Traditional RNA sequencing methods can provide a holistic view of transcriptional regulation, but they struggle to capture rapid or transient transcriptional changes and cannot reflect real-time transcriptional activity. Cells can respond rapidly to small molecule perturbations or stress signals, making it difficult to capture rapid transcriptional changes using total RNA. Nascent RNA sequencing addresses this limitation by capturing RNA during synthesis, providing a more powerful tool for studying transcriptional dynamics.

[0003] Due to the low abundance and short half-life of nascent transcripts, capturing nascent RNA faces technical challenges. Current methods for capturing nascent transcripts fall into two categories: metabolic labeling (e.g., SLAM-seq, Bru-seq) and RNA polymerase II (RNAPII)-based enrichment. Metabolic labeling relies on nucleotide analogs incorporated during transcription, but prolonged labeling (several hours) limits temporal resolution and makes it impossible to capture RNA with a short half-life. Methods that utilize RNAPII to enrich nascent transcripts, including GRO-seq, PRO-seq, and NET-seq, can capture the 3′ end of nascent RNA and locate the position of the extending polymerase at single-nucleotide resolution. However, GRO-seq and PRO-seq rely on in vitro transcription extension reactions, which are very sensitive to experimental conditions and polymerase activity. In contrast, native elongating transcript (NET) sequencing technology based on anti-RNAPII antibodies can directly isolate RNA-DNA-RNAPII complexes from chromatin, thereby obtaining transcripts that are being extended, but the variability of antibodies and the efficiency of chromatin purification may reduce the reproducibility of the experiment. Despite this limitation, the inherent stability of the RNA-DNA-RNAPII complex under harsh biochemical conditions (such as high salt, detergents, and urea) provides a solid biochemical basis for the isolation of nascent RNA. This stability ensures that transcripts that are being extended can be stably captured, making the NET-based method the most advantageous method for obtaining nascent transcripts.

[0004] Most RNA-seq methods primarily analyze the 3′ end of transcripts, but this inadequate 3′ end capture requires supplementation with 5′ end capture. Accurate mapping of transcription start sites (TSSs) is crucial for studying promoters and transcriptional regulation. Abnormalities in these sites can lead to various diseases, including cancer and developmental disorders. Existing RNA 5′ end capture methods include oligonucleotide capping, cap analysis of gene expression (CAGE), and template strand displacement, but each faces trade-offs between specificity, input quantity, and technical complexity. GRO-cap and PRO-cap combine transcript extension with oligonucleotide capping, but still suffer from high false-positive rates in intronic regions. CAGE enables single-nucleotide TSS analysis, but requires large RNA input quantities (≥5 μg) and a complex experimental workflow. Template strand displacement reverse transcription (TSRT), widely used in single-cell RNA sequencing, simplifies the 5′ end capture process, but can introduce bias due to primer dimerization and excessive PCR amplification. Improvements in TSO design and experimental workflow optimization have partially alleviated these issues. However, the applicability of this method for the analysis of nascent RNA transcription start sites still needs further verification. Summary of the Invention

[0005] The present invention provides a library construction method for efficiently capturing the 5' end of nascent transcripts. It can quickly, efficiently and inexpensively complete the capture of nascent RNA transcription start sites and library construction, which is of great significance for the dynamic study of transient changes in cell transcription.

[0006] The method for constructing a high-efficiency nascent transcript 5′-end library of the present invention comprises the following specific steps:

[0007] Step 1: Wash the cells with PBS and add nuclease-free water. Place on ice and swell the cells with water. Centrifuge and remove the supernatant to obtain a cell pellet.

[0008] Step 2: Add urea-containing lysis buffer to the cell pellet, lyse on ice, and remove the supernatant by centrifugation to obtain a precipitate. The precipitate at this time is an RNA-DNA complex bound by RNA polymerase.

[0009] Step 3: adding a cleaning solution to the precipitate from step 2 to wash away the urea and detergent in the lysate, and centrifuging to retain the precipitate;

[0010] Step 4: Add DNase to the precipitate from step 3 to digest and remove DNA;

[0011] Step 5: Extract RNA, and the final product is nascent RNA;

[0012] Step 6: Treat the nascent RNA with terminal exonuclease to remove RNA that does not have a 5' end cap and is degrading.

[0013] Step 7: Reverse transcription of the nascent RNA is completed using a reverse transcription primer, and TSO is used for 5' capture and strand displacement to complete the synthesis of double-stranded cDNA;

[0014] In step eight, the double-stranded cDNA is amplified and sequencing primers are added for further amplification to complete the library construction.

[0015] Preferably, the lysis solution in step 2 comprises the following components: 20 mM Tris-HCl, pH 7.5, 2% Triton X-100, 300 mM NaCl, 0.2 mM EDTA, 2 mM DTT, 3 M UREA, 2 mM dithiothreitol (DTT), 1 × PI, 25 μM α-amanitin, and 20 U RNase Inhibitor.

[0016] Preferably, the cleaning solution in step 3 comprises the following ingredients: 10 mM Tris-HCl, pH 7.5, 5% Triton X-100, 150 mM NaCl, 0.05% Dig, 1x PI, 25 μM α-amanitin, and 20 U RNase inhibitor.

[0017] Preferably, the cells are HCT116 cells.

[0018] Preferably, the method for constructing a library of the 5′ end of highly efficient nascent transcripts comprises the following specific steps:

[0019] Step 1: Wash the cells with PBS and add nuclease-free water. Place on ice for 10 minutes to swell the cells. Centrifuge at 3000 g for 5 minutes at 4°C and remove the supernatant to obtain the cell pellet.

[0020] Step 2: Add urea-containing lysis buffer to the cell pellet from step 1, lyse on ice for 10 minutes, centrifuge at 13,000 rpm at 4°C for 10 minutes, and remove the supernatant. The precipitate at this time is the RNA-DNA complex bound by RNA polymerase;

[0021] Step 3: Add cleaning solution to the precipitate from step 2 to wash away urea and detergent in the lysate to avoid affecting subsequent reactions. Centrifuge at 13,000 rpm for 10 minutes at 4°C to retain the precipitate.

[0022] Step 4: Add the precipitate from step 3 to the DNase I reaction system and digest at 37°C and 600 rpm for 1 hour;

[0023] Step 5: Extract RNA, and the final product is nascent RNA;

[0024] Step 6: The nascent RNA was digested with terminal exonuclease to remove the 5'-end cap and the degrading RNA at 30°C for 1 hour.

[0025] Step 7: Reverse transcription of the nascent RNA is completed using a reverse transcription primer, and TSO is used for 5' capture and strand displacement to complete the synthesis of double-stranded cDNA;

[0026] Step 8: Amplify the double-stranded cDNA and add sequencing primers for further amplification to complete library construction;

[0027] The lysis buffer in step 2 comprises: 20 mM Tris-HCl, pH 7.5, 2% Triton X-100, 300 mM NaCl, 0.2 mM EDTA, 2 mM DTT, 3 M UREA, 2 mM dithiothreitol (DTT), 1 × PI, 25 μM α-amanitin, and 20 U RNase Inhibitor.

[0028] The cleaning solution in step 3 comprises: 10 mM Tris-HCl, pH 7.5, 5% Triton X-100, 150 mM NaCl, 0.05% Dig, 1x PI, 25 μM α-amanitin, and 20 U RNase inhibitor;

[0029] The DNase I reaction system is: DNase I 2U / μL 5μL, 10×DNase I Buffer 10μL, RNase Inhibitor 40U / μL 1μL, and H2O 84μL.

[0030] The present invention has developed a nascent RNA transcription start site sequencing technology (NSS-seq), which combines nascent RNA purification from RNA-DNA-RNAII complexes with optimized template strand displacement for capturing the 5′ end of nascent RNA. NSS-seq significantly reduces the amount of cell input required for the experiment, allowing research even with limited biological material. At the same time, due to the simplification of the experimental method, the experiment can be completed within a day in a standard molecular laboratory. Therefore, NSS-seq provides a more efficient experimental solution for the study of the transcription start site of nascent transcripts.

[0031] The beneficial effects of the present invention are as follows:

[0032] (1) The starting amount of samples required for the experiment is greatly reduced, and relatively precious samples or samples with limited materials can also be used for experiments, which broadens the applicability of the experiment.

[0033] (2) It avoids complicated experimental steps, greatly shortens the experimental time and difficulty, and only takes one day to complete the experiment.

[0034] (3) Compared with other methods, our method has higher sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the experimental process of NSS-seq.

[0036] Figure 2 Comparison of RNA capture between NSS-seq and Total RNA-seq. A. RNA captured by NSS-seq contains a high proportion of introns, demonstrating that it captures unspliced, nascent RNA being transcribed. B. RNA captured by Total RNA-seq. Because total RNA is captured, the proportion of introns is very low.

[0037] Figure 3 This is the capture of transcription start sites. A. RNA captured by NSS-seq is primarily enriched at the transcription start site. B. Base usage at positions -1 upstream and +1 downstream of the transcription start site. C. Heatmap of base usage at positions -1 upstream and +1 downstream of the transcription start site. DETAILED DESCRIPTION

[0038] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.

[0039] Example 1:

[0040] An efficient method for constructing a library of the 5' end of nascent transcripts. The overall process of the experimental steps is shown in Figure 1 :

[0041] Step 1: Take 5x10 6 A number of HCT116 cells were washed with PBS, and 1 ml of nuclease-free water was added. The cells were placed on ice for 10 minutes to swell the cells with water. The cells were centrifuged at 3000 g for 5 minutes at 4°C, and the supernatant was removed to obtain a cell pellet.

[0042] Step 2: Add urea-containing lysis buffer to the cell pellet from the previous step, lyse on ice for 10 minutes, centrifuge at 13,000 rpm at 4°C for 10 minutes, and remove the supernatant. The pellet at this time is the RNA-DNA complex bound by RNA polymerase.

[0043] The lysis solution is prepared with the following ingredients: 20 mM Tris-HCl, pH 7.5, 2% Triton X-100 by mass, 300 mM NaCl, 0.2 mM EDTA, 2 mM DTT, 3 M UREA (urea), 1×PI, 25 μM α-amanitin, and 20 μM RNase Inhibitor.

[0044] Step 3: Add cleaning solution to the precipitate from the previous step to wash away urea and detergents in the lysate to avoid affecting subsequent reactions. Centrifuge at 13,000 rpm at 4°C for 10 minutes and retain the precipitate.

[0045] The cleaning solution is prepared with the following ingredients: 10 mM Tris-HCl, pH 7.5, 5% Triton X-100 by mass, 150 mM NaCl, 0.05% Dig by mass, 1x PI, 25 μM α-amanitin, and 20 U RNase inhibitor.

[0046] Step 4: Add the precipitate from the previous step to the DNase I reaction system and digest at 37°C and 600 rpm for 1 hour.

[0047] The DNase I reaction system is: DNase I (2U / μL) 5μL, 10× DNase I Buffer 10μL, RNase Inhibitor (40U / μL) 1μL, H2O 84μL.

[0048] Step 5: Use Qiagen kit to extract RNA, and the final product obtained is nascent RNA.

[0049] Step 6: Use terminal exonuclease to remove the nascent RNA without 5' end caps and the RNA that is degrading. Digest at 30℃ for 1 hour. The reaction system is: TEX enzyme 1μL, 10x TEX buffer A 0.4μL, nascent RNA 2μL, H2O 0.6μL

[0050] Step seven: According to the principle of strand displacement, reverse transcription of the nascent RNA is completed using a reverse transcription primer (primer sequence: TCGGAGATGTGTATAAGAGACAGTCAGATNNNNN), and TSO is used for 5' capture and strand displacement to complete the synthesis of double-stranded cDNA.

[0051] Step eight, amplify the double-stranded cDNA (the upstream primer sequence is: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTGCGCGTACG; the downstream primer sequence is: GTCTCTGGGCTCGGAGATGTGTATAAGAGACAG), add sequencing primers (the upstream primer sequence is: AATGATACGGCGACCA CCGAGATCTACACATGACGCATCGTCGGCAGCGTC; the downstream primer sequence is: CAAGCAGAAG ACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT) and amplify again to complete the library construction.

[0052] The experiment was completed according to the above experimental process (NSS-seq) and sequencing analysis was performed. We compared NSS-seq with traditional Total RNA-seq ( Figure 2 ), NSS-seq can capture more RNA sequences containing introns, proving the ability of NSS-seq to capture uncut and transcribed RNA.

[0053] The enrichment of transcription start sites of nascent RNA captured by NSS-seq was analyzed. The analysis method was as follows: the original sequencing data was first quality controlled and preprocessed, and then aligned to the reference genome. TSS analysis was performed using the CAGEr (v2.8.0) data analysis software package and visualized using the ggplot2 tool. The results are shown in Figure 2. Figure 3 As shown, the nascent transcripts captured by NSS-seq are relatively well enriched at the transcription start site. Furthermore, the base usage at the -1 position upstream and +1 position downstream of the transcription start site is consistent with existing research, further demonstrating the accuracy of the NSS-seq experimental method in capturing the 5' end of nascent RNA.

Claims

1. A method for efficiently building a 5' end library of newly generated transcripts, characterized in that: The specific steps are as follows: Step 1: Wash the cells with PBS and add nuclease-free water. Place on ice and swell the cells with water. Centrifuge and remove the supernatant to obtain a cell pellet. Step 2: Add lysis buffer containing urea to the cell pellet, lyse on ice, and remove the supernatant by centrifugation to obtain a precipitate. The precipitate at this time is an RNA-DNA complex bound by RNA polymerase. Step 3: adding a cleaning solution to the precipitate from step 2 to wash away the urea and detergent in the lysate, and centrifuging to retain the precipitate; Step 4: Add DNase to the precipitate from step 3 to digest and remove DNA; Step 5: Extract RNA, and the final product is nascent RNA; Step 6: Treat the nascent RNA with terminal exonuclease to remove the RNA that does not have a 5' end cap and is degrading. Step 7: Reverse transcription of the nascent RNA is completed using a reverse transcription primer, and TSO is used for 5' capture and strand displacement to complete the synthesis of double-stranded cDNA; In step eight, the double-stranded cDNA is amplified and sequencing primers are added for further amplification to complete the library construction.

2. The method according to claim 1, characterized in that The lysis solution in step 2 comprises the following components: 20 mM Tris-HCl, pH 7.5, 2% Triton X-100, 300 mM NaCl, 0.2 mM EDTA, 2 mM DTT, 3 M UREA, 2 mM dithiothreitol, 1 × PI, 25 μM α-amanitin, and 20 U RNase Inhibitor.

3. The method according to claim 1, characterized in that The cleaning solution in step 3 comprises the following ingredients: 10 mM Tris-HCl, pH 7.5, 5% Triton X-100, 150 mM NaCl, 0.05% Dig, 1x PI, 25 μM α-amanitin, and 20 U RNase inhibitor.

4. The method according to claim 1, wherein The DNA enzyme digestion and removal of DNA, the DNA enzyme I reaction system thereof is: DNase I 2U / μL 5μL, 10×DNase I Buffer 10μL, RNase Inhibitor 40U / μL 1μL, H2O 84μL.

5. The method according to claim 1, 2, 3 or 4, characterized in that The cells are HCT116 cells.

6. The method according to claim 1, characterized in that The method for constructing a 5' end library of efficient nascent transcripts comprises the following specific steps: Step 1: Wash the cells with PBS and add nuclease-free water. Place on ice for 10 minutes to swell the cells. Centrifuge at 3000 g for 5 minutes at 4°C and remove the supernatant to obtain the cell pellet. Step 2: Add urea-containing lysis buffer to the cell pellet from step 1, lyse on ice for 10 minutes, centrifuge at 13,000 rpm at 4°C for 10 minutes, and remove the supernatant. The precipitate at this time is the RNA-DNA complex bound by RNA polymerase; Step 3: Add cleaning solution to the precipitate from step 2 to wash away urea and detergent in the lysate to avoid affecting subsequent reactions. Centrifuge at 13,000 rpm for 10 minutes at 4°C to retain the precipitate. Step 4: Add the precipitate from step 3 to the DNase I reaction system and digest at 37°C and 600 rpm for 1 hour; Step 5: Extract RNA, and the final product is nascent RNA; Step 6: The nascent RNA was digested with terminal exonuclease to remove the 5'-end cap and the degrading RNA at 30°C for 1 hour. Step 7: Reverse transcription of the nascent RNA is completed using a reverse transcription primer, and TSO is used for 5' capture and strand displacement to complete the synthesis of double-stranded cDNA; Step 8: Amplify the double-stranded cDNA and add sequencing primers for further amplification to complete library construction; The lysis buffer in step 2 comprises the following components: 20 mM Tris-HCl, pH 7.5, 2% Triton X-100, 300 mM NaCl, 0.2 mM EDTA, 2 mM DTT, 3 M UREA, 2 mM dithiothreitol, 1 × PI, 25 μM α-amanitin, and 20 U RNase Inhibitor. The cleaning solution in step 3 comprises: 10 mM Tris-HCl, pH 7.5, 5% Triton X-100, 150 mM NaCl, 0.05% Dig, 1x PI, 25 μM α-amanitin, and 20 U RNase inhibitor; The DNase I reaction system is: DNase I 2U / μL 5μL, 10×DNase I Buffer 10μL, RNase Inhibitor 40U / μL 1μL, and H2O 84μL.

Images