LysR type transcriptional regulation factor knockout Gluconobacter sp. And application of Gluconobacter sp. In continuous catalysis of production of DHA (docosahexaenoic acid)

Abstract

The invention discloses a LysR type transcriptional regulatory factor knockout Gluconobacter sp. And application thereof in continuous catalysis of DHA production, and belongs to the technical field of bioengineering. In order to improve the yield of DHA (1, 3-dihydroxyacetone), the expression levels of genes under different fermentation processes of batch fermentation and continuous catalytic perfusion are analyzed and compared through transcriptome, the relationship between the gene expression and the yield of 1, 3-dihydroxyacetone is explored, differential genes in the relationship are analyzed and verified, and it is found that after a LysR type transcriptional regulation factor is knocked out, the expression level of the 1, 3-dihydroxyacetone is analyzed and verified. And the yield of the 2, 3-dihydroxyacetone is obviously improved. After 12 days of continuous catalytic perfusion fermentation production, the cumulative yield of 1, 3-dihydroxyacetone is improved by 41.92% compared with the cumulative yield of 1, 3-dihydroxyacetone of a control strain, and the glycerin conversion rate is improved by 12.58% compared with the glycerin conversion rate of the control strain. Metabolism of Gluconobacter is changed by knocking out a LysR type transcriptional regulation factor, so that synthesis of 1, 3-dihydroxyacetone is influenced.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering, and in particular relates to a method for regulating the synthesis of 1,3-dihydroxyacetone based on a LysR-type transcriptional regulatory factor. Background Art

[0002] 1,3-Dihydroxyacetone (DHA) has broad application prospects in the fields of food, cosmetics, and pharmaceuticals. The commonly used industrial DHA production method mainly uses Gluconobacter oxydans to produce DHA through biocatalysis.

[0003] LysR-type transcriptional regulators (LTTRs) are one of the largest families of transcription factors in prokaryotes and are widely distributed in bacteria, archaea, and algae. They play important roles in bacterial metabolism, physiology, virulence, and stress resistance. Summary of the Invention

[0004] In traditional genetic engineering of bacteria, the synthesis amount of the target product is generally increased by strengthening the target product synthesis pathway, weakening the competing metabolic pathway, optimizing the balance of the cell metabolic network, improving the cell's tolerance to substrates or products, or utilizing adaptive evolution.

[0005] To increase DHA production, the present invention compared gene expression levels under different fermentation processes, such as batch fermentation and continuous catalytic perfusion, through transcriptome analysis, explored the relationship between gene expression and DHA production, and analyzed and verified the differentially expressed genes. It was found that knocking out the LysR-type transcriptional regulatory factor significantly improved DHA production.

[0006] By knocking out the LysR transcriptional regulatory factor in the genome of Gluconobacter, the genetically engineered bacteria constructed in the present invention not only increased the cumulative DHA production to 695.605 g after 12 days of culture in continuous catalytic perfusion fermentation, a 41.92% increase over the cumulative DHA production of the control strain, but also increased the glycerol conversion rate to 80.397%, a 12.58% increase over the glycerol conversion rate of the control strain. Therefore, the LysR transcriptional regulatory factor-knockout Gluconobacter constructed in the present invention has good application prospects in the production of DHA by continuous catalytic perfusion fermentation.

[0007] The present invention uses transcriptome analysis to compare gene expression levels under different fermentation processes, such as batch fermentation and continuous catalytic perfusion, to screen for differentially expressed genes. Furthermore, gene editing technology is used to knock out the genomic LysR-type transcriptional regulatory factor, thereby constructing an engineered strain capable of efficiently synthesizing 1,3-dihydroxyacetone. The nucleotide sequence of the LysR-type transcriptional regulatory factor knocked out in Gluconobacterium spp. is shown in SEQ ID NO. 1:

[0008] gcctcatcctgacggaacagggtgaagttctgaaccggaccgtacgggaagttttctcgaagctggctctgacgcaggctttccttagcgagagcaaggagcgtgcgg ctggaaagatcaagattacgaccacgaccggcttcggcctctcatggctgtccccgcgactgcatcgctttctggaaatgcatcctgatattgaggttacgcttcttc.

[0009] Furthermore, when using the engineered strain to produce 1,3-dihydroxyacetone, the carbon source of the reaction system includes glycerol. Preferably, the fermentation conditions are a temperature of 30°C, a rotation speed of 500-800 rpm, a continuous catalytic perfusion process circulation rate of 100-300 ml / min, and a feed rate and filtrate outflow rate of 2-3 L / day.

[0010] Furthermore, the reaction system includes 50-120 g / L of glycerol and 10-20 g / L of yeast extract.

[0011] The beneficial effects achieved by the present invention are:

[0012] The present invention provides a method for increasing 1,3-dihydroxyacetone production by knocking out a LysR-type transcriptional regulatory factor. The resulting engineered strain can significantly increase 1,3-dihydroxyacetone production. After 12 days of cultivation in continuous catalytic perfusion fermentation, the cumulative 1,3-dihydroxyacetone production increased to 695.605 g, a 41.92% increase over the cumulative 1,3-dihydroxyacetone production of the control strain. The glycerol conversion rate also increased to 80.397%, a 12.58% increase over the glycerol conversion rate of the control strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0014] Figure 1: Principal component analysis plot of transcription data;

[0015] Figure 2 : Comparison of cumulative DHA production and conversion rate by continuous catalytic perfusion fermentation with engineered strain ΔLysR;

[0016] Figure 3 Schematic diagram of the process flow of catalytic perfusion fermentation; 1, glycerol feeding bottle; 2, first peristaltic pump; 3, second peristaltic pump; 4, 1.5L fermentation tank; 5, DHA collection bottle. DETAILED DESCRIPTION

[0017] The preferred embodiments of the present invention are described below with reference to the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0018] Example 1

[0019] Sampling and processing of transcriptomics samples

[0020] The cultured seeds were inoculated into a 1.5 L bioreactor (reactor No. 1) at 5% of the inoculation volume, with a liquid volume of 1 L, and fed-batch fermentation was carried out at 30° C., with substrate glycerol supplemented in batches.

[0021] The DHA concentration was monitored by HPLC. When the concentration reached 60 g / L, the peristaltic pump was turned on to pump half the volume of the fermentation broth in the reactor into another sterilized 1.5 L bioreactor (reactor No. 2) for continuous catalytic perfusion fermentation with a continuous flow of substrate glycerol.

[0022] After 60 hours of fermentation in Reactor 1, samples were collected from Reactors 1 and 2. The samples were centrifuged at 5000 rpm for 5 minutes in sterile, enzyme-free centrifuge tubes to separate the supernatant and bacterial cells. The tubes containing the bacterial cells were frozen in liquid nitrogen for 10 minutes and then stored in a -80°C freezer. The fermentation broth or bacterial cells must be kept under sterile conditions throughout the entire operation. The collected samples were grouped according to Table 1 and sent to a biotechnology company for transcript expression measurement.

[0023] Table 1 Grouping of transcriptomics studies

[0024]

[0025]

[0026] Among them, B represents the sample of batch fermentation, P represents the sample of perfusion fermentation, and B1, B2, B3 and P1, P2, P3 are three biological replicates.

[0027] 2. Transcriptional level sequencing results

[0028] Figure 1 This is a PCA graph, or principal component analysis graph. The PCA graph converts the original correlated variables into linearly independent principal components (PC1, PC2, PC3, etc.) through orthogonal transformation. Each principal component is sorted by the contribution rate of explaining the data variance. In the PCA graph, the distance between samples reflects their similarity. Specifically, if two samples are close in the graph, it means that they are more similar. It can be found that the distance between samples B and P is far away, indicating that the perfusion process has a greater impact on gene expression. It is speculated that the microorganisms in the perfusion adjust their own phenotypes through apparent plasticity to adapt to environmental changes. The perfusion process may achieve continuous and efficient production by affecting genes. This is still a preliminary idea and requires further research.

[0029] To further verify the effect of perfusion process on gene expression, we used gene editing technology to knock out or overexpress LysR-type transcriptional regulatory factors with significant differences and large fold differences for the next step of verification.

[0030] Example 2 Construction of genetically engineered bacteria

[0031] The gene editing method used was based on the literature Zhijie Qin, Shiqin Yu, Li Liu, Lingling Wang, Jian Chen, Jingwen Zhou, A SacB-based system for diverse and multiple genome editing in Gluconobacter oxydans, Journal of Biotechnology, Volume 338, 2021, Pages 31-39. The pk18mob plasmid carries the SacB gene and confers kanamycin sulfate resistance (working concentration: 50 μg / ml).

[0032] The specific steps of this method are as follows:

[0033] 1. Construction of pk18mob plasmid

[0034] The purpose of constructing the plasmid pk18mob is to connect the upper and lower homologous arms of the target gene to the plasmid, and then use homologous recombination to knock out the target gene.

[0035] 1.1 Preparation of upstream and downstream homology arms

[0036] Using primer design software Primer5, with the upstream and downstream sequences of the LysR type transcriptional regulatory factor gene as templates, upstream and downstream homology arm primers were designed (amplification length of about 1000bp) and the upstream and downstream homology arms were amplified respectively by PCR.

[0037] Upstream homology arm sequence:

[0038] atcacggaagcatatctcaagagcggaccggcctcggatggttatttccgtctcaaaggcgattccggtgacgagtatcatgctcggactgtcgtgatcgcaacaggggcacaggccaagtggctgggcctcgagtcggaaaagcggctgcaggctggtggcgtttctgcctgcgcgacctgcgacggcttcttctaccgtggcaaaaccgttgccgtgattggtggaggcaacacggccgtcgaagaggccctgtacctcacacatcatgctgacagggttcatctcattcatcgtcgggatggactgagggcagagcggattttgcaggagcgccttttcgcgaatccgaaaattgaactccactgggatcaggcagttgaagaagttctgggcgcaggctccccggaagtcgtctgcggtgtcaaactcaagaacacccagacaggtgagatctccacacttgcagttgatggtgtgttcgttgccattggccataccccgaatacgggaccattccgccacgaagtggattgcgacgaagacgggtatatcctgaccgaagctggtggaaccgcaacttccgttgagggtgtttttgctgccggcgacattcaggatcgcatttacaggcaggccgtcactgctgccggaaccggttgcatggctgcactggaagcagaacgatatctttctggcatacctgctatgacaaaaacttgaccctcgccccaggttaagacagtttcgtcccttcaacgacacaccgcaaaaataacgccaggtgacatgggcaagaaggacgaagaccgacgcgccagcgatcggggagaccaccacatggactgggacaagctgcgtattttccacgcagtcgctgaagccggatccttcacccatgcgggcgacagactgaatctcagtcagtctgccgtctcgcggcagatttccgcactggaagaagtgttaagggtaccgctgtttcatcggcatgctcgcg。

[0039] Downstream homology arm sequence:

[0040] ttgaagatgcagatctcgatcttggaatgcgtgaagcagatgtggctattcgtctgcatccgcctacgcagcccgatcttgttcagcggcatctcgccaattttcccatgccaatctatgcaagcccggattatctggagcgttacggcacgccgaccaatctgcgggaactggcagaacatcaaatcataggctttgcaggacgccacctgcccttgcccaatgttaactggatgctggatcttttgcggcacgaagggcttgcccatcacggaagccggttggccatcaacaacattgccgctgtagccaacgctatttcatcgggcacgggaattgggtctctgccgctttatactgcggcgtcctactccaacctggttcgcgttctgccagatcagccggttcctctggtggaggcttatttcgtctatccggaagaacttcgtacatccaagagaattgccgtattcagggactttctgctgactgaaatcagcagcctcaaaggacaggaataatcagtccagacgccgtcggctcagccgcggcgtccgtgctccagggtgcaggcgtgctgatctgccgaggaccgaaagacagcctccccaatgggagcaaaactgttggaatgcccaaggtgaccttttcccggactggctttgagaaaaatcagtccagcctgggatcgatagcagggtgcgcctgaactcttctgaagtatcactcgcggcgcgacatacctgctcgtggggtgcacagatttttggatatgggaagacgatgccgcaaaacatggctgcacgaatgtactaacgccaagagccgcccacaggaaaatcattacagagcgcaaggaaatttctctccacatggcggagagaataccctatttgaacgcattccccgcgtccaaataagagcctgccagcaatccttcacgaaatgatgcaaggacagcacaacagagcgctgttcgaggaaacacgccagcgcgtca。

[0041] Table 2 PCR amplification system

[0042]

[0043] The PCR program was as follows: pre-denaturation (95°C) for 30 seconds; then 30 cycles of denaturation (98°C) for 10 seconds, annealing ((Tm+5)°C) for 5 seconds, and extension at 72°C (this enzyme activity extends approximately 1 kb in 5-10 seconds); further extension at 72°C for 1 minute; and maintenance (4°C).

[0044] The PCR product was purified by gel recovery using a gel recovery kit (Vazyme, product number DC301-01).

[0045] 1.2 Preparation of linearized vector

[0046] The vector was linearized by inverse PCR amplification.

[0047] The PCR product was purified by gel recovery using a gel recovery kit (Vazyme, product number DC301-01).

[0048] 1.3 Recombination reaction

[0049] All recombinant enzymes used were enzymes of the ClonExpress Ultra One Step Cloning Kit V3 series, and the recombination conditions were: 50°C, 30 min.

[0050] Table 3 Recombination system

[0051] Reaction system Volume (10 μL) Linearized vector X n insert fragments <![CDATA[Y1+Y2+…+Y n ]]> 2×CE Mix V3 5 <![CDATA[ddH2O]]> to 10

[0052] Note: For multi-fragment homologous recombination reactions, the optimal amount of DNA used is 0.03 pmol of each fragment (including linearized vector) (the molar ratio of vector to insert is 1:1).

[0053] Optimal cloning vector usage = [0.02 × number of cloning vector base pairs] ng (0.03 pmol)

[0054] The optimal amount of each fragment = [0.02 × number of base pairs per fragment] ng (0.03 pmol)

[0055] The amount of vector and each insert fragment is calculated using the formula X / Y. To ensure accurate loading, the linearized vector and insert fragments should be appropriately diluted before preparing the recombination reaction system, and the loading volume of each component should be no less than 1 μl.

[0056] 1.4 Plasmid transformation

[0057] Add 10 μL of the reaction solution to 100 mL of JM109 chemically competent cells. Mix gently, then incubate on ice for 30 minutes. Heat shock the cells at 42°C for 45-90 seconds, then immediately incubate on ice for 2-3 minutes. Add 900 μL of LB liquid medium and resuspend the cells at 37°C for 1 hour. Centrifuge at 8000 rpm for 2 minutes, discard the supernatant, and resuspend the cells in approximately 100 μL. Spread the cells onto a plate containing 50 mg / L kanamycin sulfate, invert the plate, and incubate at 37°C overnight. Once a single colony has grown on the plate, identify the positive recombinants by colony PCR.

[0058] 1.5 Clone identification

[0059] PCR-positive colonies were inoculated into LB medium containing 50 mg / L kanamycin sulfate and cultured overnight. The plasmids were extracted, identified by PCR and enzyme digestion, and sent to Shanghai Biotechnology for sequencing.

[0060] 2. Construction of genetically engineered bacteria

[0061] 2.1 Plasmid electroporation

[0062] After successful plasmid sequencing, the plasmid was electroporated into competent cells of Gluconobacter oxydans. A 100 μL aliquot of competent cells removed from -80°C was thawed on ice for 5 minutes. 5 μL of plasmid was added, mixed, and then placed on ice for 10 minutes. The mixture was then added to a pre-chilled electroporation cuvette with a 1 mm gap. Electroporation was performed using a Bio-Rad MicroPulser at 1.8 kV for 5 ms. Immediately after electroporation, 1 mL of pre-chilled sorbitol liquid medium was added. The cells were incubated at 30°C for 3 hours, then plated onto solid sorbitol plates containing 50 μg / mL kanamycin. After incubation until visible colonies developed, positive colonies were identified by colony PCR and selected.

[0063] 2.2 Screening of mutants

[0064] After successful verification, the correct colony was inoculated into sorbitol liquid medium containing 50 μg / mL kanamycin sulfate and cultured at 30°C. 3 , 10 4 The strain was diluted with sterile water at a ratio of 1:1, and 50 μL of the dilution was then spread onto a sorbitol medium plate containing 5% sucrose and incubated at 30°C. After 2 days, colonies were picked for colony PCR to verify whether the target gene was knocked out. Successfully verified colonies were inoculated into a sorbitol-free liquid medium. After 24 hours of incubation, the genome was extracted for PCR verification and sent to Shanghai Bioengineering for sequencing. The sequencing results were compared with the whole genome. The genetically engineered strain that successfully knocked out the LysR-type transcriptional regulator was named ΔLysR.

[0065] Example 3 Production of 1,3-dihydroxyacetone by continuous catalytic perfusion fermentation of genetically engineered bacteria

[0066] The correctly sequenced genetically engineered bacteria were streaked with a bacterial liquid taken at -80°C on a glycerol solid medium and cultured in a 30°C incubator for 48 hours. A single bacterium was taken and cultured in a 50ml glycerol liquid medium at 30°C shaker at 200rpm for 24 hours, and then transferred once at a 5% inoculation rate. The secondary seeds were inoculated into a 1.5L fermentation tank 4 at a 5% inoculation rate, cultured at a temperature of 30°C and pH 6.0, and the dissolved oxygen was maintained above 30% by changing the agitator speed and aeration rate. When the glycerol concentration in the tank was lower than 10g / L, continuous catalytic perfusion was started, and the feeding rate of the glycerol feeding bottle 1 and the filtrate outflow rate were controlled to maintain the glycerol concentration in the tank at 0-10g / L. Until the strain no longer catalyzes the conversion of glycerol into 1,3-dihydroxyacetone, the wild strain Gluconobacter thailandensis HD924 (the strain disclosed in CN 102391976 A) was fermented using the same method. The flow diagram of the catalytic perfusion fermentation process is shown as follows. Figure 3 As shown. After 12 days of continuous catalytic perfusion fermentation, the cumulative production of 1,3-dihydroxyacetone of the engineered strain ΔLysR increased to 695.605g, a 41.92% increase over the 1,3-dihydroxyacetone production of the wild strain; the glycerol conversion rate increased to 80.397%, a 12.58% increase over the glycerol conversion rate of the control strain. ( Figure 2 ) (Glycerol conversion rate is calculated as the ratio of glycerol converted to 1,3-dihydroxyacetone to the total glycerol consumed)

[0067] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A Gluconobacterium knockout LysR type transcriptional regulatory factor, characterized in that The LysR-type transcriptional regulatory factor is obtained by knocking out the LysR-type transcriptional regulatory factor on the genome of Gluconobacter. The nucleotide sequence of the LysR-type transcriptional regulatory factor is shown in SEQ ID NO.

1.

2. Use of the strain according to claim 1 in the continuous catalytic production of 1,3-dihydroxyacetone.

3. A method for increasing the yield of 1,3-dihydroxyacetone, characterized in that: The production of 1,3-dihydroxyacetone was increased by knocking out the LysR-type transcriptional regulatory factor in the Gluconobacter genome.

4. A method for producing 1,3-dihydroxyacetone by biocatalysis, characterized in that: 1,3-dihydroxyacetone is produced by fermentation using the strain described in claim 1.

5. The method according to claim 4, wherein 1,3-Dihydroxyacetone was produced by fermentation in a continuous catalytic perfusion process system.

6. The method according to claim 4 or 5, characterized in that 1,3-dihydroxyacetone was produced by fermentation in a reaction system using glycerol as a carbon source.

7. The method according to claim 5 or 6, characterized in that The fermentation conditions are as follows: a temperature of 30° C., a rotation speed of 500-800 rpm, a continuous catalytic perfusion process circulation speed of 100-300 ml / min, and a feed rate and a filtrate outflow rate of 2-3 L / Day.

8. The method according to claim 4, wherein The reaction system comprises 50-120 g / L of glycerol and 10-20 g / L of yeast extract.

Images