Application of FveWRKY50 protein and coding gene thereof in regulation and control of plant anthracnose resistance

Abstract

The invention relates to the technical field of gene breeding, in particular to an application of FveWRKY50 protein and a coding gene thereof in regulation and control of plant anthracnose resistance, the FveWRKY50 gene is knocked out from strawberries and overexpressed, it is verified that the strawberry FveWRKY50 gene can negatively regulate and control the anthracnose resistance, and by reducing the expression quantity of the FveWRKY50 protein in plants, the anthracnose resistance of the plants can be negatively regulated and controlled. The anthracnose resistance of plants can be effectively improved. The verification of the anthracnose resistance function of the FveWRKY50 gene provides a new gene target and resource for cultivating anthracnose resistance improving plant varieties, and lays a certain theoretical foundation for researching the anthracnose resistance responding mechanism and the adverse environment resisting molecular mechanism of plants.

Description

Technical Field

[0001] The present invention relates to the technical field of gene breeding, and in particular to application of FveWRKY50 protein and its encoding gene in regulating plant anthracnose resistance. Background Art

[0002] Anthracnose is a major agricultural disease worldwide. Its causative agent, the fungus Colletotrichum spp., can cause significant economic losses to major crops such as corn, rice, and soybeans, as well as major cash crops such as tea, tomatoes, lychees, and strawberries. Strawberry (Fragaria annassa Duch.), a high-value specialty berry, is highly sought after by consumers. Cultivated strawberries primarily propagate via runners, requiring summer seedling cultivation. Anthracnose is highly susceptible to the disease under high temperature and high humidity conditions, and in severe cases, can cause entire greenhouses to die. It is currently the most important seedling disease of cultivated strawberries in my country. Currently, the strawberry industry primarily controls the disease through the application of pesticides, which can easily lead to drug resistance and environmental pollution. Identifying key regulatory genes for strawberry anthracnose resistance and elucidating their molecular mechanisms, and cultivating high-quality strawberry germplasm with high anthracnose resistance through biobreeding techniques such as gene editing, could provide candidate genes and genetic material for the green control of strawberry anthracnose.

[0003] WRKY is an important transcription factor gene family unique to plants, playing an important role in plant growth and development, morphological construction, fruit development and ripening, and response to biotic and abiotic stresses. Currently, there is little research on the regulatory mechanism of strawberry anthracnose resistance and its biological functions during the strawberry-anthracnose interaction. Summary of the Invention

[0004] In view of the deficiencies in the prior art, the present invention aims to provide an application of the FveWRKY50 protein and its encoding gene in regulating plant anthracnose resistance. By knocking out the FveWRKY50 gene in strawberry and overexpressing the FveWRKY50 gene, it was verified that the strawberry FveWRKY50 gene can negatively regulate anthracnose resistance.

[0005] In order to solve the above technical problems, the technical solution provided by the present invention is:

[0006] Application of the FveWRKY50 gene or its encoding protein or biological materials containing its encoding gene in regulating plant anthracnose resistance,

[0007] The nucleotide sequence of the FveWRKY50 gene is any one of the following:

[0008] A1) the nucleotide sequence shown in SEQ ID NO. 1;

[0009] A2) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO. 1 and the nucleotide sequence expresses a protein with the same function.

[0010] Preferably, the amino acid sequence of the FveWRKY50 protein is any one of the following:

[0011] B1) the sequence shown in SEQ ID NO. 2;

[0012] B2) A protein sequence having the same biological function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the sequence shown in SEQ ID NO. 2.

[0013] Preferably, the biological material is any one of the following C1) to C7):

[0014] C1) The nucleic acid molecule according to claim 1;

[0015] C2) an expression cassette containing the nuclear FveWRKY50 nucleic acid molecule described in C1);

[0016] C3) a recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2);

[0017] C4) a recombinant microorganism containing the nucleic acid molecule described in C1), or a recombinant microorganism containing the expression cassette described in C2), or a recombinant microorganism containing the recombinant vector described in C3);

[0018] C5) a transgenic plant cell line containing the nucleic acid molecule of C1), or a transgenic plant cell line containing the expression cassette of C2), or a transgenic plant cell line containing the recombinant vector of C3);

[0019] C6) transgenic plant tissue containing the nucleic acid molecule described in C1), or transgenic plant tissue containing the expression cassette described in C2), or transgenic plant tissue containing the recombinant vector described in C3);

[0020] C7) A transgenic plant organ containing the nucleic acid molecule described in C1), or a transgenic plant organ containing the expression cassette described in C2), or a transgenic plant organ containing the recombinant vector described in C3).

[0021] Preferably, the regulation is negative regulation, which improves the anthracnose resistance of the plant by inhibiting or reducing the expression level or activity of the FveWRKY50 gene or FveWRKY50 protein in the plant.

[0022] The nucleotide sequences of the primers for amplifying the FveWRKY50 gene are shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10.

[0023] The present invention also provides a method for improving plant anthracnose resistance.

[0024] Improving plant anthracnose resistance by inhibiting or reducing the expression level or activity of the FveWRKY50 gene or FveWRKY50 protein in the plant;

[0025] The nucleotide sequence of the FveWRKY50 gene is any one of the following:

[0026] A1) the nucleotide sequence shown in SEQ ID NO. 1;

[0027] A2) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO. 1 and the nucleotide sequence expresses a protein with the same function.

[0028] Preferably, the plant is strawberry.

[0029] The present invention also provides a method for increasing strawberry yield.

[0030] Increasing strawberry yield by inhibiting or reducing the expression or activity of the FveWRKY50 gene or FveWRKY50 protein in plants;

[0031] The nucleotide sequence of the FveWRKY50 gene is any one of the following:

[0032] A1) the nucleotide sequence shown in SEQ ID NO. 1;

[0033] A2) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO. 1 and the nucleotide sequence expresses a protein with the same function.

[0034] Preferably, the expression level of the FveWRKY50 gene in the plant is reduced by gene knockout technology, and the target sequence is shown as SEQ ID NO.5 and SEQ ID NO.6.

[0035] The present invention also provides a strawberry anthracnose-resistant FveWRKY50 gene mutant material, characterized in that:

[0036] The mutant material is: the nucleotide sequence of its FveWRKY50 gene is shown in SEQ ID NO.1, which lacks 5 bases from 18 to 22 bp, and the other chromosome lacks 114 bases from 18 to 131 bp;

[0037] Alternatively, the mutant material is: the two chromosomal nucleotide sequences of its FveWRKY50 gene are the sequence shown in SEQ ID NO. 1, but 5 bases in total, bp 18-22 are missing.

[0038] The beneficial effects of the present invention are:

[0039] The present invention provides the use of the FveWRKY50 protein and its encoding gene in regulating plant anthracnose resistance. By knocking out the FveWRKY50 gene in strawberry, it was determined that the mutant had a significantly improved anthracnose resistance phenotype, verifying that the strawberry FveWRKY50 gene can negatively regulate anthracnose resistance. This provides new gene targets and resources for breeding plant varieties with improved anthracnose resistance, and lays a certain theoretical foundation for studying the mechanisms of plant response to anthracnose resistance and the molecular mechanisms of resistance to adverse environments. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0041] Figure 1 This is the pYLCRISPR / Cas9Pubi-H vector map

[0042] Figure 2 Expression analysis of strawberry FveWRKY50 in response to Colletotrichum

[0043] Figure 3 Phenotypes of WT and FveWRKY50-CR plants

[0044] Figure 4 Phenotype of WT and FveWRKY50-CR plants after crown and leaves were inoculated with anthracnose

[0045] Figure 5 Phenotype of WT and FveWRKY50-CR plants after inoculation with anthracnose DETAILED DESCRIPTION

[0046] The following describes preferred embodiments of the present invention in conjunction with the accompanying drawings. It should be understood that the following embodiments are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0047] The quantitative experiments in the following examples were repeated three times unless otherwise specified. The strawberry variety di Bosco in the following examples was obtained from THE HEIRLOOM SEED STORE. The pYLCRISPR / Cas9Pubi-H plasmid in the following examples was kindly provided by the research group of Professor Liu Yaoguang of South China Agricultural University (recorded in: Zeng Dongchang, Ma Xingliang, Xie Xianrong, Zhu Qinlong, Liu Yaoguang. Methods for constructing plant CRISPR / Cas9 multi-gene editing vectors and performing mutation analysis [J]. Chinese Science: Life Sciences, 2018, 48(07): 783-794). The AtU6-29 plasmid in the following examples was kindly provided by the research group of Professor Liu Yaoguang of South China Agricultural University (recorded in: Zeng Dongchang, Ma Xingliang, Xie Xianrong, Zhu Qinlong, Liu Yaoguang. Methods for constructing plant CRISPR / Cas9 multi-gene editing vectors and performing mutation analysis [J]. Chinese Science: Life Sciences, 2018, 48(07): 783-794). The vector pDONR221 and the plant expression vector pH7WG2D in the following examples were preserved in our laboratory and have been described in: Mao W, Han Y, Chen Y, Sun M, Feng Q, Li L, Liu L, Zhang K, Wei L, Han Z, Li B. Low temperature inhibits anthocyanin accumulation in strawberry fruit by activating FvMAPK3-induced phosphorylation of FvMYB10 and degradation of Chalcone Synthase 1. Plant Cell. 2022 Mar 29; 34(4): 1226-1249).

[0048] The nucleotide sequence of the FveWRKY50 gene in the strawberry variety 'di Bosco' is shown in SEQ ID NO.1, the gene number is FvH4_6g53770, and it consists of 642 bases. The amino acid sequence of the FveWRKY50 protein is shown in SEQ ID NO.2, and it consists of 213 amino acid residues.

[0049] Example 1 Expression Analysis of Strawberry FveWRKY50 in Response to Anthrax

[0050] The diploid forest strawberry 'di Bosco' and the octoploid cultivated strawberry 'Benihoppe' were used as experimental materials. The seedlings (S), mature leaves (ML), crowns (C) and fruits (Fruit, F) of the experimental materials were inoculated with anthracnose fungus (Colletotrichum gloeosporioides, Cg). The control (CK) was treated with the same dose of deionized water. Total RNA was extracted from the plant materials and real-time fluorescence quantitative PCR (qRT-PCR) was used to analyze the response characteristics of FveWRKY50 to anthracnose fungus.

[0051] like Figure 2 As shown, compared with the control treatment (CK), the expression levels of FveWRKY50 in the seedlings, leaves, shortened stems and fruits of diploid forest strawberry 'di Bosco' and octoploid cultivated strawberry 'Benihoppe' were significantly upregulated after anthracnose inoculation (Cg), indicating that FveWRKY50 significantly responded to anthracnose infection.

[0052] The specific test steps are as follows:

[0053] 1. Anthrax inoculation treatment

[0054] The strain used was Colletotrichum fructicola, a member of the Colletotrichum gloeosporioides complex, the main pathogenic strain of strawberry anthracnose in my country. It was kindly donated by Professor Gao Qinghua's research group at the Shanghai Academy of Agricultural Sciences. 7 cfu / mL spore suspension was dropped on the surface of leaves or crowns at the same dose; in addition, a concentration of 3×10 6 cfu / mL of spore suspension, the same dose of spore suspension was dropped on the surface of the fruit and cultured at 28 ° C and 100% relative humidity.

[0055] 2. Strawberry Total RNA Extraction and Reverse Transcription

[0056] Omega's plant RNA extraction kit is used to extract total RNA from strawberries:

[0057] 1) Grind the sample using a high-throughput grinder and aliquot into RNase-free 2 mL centrifuge tubes.

[0058] 2) Mix RCL Lysis Buffer, Plant Extraction Agent, and Mercaptoethanol in a ratio of 50:7:1. Add 580 μL of this mixture to the sample. Mix thoroughly and heat evenly at 65°C for 2-3 minutes. Repeat this process 3-4 times.

[0059] 3) Centrifuge at 12,000 rpm for 12 minutes. Remove the supernatant and add it to a DNA adsorption column. Centrifuge at 12,000 rpm for 1 minute. Discard the adsorption column and retain the supernatant to remove the DNA.

[0060] 4) Mix the supernatant and RCB in a 1:1 ratio to obtain RNA precipitation.

[0061] 5) Transfer all the liquid mixed with RNA precipitate to the RNA collection column, centrifuge at 12000 rpm for 1 min, centrifuge again at 12000 rpm, and transfer to a new collection tube.

[0062] 6) Add 500 μL RWF, centrifuge at 12,000 rpm for 1 min, and discard the filtrate to remove impurities such as protein.

[0063] 7) Add 500 μL of Buffer II to the center of the RNA collection column, centrifuge at 12,000 rpm for 1 min, discard the filtrate, and repeat this process once to remove impurities such as polysaccharides.

[0064] 8) Centrifuge at 13000 rpm for 3 min to dry the RNA.

[0065] 9) Place the RNA collection column in an RNase-free 1.5 mL centrifuge tube, add 36 μL of DEPC water (preheated at 65°C) to the center of the collection column, let it stand at room temperature for 2 minutes, and centrifuge at 8000 rpm for 1 minute. The collected filtrate is the final tissue total RNA sample.

[0066] 10) Detect RNA concentration using Nanodrop.

[0067] cDNA synthesis

[0068] 1) Set up the reaction system on ice

[0069]

[0070] 2) Reaction procedure: Mix thoroughly and centrifuge immediately; 55°C, 5 min; 85°C, 5 min; 4°C, ∞; After the reaction, place on ice or store at -20°C.

[0071] 3. qRT-RCR test

[0072] 1) Reaction system

[0073]

[0074] 2) Reaction procedure

[0075]

[0076] FveWRKY50 qRT-PCR detection primers are as follows:

[0077] FveWRKY50-qRT-F: 5'-CGAATATGGGAAGCCCTCAA-3' (SEQ ID NO.3) FveWRKY50-qRT-R: 5'-TAACAGCAAGTTGTCTCCCGC-3' (SEQ ID NO.4)

[0078] Example 2 Construction of the recombinant vector FveWRKY50-CR and acquisition of transformed strawberry plants

[0079] 1. Construction of recombinant vector FveWRKY50-CR

[0080] 1) Target design. Design the target site of the FveWRKY50 gene at http: / / crispr.hzau.edu.cn / CRISPR / and synthesize primers for vector construction.

[0081] Using pYLCRISPR / Cas9Pubi-H as a plant expression vector, the reverse complementary sequence at positions 15-34 of SEQ ID NO. 1 in the CDS sequence of FveWRKY50 was selected as a target (target 1, target sequence: 5'-AATGTTCTTCCCCGGATCAT-3' SEQ ID NO. 5) for primer design and vector construction; the sequence at positions 115-134 of SEQ ID NO. 1 was selected as a target (target 2, target sequence: 5'-AGCAGCGGTACTGCCAACTATGG-3' SEQ ID NO. 6) for primer design and vector construction:

[0082] The primer sequences are as follows:

[0083] FveWRKY50-CR-T1-F: 5'-ATGATCCGGGGAAGAACATTgttttagagctagaaat-3' (SEQ IDNO.7)

[0084] FveWRKY50-CR-T1-R:5'-AATGTTCTTCCCCGGATCATCaatcactacttcgtct-3'(SEQ IDNO.8)

[0085] FveWRKY50-CR-T2-F:5'-AGCAGCGGTACTGCCAACTAgttttagagctagaaat-3'(SEQ IDNO.9)

[0086] FveWRKY50-CR-T2-R:5'-TAGTTGGCAGTACCGCTGCTCaatctcttagtcgact-3'(SEQ IDNO.10)

[0087] 2) Construction of sgRNA expression cassette. Using sgRNA as template, the corresponding target (U#T# / gRT#) and linker

[0088] (UF / gR-R) were used as primers to prepare a PCR reaction system. The system is shown in Table 1 below.

[0089] Table 1 PCR reaction system for constructing sgRNA expression cassette

[0090]

[0091] The PCR reaction conditions were: 98°C for 30 s; 98°C for 10 s, 56°C for 5 s, 72°C for 10 s, 32 cycles; 72°C for 1 min.

[0092] The PCR product was recovered using Tiangen's agarose gel recovery kit. Using the recovered product as a template, a second round of PCR amplification was performed using primers Pps-GGL, Pgs-GG2, Pps-GG2, and Pgs-GGR. The system was the same as above, followed by electrophoresis detection and recovery. The primer sequences are as follows:

[0093] Pps-GGL: 5'-TTCAGAGGTCTCCTCGACTAGTATGGAATCGGCAGCA AAGG-3' (SEQ IDNO.11)

[0094] Pgs-GG2: 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3' (SEQ ID NO.12)

[0095] Pps-GG2: 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3' (SEQ ID NO.13)

[0096] Pgs-GGR: 5'-AGCGTGGGTCTCGACCGACGCGTATCCATCCACTCCAAG CTC-3' (SEQ IDNO.14)

[0097] 3) Assemble the sgRNA expression cassette from step 2) into the pYLCRISPR / Cas9Pubi-H vector (referred to as the pYLCRISPR / Cas9 vector). Use the Golden Gate method to connect the sgRNA expression cassette to the expression vector. The system is shown in Table 2 below.

[0098] Table 2 Ligation reaction system

[0099]

[0100] PCR reaction conditions were: 37°C for 5 min, 10°C for 5 min, 20°C for 5 min, 20 cycles, 37°C for 5 min;

[0101] 4) The PCR reaction product was transformed into DH5α competent E. coli cells using the heat shock method. The transformation method was as follows: the gel-recovered product was added to 50 μL of DH5α competent E. coli cells, incubated on ice for 30 min, heat-shocked at 42°C for 45 s, and immediately cooled on ice for 2 min. 500 μL of antibiotic-free LB was added, and the cells were shaken at 37°C at 180 rpm for 40 min. The cells were collected by centrifugation at 5000 rpm for 5 min. The cells were resuspended and spread onto LB solid medium containing 50 mg / L kanamycin using a spreader. The cells were cultured at 37°C overnight. A single colony was picked and transferred to LB liquid medium containing 50 mg / L kanamycin and cultured in a shaking incubator at 37°C for 6-8 h. The bacterial culture was identified by PCR using primers SP-L1: 5'-GCGGTGTCATCTATGTTACTAG-3' (SEQ ID NO. 15) and SP-R: 5'-TGCAATAACTTCGTATAGGCT-3' (SEQ ID NO. 16). Positive clones were selected for sequencing. The positive bacteria were recombinant Escherichia coli DH5α / FveWRKY50-CR containing the recombinant vector FveWRKY50-CR. The positive clones that were sequenced correctly were cultured in shake flasks, and the plasmids were extracted using a plasmid extraction kit to obtain the recombinant vector FveWRKY50-CR.

[0102] 2. Construction of recombinant vector FveWRKY50-OE

[0103] Primers were designed based on the coding region sequence of the FveWRKY50 gene, and the cDNA obtained by reverse transcription was used as a template. The primer sequences and amplification system are as follows:

[0104] The primer sequences are as follows:

[0105] Upstream primer AttB1: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGGAAAACAACCAAATGTTCTTCC-3' (SEQ ID NO. 17)

[0106] Downstream primer AttB2: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTGACCTAGCTGGCCTGTGTGATTT-3' (SEQ ID NO. 18)

[0107] PCR system (total volume 25 μL): Q5 Buffer 5 μL, dNTP (2.5 mM) 2.5 μL, upstream primer 1.25 μL, downstream primer 1.25 μL, cDNA 2 μL, ddH2O 12.75 μL, Q5 enzyme 0.25 μL.

[0108] PCR reaction conditions were as follows: 98°C for 3 min; 98°C for 10 s, 55°C for 15 s, 72°C for 1 min / kb, 33 cycles; 72°C for 2 min.

[0109] Take 2.5 μL of PCR product, 1 μL of pDONR221, 1 μL of TE buffer, and BP Clonase TM 0.5 μL of II was used for BP reaction in a PCR instrument at 25°C for 1 hour. 1 μL of Proteinase K was added and the reaction was terminated at 37°C for 10 minutes. The reaction product was transformed into competent E. coli DH5α and cultured at 37°C to produce plaques. Colony PCR was performed to identify the positive clones.

[0110] The pDONR221-FveWRKY50 vector was successfully obtained and the sequenced pDONR221-FveJAZ5 was combined with the final expression vector pH7WG2D vector (see the vector schematic diagram for details). Figure 1 ) for LR reaction, the reaction system is: expression vector pH7WG2D 1μL, pDONR221-FveWRKY50 2.5μL, TE buffer 1μL, LR Clonase TM II 0.5 μL.

[0111] The reaction was allowed to proceed in a PCR instrument at 25°C for 1 hour. 1 μL of Proteinase K was added and the reaction was terminated by incubation at 37°C for 10 minutes. The exchange product was transformed into competent E. coli DH5α and cultured at 37°C until plaques grew. Colony PCR was then performed to identify positive bacterial cultures, yielding the recombinant vector FveWRKY50-OE.

[0112] 2. Obtaining transgenic strawberry plants

[0113] 1) Obtaining recombinant Agrobacterium EHA105 / FveWRKY50-CR and EHA105 / FveWRKY50-OE

[0114] The recombinant vectors FveWRKY50-CR and FveWRKY50-OE were transformed into competent Agrobacterium EHA105 (Shanghai Weidi Biotechnology Co., Ltd.) using the following method: 5 μg of plasmid was added to 50 μL of EHA105 competent Agrobacterium medium, mixed, and placed on ice for 5 minutes. The cells were then quickly frozen in liquid nitrogen for 5 minutes and then incubated in a 37°C water bath for 5 minutes. The cells were then added to 700 μL of resistance-free LB liquid medium and cultured with shaking at 180 rpm at 28°C for 4 hours. The cells were then centrifuged at 5000 rpm for 5 minutes, the supernatant discarded, and the remaining 100 μL of cells were resuspended and plated on plates containing 25 mg / L rifampicin and 50 mg / L kanamycin. The cells were then cultured at 28°C for 2 days. Single colonies were picked and shaken for bacterial liquid PCR identification using SP-L and SP-R primers. The PCR product size of the positive clone was 1000bp (i.e., the length of two sgRNA expression cassettes). Recombinant Agrobacterium EHA105 / FveWRKY50-CR, which was successfully transformed with the FveWRKY50 gene knockout recombinant vector FveWRKY50-CR, and recombinant Agrobacterium EHA105 / FveWRKY50-OE, which was successfully transformed with the FveWRKY50 gene overexpression recombinant vector FveWRKY50-OE, were obtained.

[0115] 2) Stable genetic transformation of diploid strawberry

[0116] Preparation and activation of infection culture: The EHA105 / FveWRKY50-CR or EHA105 / FveWRKY50-OE culture was centrifuged at 5000 rpm for 10 min, and MS activation solution (solvent: water, solute and its content: MS 4.4 g / L, sucrose 30 g / L, 1 M NaOH to adjust the pH to 5.8, sterilize at high temperature and high pressure, and add acetosyringone to a final concentration of 100-200 μM before use) was added to suspend the bacteria to an OD value of 0.4-0.6, and placed in a shaker at 28°C for activation for 40 min.

[0117] Di Bosco strawberry seeds were sterilized with 75% anhydrous ethanol and 1% NaClO and then spotted onto 1 / 2 MS culture medium. After being protected from light for 4-7 days, they were cultured in a constant temperature and humidity tissue culture room with a 12 / 12 h photoperiod, a temperature of 24°C, and a humidity of 45%. Diploid strawberry tissue culture seedlings were obtained after 40-50 days of culture.

[0118] Explant infection (leaf disc method): During the activation period, plant material was cut as explants. Take 50-60 day old strawberry diploid variety di Bosco (hereinafter referred to as wild-type strawberry, WT) tissue culture seedlings, cut their young leaves and petioles, cut them into appropriate sizes, and place them in MS activation solution. After cutting a sufficient number of explants, add the activated bacterial solution, and then place them in a 50ml syringe and evacuate until the leaves are water-soaked.

[0119] Explant culture: After infection, the explants were transferred to co-cultivation medium (solvent: water, solutes and their contents: MS 4.4 g / L, sucrose 30 g / L, agar powder 7 g / L, 6-BA 0.1 mg / L, 2,4-D 0.01 mg / L, TDZ 2 mg / L, adjusted to pH 5.8 with 1 M NaOH, and sterilized by high temperature and high pressure) and incubated in the dark for 2 days. After dark incubation, the explants were carefully transferred to screening medium (solvent: water, solutes and their contents: MS 4.4 g / L, sucrose 30 g / L, agar powder 7 g / L, 6-BA 0.1 mg / L, 2,4-D 0.01 mg / L, TDZ 2 mg / L, adjusted to pH 5.8 with 1 M NaOH, sterilized by high temperature and high pressure, and then added with Hyg 2 mg / L and Timentin 400 mg / L). After approximately 40 days of culture, shoot clusters emerged.

[0120] Callus rooting: When callus sprouts, transfer to rooting medium (solvent: water, solute and its content: MS 4.4 g / L, sucrose 30 g / L, agar powder 7 g / L, 1 M NaOH to adjust pH to 5.8, high temperature and high pressure sterilization, add Hyg 2 mg / L, Tim 400 mg / L).

[0121] Transplantation of transgenic seedlings: Transplant seedlings with roots 4-5 cm long and well-developed fibrous root systems into soil, carefully remove the root culture medium, and cover with plastic wrap to retain moisture. Remove the plastic wrap after 15 days to obtain transgenic plants containing the recombinant vector FveWRKY50-CR or FveWRKY50-OE to be identified.

[0122] 3. Identification of FveWRKY50 transgenic editing lines

[0123] (1) Identification of FveWRKY50-OE transgenic lines

[0124] Total RNA was extracted from leaves of WT and FveWRKY50-OE plants to be tested, and reverse transcription was performed to obtain cDNA according to the relevant steps described above. FveWRKY50 gene expression analysis was performed using FveWRKY50 qRT-PCR detection primers (SEQ NO.3 and SEQ NO.4). FveWRKY50-OE plants with FveWRKY50 expression levels significantly higher than WT were selected as FveWRKY50 overexpressing plants FveWRKY50-OE L1 and FveWRKY50-OE L2 as transgenic materials for subsequent experiments.

[0125] (2) Identification of the FveWRKY50-CR gene-edited strain

[0126] To identify FveWRKY50-CR transgenic plants, extract DNA from leaves of the transgenic strawberry plants FveWRKY50-CR obtained in step 2. PCR detection was performed using genomic DNA as a template. 1) Extract DNA from transgenic plants containing the recombinant vector FveWRKY50-CR and perform PCR detection using the following primers:

[0127] FveWRKY50-CR-JC-F:5'-CGACACCTATCTATCTCCCTCTC-3'(SEQ ID NO.19)

[0128] FveWRKY50-CR-JC-R:5'-CTGGGGAATCTGTTTGCTTTGA-3'(SEQ ID NO.20)

[0129] 2) The PCR stock solution was sent for sequencing. The sequencing results were analyzed using Snap Gene software for peak analysis. The editing method was determined using the MDSDecode website (http: / / skl.scau.edu.cn / dsdecode / ).

[0130] 3) Based on the results of the website combined with software analysis, transgenic strawberry lines with different knockout types of FveWRKY50 were obtained: line 5 and line 6.

[0131] Compared with the wild type WT, the FveWRKY50 gene in the two homologous chromosomes has the following mutations:

[0132] Strain 5:

[0133] A biallelic strain (FveWRKY50-CR-5#) with a deletion of 5 bases (bp 18-22) in the target site 1 of one chromosome, 5'-AATGTTCTTCCCCGGATCAT-3', mutated to 5'-AATTCCCCGGATCAT-3'.

[0134] In another chromosome, the 18th to 131th base pair of the sequence shown in SEQ ID NO. 1 was deleted between target sites 1 and 2, resulting in a total of 114 base pairs (FveWRKY50-CR-5#).

[0135] 5'–AATGTTCTTCCCCGGATCATCATCAGCTTCATCCTCTTCGTCAATG GCGGCTTTTTCATCACCGAATATGGGAAGCCCTCAAGTACTACTTTACAGT AGCAGCGGTACTGCCAACTATGG-3', mutated to 5'–AATCTATGG-3'.

[0136] Strain 6:

[0137] The homozygous strain (FveWRKY50-CR-6#) deleted 5 bases (bp 18-22) in the sequence shown in SEQ ID NO. 1 at both chromosome target sites 1, 5'-AATGTTCTTCCCCGGATCAT-3', and mutated to 5'-AATTCCCCGGATCAT-3'.

[0138] like Figure 3 As shown, compared with WT, the two gene-edited mutant lines FveWRKY50-CR L5 and FveWRKY50-CR L6 had no obvious differences in plant size and vegetative growth stage, indicating that FveWRKY50-CR L5 and FveWRKY50-CRL5 had no obvious adverse phenotypes in the vegetative growth stage.

[0139] Example 3 Analysis of Anthracnose Resistance of WT, FveWRKY50-OE, and FveWRKY50-CR

[0140] The wild type (WT), FveWRKY50 overexpression (FveWRKY50-OE) and FveWRKY50 gene editing mutant (FveWRKY50-CR) were used as experimental materials. The leaves and crowns of the plants were examined. Figure 4 ) and fruit ( Figure 5 ) were inoculated with anthracnose bacteria. The strain used was Colletotrichum fructicola, a member of the Colletotrichum gloeosporioides complex, the main pathogenic strain of strawberry anthracnose in my country. After the Colletotrichum fructicola grew to mature spores, a concentration of 1×10 7 cfu / mL spore suspension was dropped on the surface of leaves or crowns at the same dose; in addition, a concentration of 3×10 6 The same dose of spore suspension was dripped onto the fruit surface. Culture and phenotypic observation were performed at 28°C and 100% relative humidity. The anthracnose incidence of different materials was analyzed by counting the lesion area using ImageJ software.

[0141] like Figure 4As shown in the figure, after the leaves of WT, FveWRKY50-OE and FveWRKY50-CR plants were inoculated with anthracnose, the phenotypes were observed and the lesion area was counted 10 days after inoculation. It was found that compared with WT, the lesion area of ​​the leaves of FveWRKY50-OE plants after inoculation with anthracnose was significantly larger than that of WT, while the lesion area of ​​the leaves of FveWRKY50-CR plants was significantly lower than that of WT ( Figure 4 A and 4B).

[0142] The crowns of WT, FveWRKY50-OE, and FveWRKY50-CR plants were inoculated with anthracnose. The petiole mortality rate (%) = number of withered and dead petioles / total number of petioles was used as an indicator. It was found that 7 days after anthracnose inoculation, the petiole mortality rate of FveWRKY50-OE was significantly higher than that of WT, while the petiole mortality rate of FveWRKY50-CR was significantly lower than that of WT. Figure 4 C and 4D)

[0143] The detached leaves of WT, FveWRKY50-OE and FveWRKY50-CR were inoculated with anthracnose. Five days after treatment, the lesion area of ​​FveWRKY50-OE was significantly larger than that of WT, while the lesion area of ​​FveWRKY50-CR was significantly smaller than that of WT. Figure 4 E and 4F).

[0144] like Figure 5 As shown in the figure, red-ripe fruits of WT, FveWRKY50-OE and FveWRKY50-CR were inoculated with Colletotrichum jinxinxin. The lesion area was counted 7 days after inoculation and it was found that the lesion area of ​​FveWRKY50-OE fruits was significantly larger than that of WT, while the lesion area of ​​FveWRKY50-CR fruits was significantly smaller than that of WT.

[0145] The above results indicate that mutation of the FveWRKY50 gene can significantly improve the anthracnose resistance of strawberry plants at the seedling and fruiting stages, and that the FveWRKY50 protein and its encoding gene play a negative regulatory role in the regulation of anthracnose resistance in strawberry plants.

[0146] The contents not described in detail in this specification belong to the prior art known to those skilled in the art.

[0147] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. Use of the FveWRKY50 gene or its encoded protein or a biological material containing the encoding gene thereof in regulating plant anthracnose resistance, characterized in that: The nucleotide sequence of the FveWRKY50 gene is any one of the following: A1) the nucleotide sequence shown in SEQ ID NO. 1; A2) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO. 1 and the nucleotide sequence expresses a protein with the same function.

2. The use according to claim 1, characterized in that The amino acid sequence of the FveWRKY50 protein is any one of the following: B1) the sequence shown in SEQ ID NO. 2; B2) A protein sequence having the same biological function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the sequence shown in SEQ ID NO.

2.

3. The use according to claim 1, characterized in that The biological material is any one of the following C1) to C7): C1) The nucleic acid molecule according to claim 1; C2) an expression cassette containing the nuclear FveWRKY50 nucleic acid molecule described in C1); C3) a recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2); C4) a recombinant microorganism containing the nucleic acid molecule described in C1), or a recombinant microorganism containing the expression cassette described in C2), or a recombinant microorganism containing the recombinant vector described in C3); C5) a transgenic plant cell line containing the nucleic acid molecule of C1), or a transgenic plant cell line containing the expression cassette of C2), or a transgenic plant cell line containing the recombinant vector of C3); C6) transgenic plant tissue containing the nucleic acid molecule described in C1), or transgenic plant tissue containing the expression cassette described in C2), or transgenic plant tissue containing the recombinant vector described in C3); C7) A transgenic plant organ containing the nucleic acid molecule described in C1), or a transgenic plant organ containing the expression cassette described in C2), or a transgenic plant organ containing the recombinant vector described in C3).

4. The use according to claim 1, characterized in that The regulation is negative regulation, which improves the anthracnose resistance of the plant by inhibiting or reducing the expression level or activity of the FveWRKY50 gene or FveWRKY50 protein in the plant.

5. The nucleotide sequences of the primers for amplifying the FveWRKY50 gene are shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.

10.

6. A method for improving plant anthracnose resistance, characterized in that: Improving plant anthracnose resistance by inhibiting or reducing the expression level or activity of the FveWRKY50 gene or FveWRKY50 protein in the plant; The nucleotide sequence of the FveWRKY50 gene is any one of the following: A1) the nucleotide sequence shown in SEQ ID NO. 1; A2) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO. 1 and the nucleotide sequence expresses a protein with the same function.

7. The use according to any one of claims 1 to 6, characterized in that The plant is strawberry.

8. A method for increasing strawberry yield, characterized in that: Increasing strawberry yield by inhibiting or reducing the expression or activity of the FveWRKY50 gene or FveWRKY50 protein in plants; The nucleotide sequence of the FveWRKY50 gene is any one of the following: A1) the nucleotide sequence shown in SEQ ID NO. 1; A2) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO. 1 and the nucleotide sequence expresses a protein with the same function.

9. The method according to claim 6 or 8, characterized in that The expression level of FveWRKY50 protein in plants is reduced by gene knockout technology, and the target sequence is shown as SEQ ID NO.5 and SEQ ID NO.

6.

10. A strawberry anthracnose-resistant FveWRKY50 gene mutant material, characterized in that: The mutant material has a nucleotide sequence of the FveWRKY50 gene as shown in SEQ ID NO. 1, wherein one chromosome is missing 5 bases from 18 to 22 bp, and the other chromosome is missing 114 bases from 18 to 131 bp. Alternatively, the mutant material is: the nucleotide sequence of its FveWRKY50 gene is the sequence shown in SEQ ID NO.1, and both chromosomes are missing 18-22 bp, a total of 5 bases.

Images