Universal epegRNA eukaryotic expression skeleton vector as well as construction method and application thereof

Abstract

The invention discloses a universal epegRNA eukaryotic expression skeleton vector as well as a construction method and application thereof, and belongs to the technical field of gene engineering. The vector is an annular vector and comprises a pronucleus replication starting point, an ampicillin resistance gene, a U6 promoter, sgRNAscaffold, a 3'structural motif tevopreQ1, a TTTTTTT terminator, a BbsI restriction enzyme site, an LguI restriction enzyme site, an Mva1269I restriction enzyme site, an NheI restriction enzyme site and an MunI restriction enzyme site. In a eukaryotic cell, the U6 promoter is responsible for starting transcription of epegRNA, and the TTTTTTT terminator is responsible for terminating transcription. The vector can be conveniently inserted into a spacer sequence of epegRNA after being subjected to BbsI enzyme digestion, and then can be conveniently inserted into RTT and PBS sequences of the epegRNA after being subjected to LguI and Mva1269I double enzyme digestion. The universal skeleton vector is especially suitable for constructing eukaryotic expression vectors of different epegRNAs in batches, the cost of synthesizing DNA sequences in vitro is saved, the operation is simple, and the operation can be carried out by mastering a simple molecular cloning technology.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and in particular relates to a universal epegRNA eukaryotic expression skeleton vector and a construction method and application thereof. Background Art

[0002] Prime editing (PE) is a novel gene editing technology developed by David R. Liu's team in 2019. It can precisely insert, delete, replace, and mutate any of twelve bases at targeted DNA sites without generating DSBs (double-strand DNA breaks) and without requiring an additional donor DNA template (Anzalone et al., 2019). PE technology requires the use of prime editing guide RNA (pegRNA) to achieve precise gene editing. Unlike traditional sgRNA, pegRNA can target specific DNA sequences and contain a template for precise editing. To maintain the stability of pegRNA in cells and prevent degradation of its 3' end, David R. Liu's team modified pegRNA by adding the RNA structural motif tevopreQ1 to its 3' end. The modified pegRNA is called epegRNA (engineered pegRNA). Compared with pegRNA, epegRNA can increase gene editing efficiency by 1.5-4 times (Nelson et al., 2022).

[0003] From the 5' end to the 3' end, the epegRNA consists of a spacer, a sgRNA scaffold (consistent with traditional sgRNAs), an RTT (reverse transcription template), a PBS (primer-binding site), and the tevopreQ1 structural motif at the 3' end. While the scaffold and tevopreQ1 sequences are identical across different epegRNAs, the spacer, RTT, and PBS are distinct sequences.

[0004] Currently, there are no epegRNA eukaryotic expression backbone vectors that simultaneously contain the U6 promoter, sgRNA scaffold, 3' structural motif tevopreQ1, and TTTTTTT terminator. Construction of an epegRNA eukaryotic expression vector requires the synthesis of the epegRNA spacer, scaffold, RTT-PBS, and tevopreQ1 sequences from a commercial company. Furthermore, the vector construction process requires advanced molecular manipulation techniques and is relatively cumbersome. Summary of the Invention

[0005] The purpose of the present invention is to provide a universal eukaryotic expression backbone vector for simplifying the process of constructing an epegRNA eukaryotic expression vector.

[0006] To achieve the above objectives, as a first aspect, the present invention provides a universal epegRNA eukaryotic expression backbone vector, which contains, from the 5' end to the 3' end, a prokaryotic replication origin, an ampicillin resistance gene, a U6 promoter, a sgRNA scaffold, a 3' structural motif tevopreQ1, a TTTTTTT terminator, and BbsⅠ, LguⅠ, Mva1269Ⅰ, NheⅠ, and MunⅠ restriction endonuclease sites, wherein the BbsⅠ site is located between the U6 promoter and the sgRNA scaffold, the NheⅠ site is located between the ampicillin resistance gene and the U6 promoter, and the LguⅠ, MunⅠ, and Mva1269Ⅰ sites are located between the sgRNA scaffold and the 3' structural motif tevopreQ1, named epegRNA vector. After this vector is digested with BbsⅠ, the spacer sequence of epegRNA can be conveniently inserted, and then after double digestion with LguⅠ and Mva1269Ⅰ, the RTT and PBS sequences of epegRNA can be conveniently inserted. The U6 promoter is used to strongly initiate the transcription of epegRNA, and the TTTTTTT terminator is used to terminate transcription.

[0007] In addition, the scaffold sequence of the traditional sgRNA is shown in SEQ ID NO.1:

[0008] 5'-G TTTT AGAGCTAGAAATAGCAA

[0009] GTT AAAA TAAGGCTAGTCCGTTATCAACTTGAAAAGTGGCACCGAGTCGGTG C-3' (76nt).

[0010] The four consecutive Ts are easily mistaken by cells as the transcription terminator of the U6 promoter and easily form a hairpin structure with four consecutive A residues. David R. Liu's team and other teams have found that by changing a few bases to transform the traditional sgRNA scaffold into a "flip and extension" (F+E) sgRNA scaffold, the sequence of four consecutive Ts in the traditional sgRNA scaffold is destroyed, and one of the hairpin structures is extended, which can enhance the activity of Cas9 and improve PE efficiency (Nelson et al., 2022; Petri et al., 2022).

[0011] The sequence of the sgRNA F+E scaffold is shown in SEQ ID NO. 2:

[0012] 5'-G TTT GAGAGCTATGCTGGAAACAGCATAGCAAGTT C AAA TAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3'

[0013] (86nt).

[0014] The nucleotide sequence of the epegRNA eukaryotic expression backbone vector using the sgRNA scaffold from the U6 promoter to the TTTTTTT terminator is shown in SEQ ID NO.4.

[0015] Therefore, as a second aspect, the present invention also provides a universal epegRNA eukaryotic expression backbone vector epegRNA F+E vector containing a prokaryotic replication origin, an ampicillin resistance gene, a U6 promoter, an sgRNA F+E scaffold, a 3' structural motif tevopreQ1, a TTTTTTT terminator, and BbsⅠ, LguⅠ, Mva1269Ⅰ, NheⅠ and MunⅠ restriction endonuclease sites.

[0016] The only difference between epegRNA vector and epegRNA F+E vector is the sgRNA scaffold; the other sequences are completely identical.

[0017] The nucleotide sequence of the epegRNA eukaryotic expression backbone vector using the sgRNA F+E scaffold from the U6 promoter to the TTTTTTT terminator is shown in SEQ ID NO.5.

[0018] Furthermore, the universal epegRNA eukaryotic expression backbone vector of the first aspect and the second aspect comprises the RNA 3' structural motif tevopreQ1 or mpknot; the tevopreQ1 sequence is shown as SEQ ID NO.3.

[0019] As a third aspect, the present invention provides a method for constructing a universal epegRNA eukaryotic expression backbone vector epegRNAvector, comprising the following steps:

[0020] Step (a): Using the pU6-tevopreq1-GG-acceptor vector as a template, amplify the vector backbone including tevopreQ1. The PCR product is: protective base-MunⅠ-Mva1269Ⅰ-tevopreQ1-vector backbone-NheⅠ-protective base.

[0021] Step (b): Using the PX461 vector as a template, amplify the U6 promoter + two BbsⅠ sites

[0022] +sgRNA scaffold, the PCR product is: protective base-NheⅠ-(U6 promoter+2 BbsⅠ sites+sgRNA scaffold)-LguⅠ-MunⅠ-protective base.

[0023] Step (c): The PCR products in steps (a) and (b) are double-digested with NheⅠ and MunⅠ, respectively, and then ligated to obtain the universal eukaryotic expression backbone vector epegRNA vector.

[0024] As a fourth aspect, the present invention also provides a method for constructing a universal epegRNA eukaryotic expression backbone vector epegRNA F+E vector, comprising the following steps:

[0025] Step (d): Using the pU6-tevopreq1-GG-acceptor vector as a template, amplify the vector backbone including tevopreQ1. The PCR product is: protective base-MunⅠ-Mva1269Ⅰ-tevopreQ1-vector backbone-NheⅠ-protective base.

[0026] Step (e): Using the PX461 vector as a template, amplify the U6 promoter + 2 BbsⅠ sites. The PCR product is: protective base-NheⅠ-U6 promoter + 2 BbsⅠ sites.

[0027] Step (f): Synthesize a single-stranded DNA oligonucleotide sequence containing two BbsⅠ sites-(F+E sgRNA scaffold).

[0028] Step (g): The PCR product of step (e) is subjected to fusion PCR with the single-stranded DNA sequence synthesized in step (f). The obtained PCR product is: protective base-NheⅠ-[U6 promoter+2 BbsⅠ sites+(F+E sgRNA scaffold)]-LguⅠ-MunⅠ-protective base.

[0029] Step (h): The PCR products in steps (d) and (g) are double-digested with NheⅠ and MunⅠ, respectively, and then ligated to obtain the universal eukaryotic expression backbone vector epegRNA F+E vector.

[0030] Furthermore, the present invention successfully constructed multiple eukaryotic expression vectors for epegRNA using the constructed universal eukaryotic expression backbone vector epegRNA F+Evector. The steps are as follows:

[0031] Step (i): Synthesize the top and bottom strands of the epegRNA spacer, anneal them, and ligate them to the epegRNA F+E vector digested with BbsⅠ.

[0032] Step (j): synthesize the top and bottom chains of epegRNA RTT-PBS, anneal them, and connect them to the vector constructed in step (i) by double digestion with LguⅠ and Mva1269Ⅰ.

[0033] The present invention has the following beneficial effects:

[0034] The present invention provides universal eukaryotic expression backbone vectors of epegRNA, epegRNA vector and epegRNA F+E vector, which are suitable for batch construction of eukaryotic expression vectors of epegRNA, saving the cost of synthesizing DNA sequences in vitro, and are extremely simple and convenient to operate with a high success rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Flowchart for the construction of the universal epegRNA eukaryotic expression backbone vector epegRNA vector provided in Example 1 of the present invention;

[0036] Figure 2 Flow chart for the construction of the universal epegRNA eukaryotic expression backbone vector epegRNA F+Evector provided in Example 2 of the present invention;

[0037] Figure 3 Schematic diagram of double enzyme digestion with LguⅠ and Mva1269Ⅰ of the universal epegRNA eukaryotic expression backbone vector provided in Example 3 of the present invention. DETAILED DESCRIPTION

[0038] To provide a clearer understanding of the present invention, the following detailed description is provided in conjunction with specific embodiments. It should be understood that the embodiments described herein are only a portion of the present invention, not all of the present invention. All other embodiments derived by persons of ordinary skill in the art based on the embodiments herein without inventive effort are intended to fall within the scope of protection of the present invention.

[0039] The following examples are only used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0040] The PX461 vector used in the following examples was purchased from Addgene, catalog number 48140; the pU6-tevopreq1-GG-acceptor vector was purchased from Addgene, catalog number 174038; primer synthesis was performed by Shanghai Bioengineering; sequence determination was performed by Hangzhou Qingke Biotechnology Co., Ltd.; high-fidelity PCR enzyme PrimeSTAR Max, PCR product recovery and purification kit, T4 DNA ligase, Escherichia coli DH5α competent cells, and plasmid mini-preparation kit were all purchased from TaKaRa; restriction endonucleases BbsⅠ, LguⅠ, Mva1269Ⅰ, NheⅠ, and MunⅠ were all purchased from Thermo Fisher.

[0041] Unless otherwise specified in the following examples, the experimental methods are all conventional molecular manipulation experimental methods.

[0042] Example 1 Construction of a universal epegRNA eukaryotic expression backbone vector epegRNA vector

[0043] Vector construction flow chart Figure 1 The specific operations are as follows:

[0044] ① Using the pU6-tevopreq1-GG-acceptor vector as a template, amplify the vector backbone including tevopreQ1. The PCR product is: protective base-MunⅠ-Mva1269Ⅰ-tevopreQ1-vector backbone-NheⅠ-protective base. The primers used are:

[0045] tevopreQ1-F (SEQ ID NO.6):

[0046] agc CAATTG GAATGCGCGGTTCTATCTAGTTACG;

[0047] In the sequence, the underlined sites (positions 4-9) are Mun I sites, and positions 10-16 are Mva1269 I sites.

[0048] AmpR (SEQ ID NO. 7): cta GCTAGC GACGTCAGGTGGC;

[0049] In the sequence, the underlined sites (positions 4-9) are NheI sites.

[0050] The PCR reaction system is shown in Table 1.

[0051] Table 1 Example 1 Step ① PCR reaction system

[0052] Reagents Volume (μL) pU6-tevopreq1-GG-acceptor vector (1 ng / μL) 1 Upstream primer tevopreQ1-F (10 μM) 1 Downstream primer AmpR (10 μM) 1 PrimeSTAR Max Premix (2×) 25 <![CDATA[ddH2O]]> 22 Total volume 50

[0053] The PCR reaction conditions were as follows: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, and extension at 72°C for 20 s, for a total of 35 cycles; and final extension at 72°C for 5 min.

[0054] The PCR product was recovered using a DNA recovery and purification kit according to the instructions.

[0055] ②Using the PX461 vector as a template, amplify the U6 promoter + 2 BbsⅠ sites + sgRNA scaffold. The PCR product is: protective base-NheⅠ-(U6 promoter + 2 BbsⅠ sites + sgRNA scaffold)-LguⅠ-MunⅠ-protective base. The primers used are:

[0056] U6F (SEQ ID NO. 8): cta GCTAGC GAGGGCCTATTTCCCATGATT;

[0057] In the sequence, the underlined sites (positions 4-9) are NheI sites.

[0058] scaffoldR (SEQ ID NO.9):

[0059] ttc CAATTG GCTCTTCAGCACCGACTCGGTGCCAC;

[0060] In the sequence, the underlined sites (positions 4-9) are Mun I sites, and positions 10-20 are Lgu I sites.

[0061] The PCR reaction system is shown in Table 2.

[0062] Table 2 Example 1 Step ② PCR reaction system

[0063] Reagents Volume (μL) PX461 vector (1 ng / μL) 1 Upstream primer U6F (10 μM) 1 Downstream primer scaffoldR (10 μM) 1 PrimeSTAR Max Premix (2×) 25 <![CDATA[ddH2O]]> 22 Total volume 50

[0064] The PCR reaction conditions were as follows: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, and extension at 72°C for 5 s, for a total of 35 cycles; and final extension at 72°C for 5 min.

[0065] The PCR product was recovered using a DNA recovery and purification kit according to the instructions.

[0066] ③PCR products ① and ② were double-digested with NheⅠ and MunⅠ, respectively, and then ligated. The ligation products were then transformed into Escherichia coli DH5α competent cells using conventional methods and plated. After culturing overnight at 37°C, single colonies were picked and shaken. After small-scale plasmid extraction, the vector with the correct sequencing result was the universal eukaryotic expression backbone vector epegRNA vector.

[0067] Example 2 Construction of a universal epegRNA eukaryotic expression backbone vector epegRNA F+E vector

[0068] Vector construction flow chart Figure 2 The specific operations are as follows:

[0069] ① Using the pU6-tevopreq1-GG-acceptor vector as a template, amplify the vector backbone including tevopreQ1. The PCR product is: protective base-MunⅠ-Mva1269Ⅰ-tevopreQ1-vector backbone-NheⅠ-protective base. The primers used are:

[0070] tevopreQ1-F (SEQ ID NO.6):

[0071] agc CAATTG GAATGCGCGGTTCTATCTAGTTACG;

[0072] In the sequence, the underlined sites (positions 4-9) are Mun I sites, and positions 10-16 are Mva1269 I sites.

[0073] AmpR (SEQ ID NO. 7): cta GCTAGC GACGTCAGGTGGC;

[0074] In the sequence, the underlined sites (positions 4-9) are NheI sites.

[0075] The PCR reaction system is shown in Table 3.

[0076] Table 3 Example 2 Step ① PCR reaction system

[0077] Reagents Volume (μL) pU6-tevopreq1-GG-acceptor vector (1 ng / μL) 1 Upstream primer tevopreQ1-F (10 μM) 1 Downstream primer AmpR (10 μM) 1 PrimeSTAR Max Premix (2×) 25 <![CDATA[ddH2O]]> 22 Total volume 50

[0078] The PCR reaction conditions were as follows: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, and extension at 72°C for 20 s, for a total of 35 cycles; and final extension at 72°C for 5 min.

[0079] The PCR product was recovered using a DNA recovery and purification kit according to the instructions.

[0080] ② Using the PX461 vector as a template, amplify the U6 promoter + two BbsⅠ sites. The PCR product is: protective base-NheⅠ-U6 promoter + two BbsⅠ sites. The primers used are:

[0081] U6F (SEQ ID NO. 8): cta GCTAGC GAGGGCCTATTTCCCATGATT;

[0082] In the sequence, the underlined sites (positions 4-9) are NheI sites.

[0083] U6R (SEQ ID NO. 10): TAGCTCTCAAAC AGGTCTTCTCGAAGACC;

[0084] In the sequence, the underlined sequence (positions 1-12) is the 5' end sequence of the F+E sgRNA scaffold.

[0085] The PCR reaction system is shown in Table 4.

[0086] Table 4 Example 2 Step ② PCR reaction system

[0087] Reagents Volume (μL) PX461 vector (1 ng / μL) 1 Upstream primer U6F (10 μM) 1 Downstream primer U6R (10 μM) 1 PrimeSTAR Max Premix (2×) 25 <![CDATA[ddH2O]]> 22 Total volume 50

[0088] The PCR reaction conditions were as follows: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, and extension at 72°C for 5 s, for a total of 35 cycles; and final extension at 72°C for 5 min.

[0089] The PCR product was recovered using a DNA recovery and purification kit according to the instructions.

[0090] ③Synthesize a single-stranded DNA containing two BbsⅠ sites-(F+E sgRNA scaffold), the synthetic sequence is (SEQ ID NO.11):

[0091] GAAACACCGGGTCTTCGAGAAGACCT GTTTGAGAGCTATGCTGGAAACAGCATAGCAAGTTCAAATAA GGCTAGTCCGTTATCAACTTGAAAAGTGGCACCGAGTCGGTGC ;

[0092] In the sequence, the underlined sequence (positions 27-112) is the F+E sgRNA scaffold, and positions 10-38 are the reverse complementary sequence to U6R in ②.

[0093] ④PCR product ② was combined with the sequence synthesized in ③ for fusion PCR. The resulting PCR product was: Protective base-NheⅠ-[U6 promoter+2 BbsⅠ sites+(F+E sgRNA scaffold)]-LguⅠ-MunⅠ-Protective base. The primers used were:

[0094] U6F (SEQ ID NO. 8): cta GCTAGC GAGGGCCTATTTCCCATGATT;

[0095] In the sequence, the underlined sites (positions 4-9) are NheI sites.

[0096] scaffoldR (SEQ ID NO.9):

[0097] ttc CAATTG GCTCTTCAGCACCGACTCGGTGCCAC;

[0098] In the sequence, the underlined sites (positions 4-9) are Mun I sites, and positions 10-20 are Lgu I sites.

[0099] The PCR reaction system is shown in Table 5.

[0100] Table 5 Example 2 Step ④ PCR reaction system

[0101] Reagents Volume (μL) PCR product ② (40 ng / μL) 1 Sequence synthesized in ③ (10μM) 0.3 Upstream primer U6F (10 μM) 1 Downstream primer scaffoldR (10 μM) 1 PrimeSTAR Max Premix (2×) 25 <![CDATA[ddH2O]]> 21.7 Total volume 50

[0102] The PCR reaction conditions were as follows: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, and extension at 72°C for 5 s, for a total of 35 cycles; and final extension at 72°C for 5 min.

[0103] The PCR product was recovered using a DNA recovery and purification kit according to the instructions.

[0104] ⑤PCR products ① and ④ were double-digested with NheⅠ and MunⅠ respectively and then ligated. The ligation products were then transformed into Escherichia coli DH5α competent cells using conventional methods and plated. After culturing overnight at 37°C, single colonies were picked and shaken. After small-scale plasmid extraction, the vector with the correct sequencing result was the universal eukaryotic expression backbone vector epegRNA F+E vector.

[0105] Example 3 Construction of a eukaryotic expression vector for epegRNA using the universal epegRNA eukaryotic expression backbone vector epegRNA F+E vector

[0106] The present invention uses the constructed epegRNA eukaryotic expression backbone vector epegRNA F+E vector to construct multiple eukaryotic expression vectors of different epegRNAs. This example selects one of them for detailed introduction to demonstrate the convenience and efficiency of vector construction.

[0107] The eukaryotic expression vector of epegRNA was constructed using the epegRNA F+E vector. The insertion of its spacer sequence was consistent with the traditional sgRNA spacer insertion method, which has become a routine operation and will not be described in detail here.

[0108] After inserting the spacer sequence, it is necessary to further connect the RTT-PBS sequence of epegRNA between the sgRNA scaffold and the 3' structural motif tevopreQ1. The epegRNA eukaryotic expression backbone vectors epegRNAvector and epegRNA F+E vector provided by the present invention have LguⅠ, MunⅠ and Mva1269Ⅰ connected between the sgRNA scaffold and the 3' structural motif tevopreQ1. The double enzyme digestion results of LguⅠ and Mva1269Ⅰ are as follows: Figure 3 When synthesizing the RTT-PBS top strand of epegRNA, TGC needs to be added to the 5' end and CG needs to be added to the 3' end.

[0109] RTT-PBS top(SEQ ID NO.12):5'- TGC GACCAACATGTTTAAAAGCCTCAAAAACCATTGAAACTGGCAGGGAAG C G -3'

[0110] RTT-PBS bottom (SEQ ID NO.13): 5'-CTTCCCTGCCAGTTTCCAATGGTTTTTGAGGCTTTAAACATGTTGGTC-3'

[0111] The top and bottom chains of RTT-PBS were synthesized in Shanghai Bioengineering.

[0112] Dissolve the top and bottom chains of RTT-PBS in water to a concentration of 200 μM. The annealing system is as follows:

[0113] Table 6 Annealing reaction system

[0114]

[0115]

[0116] The composition of the 10× annealing buffer includes 100 mM Tris-HCl (pH 8.0), 10 mM EDTA (pH 8.0) and 1 M NaCl.

[0117] After denaturation at 94°C for 5 minutes, the sample was taken out and placed at room temperature for 10 minutes to allow the top and bottom chains of RTT-PBS to complement each other and form RTT-PBS double-stranded DNA molecules.

[0118] The epegRNA F+E vector-spacer plasmid was digested with restriction endonucleases LguⅠ and Mva1269Ⅰ, and then ligated with the RTT-PBS double-stranded DNA molecule using the following ligation system:

[0119] Table 7 Ligation reaction system

[0120]

[0121] Incubate at 16°C for 2 hours, then transform the ligation product into competent E. coli DH5α cells using conventional methods and plate. After incubation overnight at 37°C, isolate a single colony and shake. After plasmid extraction, the vector with the correct sequencing result is the epegRNA eukaryotic expression vector. This vector, when co-transfected with PE protein into eukaryotic cells, can be used to edit specific target DNA.

Claims

1. A universal epegRNA eukaryotic expression backbone vector, characterized in that: The sequence from the 5' end to the 3' end includes: a prokaryotic replication origin, an ampicillin resistance gene, a U6 promoter, an sgRNA scaffold or an sgRNA F+E scaffold, a 3' structural motif tevopreQ1, and a TTTTTTT terminator.

2. The universal epegRNA eukaryotic expression backbone vector according to claim 1, characterized in that The vector also includes BbsⅠ located between the U6 promoter and the sgRNA scaffold or the sgRNA F+E scaffold, NheⅠ located between the ampicillin resistance gene and the U6 promoter, and LguⅠ, MunⅠ, and Mva1269Ⅰ restriction endonuclease sites located between the sgRNA scaffold or the sgRNA F+E scaffold and the 3' structural motif tevopreQ1. The BbsⅠ restriction endonuclease site is used to insert a spacer sequence, and the LguⅠ and Mva1269Ⅰ restriction endonuclease sites are used to insert RTT and PBS sequences, and the resulting 5' end protrusions and 3' end protrusions can inhibit vector self-ligation, thereby facilitating the selection of positive colonies with RTT and PBS insertion.

3. The universal epegRNA eukaryotic expression backbone vector according to claim 1, characterized in that The sgRNA scaffold sequence used is shown in SEQ ID NO.1: 5'-GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3'.

4. The universal epegRNA eukaryotic expression backbone vector according to claim 1, characterized in that The sgRNAF+E scaffold sequence used is shown in SEQ ID NO.2: 5'-GTTTGAGAGCTATGCTGGAAACAGCATAGCAAGTTCAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3'.

5. The universal epegRNA eukaryotic expression backbone vector according to claim 1, characterized in that Contains RNA 3' structural motif tevopreQ1, or mpknot; the tevopreQ1 sequence is shown in SEQ ID NO.3: 5'-CGCGGTTCTATCTAGTTACGCGTTAAAACCAACTAGAA-3'.

6. The universal epegRNA eukaryotic expression backbone vector according to claim 1 or 3, characterized in that: The nucleotide sequence of the epegRNA eukaryotic expression backbone vector using the sgRNA scaffold from the U6 promoter to the TTTTTTT terminator is shown in SEQ ID NO.

4.

7. The universal epegRNA eukaryotic expression backbone vector according to claim 1 or 4, characterized in that: The nucleotide sequence of the epegRNA eukaryotic expression backbone vector using the sgRNA F+E scaffold from the U6 promoter to the TTTTTTT terminator is shown in SEQ ID NO.

5.

8. The universal epegRNA eukaryotic expression backbone vector according to claim 1, characterized in that: In eukaryotic cells, the U6 promoter is used to strongly initiate transcription of epegRNA, and the TTTTTTT terminator is used to terminate transcription.

9. A method for constructing the universal epegRNA eukaryotic expression backbone vector according to any one of claims 1 to 8, characterized in that: The following steps are involved: Using the pU6-tevopreq1-GG-acceptor vector as a template, PCR amplify the vector backbone containing tevopreQ1; Using the PX461 vector as a template, PCR amplify the U6 promoter, two BbsⅠ sites, and the sgRNA scaffold; or PCR amplify the U6 promoter and two BbsⅠ sites, synthesize a single-stranded DNA containing two BbsⅠ sites and the F+E sgRNA scaffold, and perform fusion PCR; Ligate PCR amplification products.

Images