C-Kit-EGFR fusion protein and application thereof

By constructing a c-Kit-EGFR fusion protein and using gene editing technology, the dual-target signal synergistic regulation of c-Kit-EGFR was achieved in HEK293 cells, solving the problem of lack of stable expression models in existing technologies and enhancing signal transduction and drug screening capabilities.

CN120757660APending Publication Date: 2025-10-10GENOMEDI TECH SHANGHAI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510921525.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-04
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

The existing technology lacks a cell model that stably expresses the c-Kit-EGFR fusion gene, which limits the research on related signaling pathways and the development of new targeted drugs, especially their application in HEK293 cells.

Method used

The c-Kit-EGFR fusion protein was constructed through gene editing technology, retaining the ligand binding domain of c-Kit and the kinase domain of EGFR. SCF was used to induce c-Kit dimerization to activate EGFR-TK activity, achieve synergistic regulation of dual-target signals, and enhance intracellular signal transduction.

Benefits of technology

In the HEK293 cell model, the c-Kit-EGFR fusion protein can be specifically activated by SCF, triggering phosphorylation of the MAPK and PI3K/AKT pathways, activating downstream signaling pathways, and enhancing intracellular signal transduction, providing a stable research and drug screening platform.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120757660A_ABST
    Figure CN120757660A_ABST
Patent Text Reader

Abstract

The invention relates to a c-Kit-EGFR (Epidermal Growth Factor Receptor) fusion protein and application thereof. The fusion protein comprises a ligand binding domain of c-Kit and a kinase structural domain of EGFR. A c-Kit-EGFR fusion structure is designed and modified, a c-Kit-EGFR chimeric cell line with a stable structure is constructed, functional expression of the c-Kit-EGFR chimeric cell line is achieved, intracellular signals of c-Kit are enhanced, and a model basis is provided for subsequent mechanism exploration and drug development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to a c-Kit-EGFR fusion protein and applications thereof. Background Art

[0002] With the advancement of molecular biology, members of the receptor tyrosine kinase family, such as c-Kit (CD117) and EGFR (epidermal growth factor receptor), have been shown to play a crucial role in the development and progression of diseases such as cancer. c-Kit plays a core role in regulating physiological processes such as cell division, differentiation, and growth, and its mutation or overexpression is closely associated with many malignancies. EGFR, known for its role in mediating cell proliferation, differentiation, and migration, has been extensively studied in various solid tumors and has become a target for numerous targeted drugs.

[0003] c-Kit (CD117) is a type III receptor tyrosine kinase composed of an extracellular domain, a transmembrane domain, and an intracellular domain. The extracellular domain contains five immunoglobulin-like domains (D1-D5), of which D1-D3 are responsible for binding the ligand stem cell factor (SCF), and D4-D5 mediate receptor dimerization. The transmembrane domain is embedded in the cell membrane and transmits signals into the cell interior. The intracellular domain contains the kinase domain, which activates downstream signaling pathways through autophosphorylation, regulating cell proliferation, differentiation, survival, and migration.

[0004] The SCF / c-Kit signaling pathway regulates cell proliferation, survival, and migration. Gain-of-function mutations (such as V559D and D816V) are closely associated with malignancies such as gastrointestinal stromal tumors (GIST) and acute myeloid leukemia (AML). Epidermal growth factor receptor (EGFR) family members (such as HER1 / EGFR and HER2) drive tumor angiogenesis and metastasis by activating downstream pathways such as RAS / MAPK and PI3K / AKT, making them important therapeutic targets for breast cancer and non-small cell lung cancer.

[0005] Currently, studies have reported the construction of cell models with mutations or overexpression of receptor tyrosine kinases such as c-Kit or EGFR for mechanism studies and drug screening. However, there are few studies on cell models for c-Kit-EGFR fusion, especially stable expression models in the commonly used human embryonic kidney cell line HEK293. There are still the following problems with cell models of the c-Kit gene: the main research on the c-Kit gene on the market is done on M-07e cells, which are cytokine-dependent and have weak intracellular signals; the intracellular signals of conventionally constructed c-Kit functional cells are very weak, so there are no reporter gene cell lines with a high window on the market; the lack of in vitro cell models for the c-Kit-EGFR fusion gene limits its molecular mechanism research, drug screening, and the development of new targeted drugs.

[0006] Therefore, developing and establishing a c-Kit-EGFR fusion gene expression model in 293 cells is crucial for systematically studying the biological functions of this fusion gene and related signaling pathways, and also provides a powerful platform for screening and functional validation of novel targeted drugs. The current lack of such stable cell models has limited the in-depth development of related basic research and applied development. Summary of the Invention

[0007] To solve the above technical problems, the present invention provides a c-Kit-EGFR fusion protein and its application. The present invention constructs a structurally stable c-Kit-EGFR chimeric cell by designing and modifying the c-Kit-EGFR fusion structure, achieves its functional expression, and provides a model basis for subsequent mechanism exploration and drug development.

[0008] To achieve this object, the present invention adopts the following technical solutions:

[0009] In a first aspect, the present invention provides a c-Kit-EGFR fusion protein, wherein the fusion protein comprises the ligand binding domain of c-Kit and the kinase domain of EGFR.

[0010] In the present invention, the c-Kit (CD117) used belongs to the receptor tyrosine kinase (RTK) family, which is the same as EGFR. Both have typical RTK structural characteristics. They trigger receptor dimerization through ligand binding, activate intracellular kinase activity, and then initiate downstream signaling pathways (such as MAPK, PI3K / AKT, etc.) through autophosphorylation to regulate cell proliferation, differentiation and survival.

[0011] There is significant cross-regulation between the c-Kit and EGFR signaling pathways: 1) Signal crosstalk: EGFR activation can upregulate c-Kit expression, and c-Kit phosphorylation enhances EGFR downstream RAS / MAPK signaling through the GRB2 / SOS complex, forming a positive feedback loop and accelerating tumor progression; 2) Resistance mechanism: Single-target inhibitors (such as the EGFR-TKI gefitinib) are prone to lead to resistance through c-Kit bypass signal activation; c-Kit inhibitors (such as imatinib) have limited efficacy in D816V mutant tumors and cannot block EGFR-mediated pro-survival signals.

[0012] In the present invention, a fusion gene of the extracellular domain of c-Kit and the intracellular domain of EGFR (c-Kit-EGFR) is constructed by gene editing technology. First, the structure is optimized to retain the ligand binding domain (LBD) of c-Kit and the kinase domain (KD) of EGFR, and the dimerization of c-Kit induced by SCF is used to activate the activity of EGFR-TK, thereby realizing the coordinated regulation of dual-target signals. Secondly, the intracellular signal is enhanced. c-Kit (CD117) and EGFR belong to the receptor tyrosine kinase (RTK) family, and both have typical RTK structural characteristics. Under the same high expression and ligand saturation, the intracellular signal usually activated by EGFR is stronger and faster than that of c-Kit. The ligand binding domain of c-Kit is located in its extracellular part, and its main function is to specifically recognize and bind to its ligand SCF (stem cell factor). This combination promotes the dimerization of the two c-Kit receptors, thereby inducing conformational changes in the intracellular kinase domain and initiating signal transduction. The kinase domain of EGFR is located intracellularly. Its core function is to catalyze the tyrosine phosphorylation of itself and downstream signaling proteins after the receptor is activated and dimerized by ligands such as EGF, thereby initiating and amplifying multiple signaling pathways for cell proliferation, differentiation, and survival. By fusing the ligand-binding domain of c-Kit with the kinase domain of EGFR, intracellular signaling can be effectively enhanced. Finally, functional verification showed that in the HEK293 cell model, the c-Kit-EGFR fusion protein can be specifically activated by SCF, simultaneously triggering phosphorylation of the MAPK and PI3K / AKT pathways and activating downstream signaling pathways.

[0013] Preferably, the amino acid sequence of the ligand binding domain of c-Kit includes the sequence shown in SEQ ID No.1.

[0014] SEQ ID No. 1:

[0015] MRGARGAWDFLCVLLLLLRVQTGSSQPSVSPGEPSPPSIHPGKSDLIVRVGDEIRLLCTDPGFVKWTFEILDETNENKQNEWITEKAEATNTGKYTCTNKHGLSNSIYVFVRDPAKLFLVDRSLYGKEDNDTLVRCPLTDPEVTNYSLKGCQGKPLPKDLRFIPDPKAGIMIKSVKRAYHRLCLHCSVDQEGKSVLSEKFILKVRPAFKAVPVVSVSKASYLLREGEEFTVTCTIKDVSSSVYSTWKRENSQTKLQEKYNSWHHGDFNYERQATLTISSARVNDSGVFMCYANNTFGSANVTTTLEVVDKGFINIFPMINTTVFVNDGENVDLIVEYEAFPKPEHQQWIYMNRTFTDKWEDYPKSENESNIRYVSELHLTRLKGTEGGTYTFLVSNSDVNAAIAFNVYVNTKPEILTYDRLVNGMLQCVAAGFPEPTIDWYFCPGTEQRCSASVLPVDVQTLNSSGPPFGKLVVQSSIDSSAFKHNGTVECKAYNDVGKTSAYFNFAFKEQIHPHTLFTP。

[0016] 优选地,所述EGFR的激酶结构域氨基酸序列包括SEQ ID No.2所示的序列。

[0017] SEQ ID No.2:

[0018] IATGMVGALLLLLVVALGIGLFMRRRHIVRKRTLRRLLQERELVEPLTPSGEAPNQALLRILKETEFKKIKVLGSGAFGTVYKGLWIPEGEKVKIPVAIKELREATSPKANKEILDEAYVMASVDNPHVCRLLGICLTSTVQLITQLMPFGCLLDYVREHKDNIGSQYLLNWCVQIAKGMNYLEDRRLVHRDLAARNVLVKTPQHVKITDFGLAKLLGAEEKEYHAEGGKVPIKWMALESILHRIYTHQSDVWSYGVTVWELMTFGSKPYDGIPASEISSILEKGERLPQPPICTIDVYMIMVKCWMIDADSRPKFRELIIEFSKMARDPQRYLVIQGDERMHLPSPTDSNFYRALMDEEDMDDVVDADEYLIPQQGFFSSPSTSRTPLLSSLSATSNNSTVACIDRNGLQSCPIKEDSFLQRYSSDPTGALTEDSIDDTFLPVPEYINQSVPKRPAGSVQNPVYHNQPLNPAPSRDPHYQDPHSTAVGNPEYLNTVQPTCVNSTFDSPAHWAQKGSHQISLDNPDYQQDFFPKEAKPNGIFKGSTAENAEYLRVAPQSSEFIGA。

[0019] 优选地,所述c-Kit的配体结合域的编码核酸序列包括SEQ ID No.3所示的序列。

[0020] SEQ ID No.3:

[0021]

[0022] Preferably, the nucleic acid sequence encoding the kinase domain of EGFR includes the sequence shown in SEQ ID No.4.

[0023] SEQ ID No.4:

[0024]

[0025] Preferably, the amino acid sequence of the c-Kit-EGFR fusion protein includes the sequence shown in SEQ ID No.5.

[0026] SEQ ID No.5:

[0027]

[0028] In a second aspect, the present invention provides a nucleic acid molecule encoding the c-Kit-EGFR fusion protein described in the first aspect.

[0029] Preferably, the nucleic acid sequence of the nucleic acid molecule includes the sequence shown in SEQ ID No.6.

[0030] SEQ ID No.6:

[0031]

[0032] In a third aspect, the present invention provides an expression vector comprising the nucleic acid molecule of the second aspect; and after transfection, transduction or transformation of a host cell, the expression vector enables the host cell to express the c-Kit-EGFR fusion protein of the first aspect.

[0033] Preferably, the host cell includes any one of HEK293 cells, CHOK1 cells or Jurkat cells.

[0034] HEK293 cells are used in the present invention. Due to their advantages such as high transfection efficiency, fast growth rate and ease of culture, they have become an important tool cell line for constructing and studying the functions of novel fusion genes.

[0035] In a fourth aspect, the present invention provides a cell model, wherein the cell model expresses the c-Kit-EGFR fusion protein described in the first aspect.

[0036] In a fifth aspect, the present invention provides a use of the c-Kit-EGFR fusion protein described in the first aspect, the nucleic acid molecule described in the second aspect, the expression vector described in the third aspect, or the cell model described in the fourth aspect in preparing a disease model.

[0037] Compared with the prior art, the present invention has at least the following beneficial effects:

[0038] 1. In this invention, a fusion gene (c-Kit-EGFR) of the extracellular domains of c-Kit and the intracellular domains of EGFR was constructed using gene editing technology. The ligand binding domain (LBD) of c-Kit and the kinase domain (KD) of EGFR were retained, and SCF-induced c-Kit dimerization was used to activate EGFR-TK activity, achieving synergistic regulation of dual-target signals.

[0039] 2. In the present invention, the intracellular domain of EGFR binds to the ligand binding domain of c-Kit. c-Kit (CD117) and EGFR belong to the same receptor tyrosine kinase (RTK) family, and both have typical RTK structural characteristics. After the fusion of c-Kit and EGFR, the intracellular signal can be enhanced.

[0040] 3. The c-Kit-EGFR fusion protein constructed in the present invention can be specifically activated by SCF in the HEK293 cell model, simultaneously triggering the phosphorylation of the MAPK and PI3K / AKT pathways and activating downstream signaling pathways. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Map of the empty vector lenti-CMV-MCS-PGK-Puro used in the construction of the recombinant plasmid of the present invention.

[0042] Figure 2 The double enzyme digestion verification diagram of the two recombinant plasmids.

[0043] Figure 3 Validation diagram for activation of H_c-kit H_EGFR 293 using Human SCF protein drug.

[0044] Figure 4 Validation diagram of the antibody block for H_c-kit H_EGFR 293.

[0045] Figure 5 This is the flow cytometry validation diagram of H_c-kit H_EGFR 293. DETAILED DESCRIPTION

[0046] The technical solution of the present invention will be further described below with reference to the accompanying drawings and through specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0047] Example 1

[0048] In this example, H_c-kit (p.1 to 520)-H_EGFR (p.646 to 1210) and H_c-Kit (CD117) lentiviral plasmids were constructed.

[0049] The vector lenti-CMV-MCS-PGK-Puro was double-digested with XhoI and BamHI. The map of the empty vector is shown in the figure. Figure 1 As shown. A nucleic acid sequence encoding a c-Kit-EGFR fusion protein, SEQ ID No. 6, was synthesized and named H_ckit-H_EGFR. H_ckit-H_EGFR was double-digested with XhoI and BamHI. The nucleic acid sequence encoding the c-Kit ligand binding domain in H_ckit-H_EGFR is SEQ ID No. 3, which is the sequence from positions 1 to 520 of the c-Kit gene; and the nucleic acid sequence encoding the kinase domain of EGFR is SEQ ID No. 4, which is the sequence from positions 646 to 1210 of the EGFR gene.

[0050] The digested lenti-CMV-MCS-PGK-Puro and H_ckit-H_EGFR were connected and named lenti-CMV-H_ckit-H_EGFR-PGK-Puro. The H_ckit-H_EGFR fusion sequence of the lenti-CMV-H_ckit-H_EGFR-PGK-Puro plasmid was sequenced using primer sequences PTRE2-F, PGK-R, 102784W1F-111163, 102784W2F-111164, 102784W3F-111165, and 102784W4F-111166. The sequencing was completed by Sangon Biotech (Shanghai) Co., Ltd. The sequencing results showed that the inserted gene sequence H_ckit-H_EGFR was identical to the sequence shown in SEQ ID No. 6, confirming that the recombinant vector was successfully constructed.

[0051] The lenti-CMV-MCS-PGK-Puro vector was double-digested with XhoI and BamHI, and the nucleic acid sequence encoding the ligand-binding domain of c-Kit, shown in SEQ ID No. 3, was synthesized and named H_ckit. H_ckit was double-digested with XhoI and BamHI. The digested lenti-CMV-MCS-PGK-Puro and H_ckit were ligated and named lenti-CMV-H_c-Kit-PGK-Puro. The c-Kit gene sequence of the lenti-CMV-H_c-Kit-PGK-Puro plasmid was sequenced using pTRE2-F, 86600W1F-103920, 86600W2F-103921, 86600W3F-103922, 86600W4F-103923, and PGK-R. The sequencing results showed that the inserted gene sequence H_c-Kit was identical to the sequence shown in SEQ ID No. 3. The sequences of the above primers are shown in Table 1.

[0052] Table 1

[0053] Primer name serial number Nucleic acid sequence 5'-3' PTRE2-F SEQ ID No.7 TCGTTTAGTGAACCGTCAGA PGK-R SEQ ID No.8 CTACACAAGTGGCCTCTGGC 102784W1F-111163 SEQ ID No.9 CCTGAGGTGACCAATTACAGCC 102784W2F-111164 SEQ ID No.10 GAACGTGGATCTGATCGTGG 102784W3F-111165 SEQ ID No.11 CTTCGCCTTCAAGGAACAGATCC 102784W4F-111166 SEQ ID No.12 CTCAACTGGTGTGTGCAGATCG 6600W1F-103920 SEQ ID No. 13 CCTGAGGTGACCAATTACAGCC 86600W2F-103921 SEQ ID No.14 GAACGTGGATCTGATCGTGG 86600W3F-103922 SEQ ID No.15 CTCTGCTGATCGGCTTTGTG 86600W4F-103923 SEQ ID No.16 GAGCTCTTGCTCTGACAGCAC

[0054] The plasmid was determined by plasmid size and double enzyme digestion. Figure 2 As shown, lane 1 represents the double enzyme digestion map of lenti-CMV-H_ckit-H_EGFR-PGK-Puro plasmid, and lane 2 represents the double enzyme digestion map of lenti-CMV-H_c-Kit (CD117)-PGK-Puro. The results show that the recombinant vectors are of correct length.

[0055] Example 2

[0056] This example performs virus packaging

[0057] Lentiviral packaging cells were 293T anchorage-dependent epithelial cells grown in DMEM (containing 10% FBS). Transfection was performed using lenti-CMV-H_ckit-H_EGFR-PGK-Puro and lenti-CMV-H_c-Kit(CD117)-PGK-Puro prepared in Example 1. One day before transfection, the grown cells were passaged at the appropriate ratio into a 10 cm dish. When the cells reached 80% growth, transfection was prepared. Two hours before transfection, fresh culture medium was exchanged for the cells to be transfected, at 12 mL / 10 cm dish. Take a sterile 1.5mL EP tube, mix 1mL of DMEM, 10μg of plasmid, 10μL of Lenti-HG Mix and 60μL of HG transgene reagent, place it at room temperature for 20 minutes, and then evenly add it to the culture dish that has been replaced with the liquid in advance. Then, culture it in a CO2 incubator. After 12 hours of transfection, evenly add 100×Enhancing buffer (120μL / dish) to promote transfection. After 18 hours of transfection, aspirate the cell culture medium and add 15mL of fresh cell culture medium to continue culturing.

[0058] Virus collection: 48 hours after the liquid was changed, the cell supernatant was aspirated into a 50 mL centrifuge tube and centrifuged at 4°C and 4500 g for 5 min. The supernatant was filtered through a 0.45 μm filter and transferred to a new centrifuge tube. Finally, the filtrate was transferred to a concentration device in batches and centrifuged at 4°C and 4500 g for 10 min. The lower layer of liquid was discarded into a waste liquid cup containing disinfectant. The final centrifugation was performed at 4°C and 4500 g for 20 min. At this time, the liquid in the upper layer of the filter was the virus concentrate.

[0059] Lentivirus titer determination: 293T cells in the logarithmic growth phase were trypsinized and seeded into 96-well plates at 8,000 cells / well. The cells were cultured at 37 degrees overnight. The cells grew to a confluence density of 40% when infected the next day. The virus solution was serially diluted using cell culture medium containing 10% FBS. The required cell wells were selected, 90 μL of culture medium was aspirated, and 90 μL of the mixed lentivirus dilution solution was added to each well of cells. The cells were cultured in a cell culture incubator at 37°C overnight. On the third day, the culture medium containing the lentivirus was removed and 100 μL of complete culture medium was added. On the fifth day, the virus titer was measured using RT-PCR. The RT-PCR system is shown in Table 2, the RT-PCR reaction conditions are shown in Table 3, and the primers used are shown in Table 4. The titer of lenti-CMV-H_ckit-H_EGFR-PGK-Puro was 1.29×10 8TU / mL, the titer of lenti-CMV-H_c-Kit(CD117)-PGK-Puro was 4.78×10 8 TU / mL.

[0060] The dilution method is as follows: diluent No. 1: 10 μL virus solution + 90 μL virus dilution culture medium; diluent No. 2: 10 μL diluent No. 1 + 90 μL virus dilution culture medium.

[0061] Table 2

[0062] Components volume Ultrapure water 7.2μL 2×SYBR Mix 10 μL Upstream primer (10uM) 0.4μL Downstream primer (10uM) 0.4μL template 2μL Overall system 20 μL

[0063] Table 3

[0064]

[0065] Table 4

[0066] Primer name serial number Nucleic acid sequence 5'-3' WPRE-F SEQ ID No. 17 CGCTATGTGGATACGCTGCTTTA WPRE-R SEQ ID No. 18 GCAACCAGGATTTATACAAGGAGGA GAPDH-F (internal reference) SEQ ID No. 19 GTCTCCTCTGACTTCAACAGCG GAPDH-R (internal reference) SEQ ID No. 20 ACCACCCTGTTGCTGTAGCCAA

[0067] Example 3

[0068] This example constructs a functional cell line

[0069] The two virus solutions obtained in Example 2 were used to infect 6×LHRE HEK-293 Cell Line cells at a virus MOI of 10, and the calculated virus dosage was 1 mL.

[0070] On the first day, cells were cultured to the logarithmic growth phase and 4 × 10 4 The cells were placed in a 1.5 mL EP tube and centrifuged at 1000 r / min for 5 min. The supernatant was discarded and the cell pellet was kept for later use. The required volume of lentivirus was calculated according to MOI = 10. The virus solution was aspirated and added to another EP tube prepared in advance (containing 500 μL complete medium). After pipetting and mixing, it was added to 4 × 10 4 The cell pellet was gently pipetted into the EP tube to avoid bubbles. The new mixture was then transferred to a 24-well plate and centrifuged at 2100 rpm for 30 minutes. After centrifugation, the cell culture plate was placed in a 37°C, 5% CO2 incubator for overnight culture.

[0071] On the second day, 16 hours after infection, observe the cell status. If the status deteriorates significantly, aspirate the culture medium containing the lentiviral particles and replace with a full volume of fresh culture medium. If the status is normal, replenish the medium to 1 mL of full culture medium and replace with a full volume of fresh culture medium on the third day.

[0072] On the fourth day, continue to culture the cells and observe whether there are any abnormalities in the cell status.

[0073] On the fifth day, cells were selected for eukaryotic resistance to blasticidin and puromycin (blasticidin at a full lethal concentration of 7 μg / mL, with a maintenance concentration of 3.5 μg / mL; puromycin at a full lethal concentration of 1.5 μg / mL, with a maintenance concentration of 0.75 μg / mL). After two rounds of drug selection (one round lasting two days), the cells stabilized and were maintained in complete medium containing DMEM + 10% FBS + 1% P.S. + 4 μg / mL blasticidin + 0.75 μg / mL puromycin or DMEM + 10% FBS + 1% P.S. + 0.75 μg / mL puromycin, respectively. After two rounds of drug selection, two reporter gene cell lines, H_c-kit H_EGFR 293 functional cells and H_c-Kit 293, were obtained.

[0074] Example 4

[0075] This example performs a functional cell line activation verification test

[0076] On the afternoon of the first day, H_c-kit H_EGFR 293 and H_c-Kit(CD117)293 cells were removed from the culture flask, the cell pellet was collected by centrifugation, and the cells were resuspended in complete medium. Cell viability was detected and counted, and the cell concentration was adjusted to 1.5×10 5 cells / mL. Using a pipette, add 100 μL of cells / well to the center well. Add 100 μL of PBS to the surrounding wells. Cover the plate and incubate overnight in an incubator.

[0077] The next morning, materials were prepared and the experiment officially began. For this experiment, the starting concentration of Human SCF protein (Jiman Bio) was 3μg / mL, and a 3-fold gradient dilution was performed to make 9 wells; then a 0 concentration was set as a control. The cells prepared in advance were taken out and the supernatant was discarded; then the gradient diluted drugs were added separately, 100uL per well, and incubated for 16h. GMOne-Step Luciferase Reporter Gene Assay Kit (source: Jiman Bio) was used to detect Luciferase. Figure 3 The results showed that H_c-kit H_EGFR 293 could activate Luciferase with Human SCF protein and detect fluorescence signal with EC50 value of 0.1642ug / mL, while H_c-Kit (CD117) 293 was ineffective.

[0078] Experimental results showed that cells expressing only the c-Kit gene domain failed to activate or enhance intracellular signaling after addition of Human SCF protein, indicating that the endogenous domain of c-Kit is ineffective in mediating downstream signaling. In contrast, when reporter cells were constructed by fusing the extracellular ligand-binding domain of c-Kit with the intracellular kinase domain of EGFR, stimulation with Human SCF protein significantly induced activation of downstream signaling pathways, as evidenced by an increase in the intracellular fluorescent reporter signal. This result suggests that the c-Kit ligand-binding domain can mediate recognition of the Human SCF protein but relies on the EGFR kinase domain for effective intracellular signaling, thereby achieving amplification and detectability of cellular signals.

[0079] Example 5

[0080] This example performs functional cell line inhibition verification testing

[0081] On the afternoon of the first day, H_c-kit H_EGFR 293 cells were removed from the culture flask, the cell pellet was collected by centrifugation, and the cells were resuspended in complete medium. Cell viability was detected and counted, and the cell concentration was adjusted to 1.5×10 5 cells / mL. Using a pipette, add 100 μL of cells / well to the center well. Add 100 μL of PBS to the surrounding wells. Cover the plate and incubate overnight in an incubator.

[0082] The next morning, prepare experimental materials. For this experiment, use a fixed concentration of 200 ng / mL for Human SCF protein (provided by Yoshiman Biotech (Shanghai) Co., Ltd.). Prepare a 96-well plate and dilute the antibody. Start with a 15 μg / mL concentration for Anti-c-Kit (CD117) antibody (provided by Yoshiman Biotech (Shanghai) Co., Ltd.) and perform a three-fold serial dilution across nine wells. A zero concentration control is then set.

[0083] Remove the prepared cells and discard the supernatant. First, add 50 μL of serially diluted Anti-c-Kit (CD117) solution to each well and incubate in an incubator for 1 hour. After 1 hour, remove the mixed solution from the plate and add 50 μL of 400 ng / mL Human SCF protein solution to each well. Cover the plate and incubate in a 37°C CO2 incubator for another 15 hours. Detect luciferase using the GMOne-Step Luciferase Reporter Gene Assay Kit.

[0084] like Figure 4As shown in the figure, in H_c-kit H_EGFR 293 cells, the addition of Human SCF protein can effectively activate the c-Kit receptor and promote the upregulation of the fluorescence signal. After further addition of Anti-c-Kit (CD117) neutralizing antibody, the fluorescence signal induced by Human SCF protein was significantly inhibited, indicating that the antibody can effectively block the signal transduction pathway mediated by c-Kit protein.

[0085] Example 6

[0086] This embodiment performs flow verification detection

[0087] Digest H_c-kit H_EGFR 293 and take 100 μL cell suspension (adjust the concentration to 2×10 with PBS after counting the cells). 6 Then, Anti-c-Kit (CD117) antibody was added and incubated at 4°C in the dark for 30 min.

[0088] Wash the cells with 1 mL of 1% PBS / BSA, centrifuge at 400 g for 5 minutes, discard the supernatant, and repeat this step twice. Dilute the fluorescent dye-labeled secondary antibody to the optimal concentration using 1% BSA / PBS, then resuspend the cells in this solution and incubate at 4°C in the dark for 30 minutes. Wash the cells three times, centrifuge at 400 g for 5 minutes, and discard the supernatant. Finally, resuspend the cells in a pre-cooled 1% BSA / PBS solution and analyze the cells using a flow cytometer. Figure 5 As shown, flow cytometry results show that the constructed H_c-kit H_EGFR 293 cells successfully expressed c-Kit protein on their surface. Compared with the control group, both the proportion of positive cells and the fluorescence intensity were significantly increased, indicating that the target gene was stably expressed in this cell line.

[0089] In summary, the present invention designed and modified the c-Kit-EGFR fusion structure to construct a structurally stable c-Kit-EGFR chimeric cell line, achieve its functional expression, enhance the endogenous signaling of c-Kit, and provide a model basis for subsequent mechanism exploration and drug development.

[0090] The applicant declares that the above is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the scope of protection and disclosure of the present invention.

Claims

1. A c-Kit-EGFR fusion protein, characterized in that The fusion protein includes the ligand binding domain of c-Kit and the kinase domain of EGFR.

2. The c-Kit-EGFR fusion protein according to claim 1, characterized in that The amino acid sequence of the ligand binding domain of c-Kit includes the sequence shown in SEQ ID No. 1; Preferably, the amino acid sequence of the kinase domain of EGFR includes the sequence shown in SEQ ID No.

2.

3. The c-Kit-EGFR fusion protein according to claim 1 or 2, characterized in that The nucleic acid sequence encoding the ligand binding domain of c-Kit includes the sequence shown in SEQ ID No. 3; Preferably, the nucleic acid sequence encoding the kinase domain of EGFR includes the sequence shown in SEQ ID No.

4.

4. The c-Kit-EGFR fusion protein according to any one of claims 1 to 3, characterized in that The amino acid sequence of the c-Kit-EGFR fusion protein includes the sequence shown in SEQ ID No.

5.

5. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the c-Kit-EGFR fusion protein according to any one of claims 1 to 4.

6. The nucleic acid molecule according to claim 5, characterized in that The nucleic acid sequence of the nucleic acid molecule includes the sequence shown in SEQ ID No.

6.

7. An expression vector, characterized in that The expression vector contains the nucleic acid molecule according to claim 5 or 6; and after transfection, transduction or transformation of a host cell, the expression vector enables the host cell to express the c-Kit-EGFR fusion protein according to any one of claims 1 to 4.

8. The expression vector according to claim 7, characterized in that The host cell includes any one of HEK293 cells, CHOK1 cells or Jurkat cells.

9. A cell model, characterized in that The cell model expresses the c-Kit-EGFR fusion protein according to any one of claims 1 to 4.

10. Use of the c-Kit-EGFR fusion protein according to any one of claims 1 to 4, the nucleic acid molecule according to claim 5 or 6, the expression vector according to claim 7 or 8, or the cell model according to claim 9 in preparing a disease model.