Specific primer pair of qCC2.1. InDel.151 closely linked with capsaicin substance content and application of specific primer pair of qCC2.1. InDel.151 closely linked with capsaicin substance content
By developing a qCC2.1.InDel.151-specific primer pair that is closely linked to the content of capsaicinoids, and using PCR amplification to detect the specific fragment size of pepper materials, the problem of screening the content of capsaicinoids in pepper breeding was solved, and efficient and accurate pepper material screening and breeding was achieved.
Patent Information
- Application Number
- CN202510946911.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-10
- Publication Date
- 2025-10-10
AI Technical Summary
Existing technologies make it difficult to efficiently screen materials with different capsaicinoid contents in pepper breeding, resulting in a cumbersome and inefficient breeding process.
A specific primer pair qCC2.1.InDel.151, which is closely linked to the content of capsaicinoids, was developed. The specific fragment size of the pepper material was detected by PCR amplification, and the 179bp and 198bp amplified fragments were used to distinguish between high-spiciness and low-spiciness materials.
The method achieves efficient screening of pepper materials with different capsaicinoid contents at the pepper seedling stage, improves the accuracy and efficiency of breeding, and reduces the workload of capsaicinoid content determination.
Smart Images

Figure CN120758656A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of agricultural biotechnology, and in particular to a qCC2.1.InDel.151 specific primer pair closely linked to the content of capsaicinoid substances and an application thereof. Background Art
[0002] Phenotypic measurements and high-density EST genetic maps have been constructed using recombinant inbred lines of the shrub pepper 'acc.2814-6' and the Chinese pepper 'NuMexRNAKY'. Phenotypic correlations between these phenotypes and the genetic map have been used to locate QTLs for various traits, including 12 QTLs associated with capsaicinoid content. SSR marker CAMS-142 was found on chromosome 1 and was reported to be significantly associated with capsaicinoid and dihydrocapsaicinoid levels. Two QTLs for capsaicinoid content (qcap3.1 and qcap6.1) were detected on chromosomes LG3 and LG6, and two QTLs for dihydrocapsaicinoid content (qhdc2.1 and qhdc2.2) were detected on chromosome LG2. A major QTL was located on chromosome 6, and a total of 15 QTLs for capsaicinoid content were identified on chromosomes 3, 6, and 1. It can be seen that molecular markers with high correlation with phenotypes play a very important role in breeding and the positioning of genes and QTLs as well as breeding. Summary of the Invention
[0003] The purpose of the present invention is to provide a qCC2.1.InDel.151 specific primer that is closely linked to the content of capsaicinoids.
[0004] Another object of the present invention is to provide applications of the above-mentioned specific primers.
[0005] The qCC2.1.InDel.151 specific primer pair closely linked to the capsaicinoid content according to the present application includes the following primers:
[0006] Chr02_151083193_F:ATTTTGCTAGCCACGTGTAGT;
[0007] Chr02_151083193_R:AAGAATGTAAAGCTAAGAGGTCA.
[0008] The above-mentioned qCC2.1.InDel.151 specific primer pair that is closely linked to the content of capsaicinoids is used to screen pepper materials with different capsaicinoid contents at the pepper seedling stage.
[0009] A method for screening pepper materials with different capsaicinoid contents at the pepper seedling stage, the method comprising the following steps:
[0010] The PCR amplification of the test material is performed using the primer pair specific to the qCC2.1.InDel.151 which is closely linked to the capsaicinoid content;
[0011] When the amplified fragment is 198bp, the pungency value of the test pepper material is less than 100000 SHU, and when the amplified fragment is 179bp, the pungency value of the test pepper material is greater than 100000 SHU.
[0012] According to the technical solution of the present application, there is a base insertion of TTTCATTTGTGTTTTTCAG at 151083393bp of chromosome 2 in low-pungency material PI152225 which is significantly related to the capsaicin content. In the F2 population, 236 single plants are counted, and the correlation coefficient of the marker and the capsaicin content reaches 0.504**. When the pungency value (SHU) is 100000 as the threshold value, among the materials with a pungency value less than 100000, 91.94% of the materials have the base CTTTCATTTGTGTTTTTCAG at this site except for the heterozygotes, and among the materials with a pungency value greater than 100000, 74.54% of the materials have the base C at this site except for the heterozygotes. The overall statistical results show that the base insertion at Chr02: 151083393bp has a relatively high accuracy in identifying the capsaicin content of the material.
[0013] Since the marker is very close to the gene Cchi02g002094 and has a very high identification rate for the gene, it is of great significance for molecular marker-assisted selection breeding.
[0014] Through the technical solution of the present application, different capsaicinoid content peppers can be screened at the pepper seedling stage, which reduces the determination work of capsaicinoid content and accelerates the screening of different pungency materials, and has a very important role in the molecular genetic breeding of different pungency peppers. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 Figure a shows the agarose electrophoresis map of the marker qCC2.1.InDel.151, M: marker D50, the length of the PCR amplification product is 179 / 198bp, and figure b shows the marker typing result. DETAILED DESCRIPTION
[0016] Example 1: Development of a molecular marker linked to the capsaicinoid content
[0017] Marker development and screening material: "PBC932" (high-pungency material) and "PI152225" (low-pungency material), F2 of "PBC932" x "PI152225" 1,Marker application verification material: F2 population of "PBC932" × "PI152225".
[0018] The process of establishing the genetic map: compare the differential sites between the parents, perform whole-genome resequencing on individual plants in the F2 population, export the F2 resequencing results as a vcf file, and convert the genotype of the individual plant. The genotype that is the same as "PI152225" is assigned a value of "0", the genotype that is the same as "PBC932" is assigned a value of "2", and the genotype that is the same as "F1" is assigned a value of "1". The genotype data of the F2 population are sorted, and a chromosome gene linkage map is constructed using QTL IciMapping. Regions with LOD values exceeding 3.0 are set as QTL sites to establish a genetic linkage map.
[0019] The process and results of the phenotype-genotype association analysis: F2 plants were phenotypically identified, and capsaicinoids were measured in individual F2 plants using high-performance liquid chromatography. QTL IciMapping was used to map the genetic linkage map and the bip files of genotypes and phenotypes, and the phenotypic contribution (PVE) of each locus was calculated. After preliminary mapping, InDel markers were designed to validate the initial mapping results, ultimately identifying a major QTL on chromosome 2, qCC2.1, with a contribution of 24.20%.
[0020] Using PBC932 as the reference genome (Zhang et al., 2025, https: / / ngdc.cncb.ac.cn / gwh / ), a base sequence TTTCATTTGTGTTTTTCAG, which is significantly correlated with capsaicin content, was inserted into qCC2.1 (near gene Cchi02g002094) at bp 151083393 on chromosome 2 in plant material PI152225. This sequence was named qCC2.1_InDel_151, and the primers were:
[0021] Chr02_151083193_F:ATTTTGCTAGCCACGTGTAGT;
[0022] Chr02_151083193_R: AAGAATGTAAAGCTAAGAGGTCA, the amplified fragment size is 179 / 198 bp.
[0023] The marker was applied to the F1 of "PI152225" and "PBC932" and "PBC932" × "PI152225" and detected by agarose gel electrophoresis. The detection results were statistically analyzed ( Figure 1 (Figure b in the figure).
[0024] Analysis results: Agarose gel electrophoresis was performed on "PI152225" and "PBC932", and the F1 of "PBC932" × "PI152225" showed that the amplified fragment of "PI152225" material was 198 bp in size, the amplified fragment of "PBC932" material was 179 bp in size, and the amplified fragment of "PBC932" × "PI152225" F1 was two bands, 198 bp and 179 bp respectively. This indicates that the marker is polymorphic in high-spiciness materials and low-spiciness materials ( Figure 1 b) The molecular markers obtained using the primers have a high correlation with the capsaicin content.
[0025] Example 2 Application of the specific primers of the molecular marker linked to the content of capsaicinoids in breeding
[0026] The marker was applied to the F2 population for validation, and the F2 population was tested by agarose gel electrophoresis. PCR amplification results were run on a 3% agarose gel for 1 hour and 40 minutes.
[0027] The test results were statistically analyzed and then assigned values. The genotype of "A" (the same as the parent "PI152225", with a low spiciness phenotype) was assigned a value of "1", the genotype of "B" (the same as the parent "PBC932", with a high spiciness phenotype) was assigned a value of "3", and the genotype of "H" (the same as F1) was assigned a value of "2". Correlation analysis was performed using SPSS software.
[0028] Analysis results: 236 individuals were counted in the F2 population of "PBC932"×"PI152225". The correlation coefficient between this marker and capsaicin content reached 0.504**. When the spiciness value (SHU) was 100,000 as the threshold and the amplified fragment size was 198 bp, 91.94% of the materials with spiciness values less than 100,000, excluding heterozygotes, had the base CTTTCATTTGTGTTTTTCAG at this site. In the materials with spiciness values greater than 100,000, excluding heterozygotes, 74.54% of the materials with spiciness values greater than 100,000, excluding heterozygotes, had the base C( Figure 1 (Figure a in the figure).
[0029] Using this method, the marker was used to detect capsaicinoid content in homozygous natural inbred lines of pepper. The size of the marker fragment was used to determine the capsaicinoid content in 138 pepper accessions from natural inbred lines. When the amplified fragment was 198 bp, there was a 100% probability that the pungency value was less than 100,000 SHU, while when the amplified fragment was 179 bp, there was a 57.1% probability that the pungency value was greater than 100,000 SHU. Furthermore, a significant correlation between the marker and the capsaicinoid content in all 138 accessions from natural inbred lines of pepper was found, with a correlation coefficient of 0.664**.
[0030] The above embodiments are only used to understand the technical solutions of the present application and do not limit the scope of protection of the present application.
Claims
1. A qCC2.1_InDel_151 specific primer pair closely linked to the content of capsaicinoids, characterized in that: The specific primer pair includes the following primers: Chr02_151083193_F: 5'ATTTGCTAGCCAGTGTAGT3'; Chr02_151083193_R: 5'AAGAATGTAAAGCTAAGAGGTCA3'.
2. Use of the qCC2.1_InDel_151 specific primer pair tightly linked to the capsaicinoid content according to claim 1 for screening pepper materials with different capsaicinoid content at the pepper seedling stage.
3. A method for screening pepper materials with different capsaicinoid contents at the pepper seedling stage, characterized in that: The method comprises the following steps: PCR amplification was performed on the pepper material to be tested using the qCC2.1_InDel_151 specific primer that is closely linked to the content of capsaicinoids. The specific primer pair includes the following primers: Chr02_151083193_F:5'ATTTGCTAGCCAGTGTAGT3', Chr02_151083193_R: 5'AAGAATGTAAAGCTAAGAGGTCA3'; When the amplified fragment is 198 bp, the pungency value of the pepper material to be tested is less than 100,000 SHU, and when the amplified fragment is 179 bp, the pungency value of the pepper material to be tested is greater than 100,000 SHU.