CRISPR / Cas12a-RPA-based sequence combination for rapidly detecting mouse hepatitis virus and kit thereof

Abstract

The invention discloses a CRISPR / Cas12a-RPA (clustered regularly interspaced short palindromic repeats / CRISPR associated protein 12a-recombinase polymerase amplification)-based sequence combination for rapidly detecting mouse hepatitis virus and a kit thereof, and belongs to the technical field of biological detection The sequence combination comprises an RPA primer pair sequence, a crRNA sequence and an ssDNA probe sequence; the kit comprises an RPA primer pair sequence, a crRNA sequence and an ssDNA probe sequence, the kit further comprises a mouse hepatitis virus negative control standard substance, RNase-free water, an RPA reaction buffer solution, an NEB buffer solution, Lba Cas12a nuclease, dry powder RPA reaction microspheres containing recombinase polymerase and magnesium acetate with the concentration of 280 mM. The kit can be used for rapidly detecting the mouse hepatitis virus. The primer sequence combination provided by the invention is good in conservative property and specificity and relatively high in sensitivity, and rapid detection of the mouse hepatitis virus can be realized.

Description

TECHNICAL FIELD

[0001] The application relates to a sequence combination for rapidly detecting a mouse hepatitis virus based on CRISPR / Cas12a-RPA and a kit thereof, and belongs to the technical field of biological detection. BACKGROUND

[0002] Mouse hepatitis virus (MHV) infection is a viral infectious disease that seriously endangers mouse production, can cause mouse fatal hepatitis, encephalitis and enteritis, and causes great threat to mouse breeding and development. In most cases, mouse hepatitis virus infection in a mouse population is subclinical, but it seriously interferes with experimental research. Therefore, timely and accurate detection of whether a mouse is infected with a mouse hepatitis virus is crucial for mouse breeding and related scientific research.

[0003] At present, the methods commonly used in laboratories for detecting mouse hepatitis virus include serological detection, molecular biology detection and virus isolation and culture. Serological detection determines whether a mouse is infected with a virus by detecting whether specific antibodies against the hepatitis virus exist in the mouse serum. This method is relatively simple to operate and has low cost, but may miss the detection of mice in the early stage of infection that have not yet produced antibodies. Molecular biology detection usually uses PCR (polymerase chain reaction) technology to detect viral nucleic acids carried in mouse tissues or feces. This method has high sensitivity and strong specificity, and can detect viruses in the early stage of infection, and is one of the commonly used methods for detecting mouse hepatitis virus. However, PCR technology requires a thermal cycle amplification device, and has high requirements for laboratory conditions and the professional level of operators, making it difficult to achieve rapid on-site detection. In addition, virus isolation and culture method can also be used for detection. Suspected infected mouse tissues or fecal samples are subjected to virus isolation and culture. If the virus can be successfully cultured and infect cells, it can be confirmed to be infected. Virus isolation and culture technology is the “gold standard” for diagnosing viral infection, but the operation is complex, the experimental period is long, and the laboratory conditions are demanding, which cannot meet the demand for rapid detection.

[0004] With the continuous development of biotechnology, isothermal nucleic acid amplification technology and CRISPR technology gradually stand out. RPA technology has the advantages of fast reaction speed, high amplification efficiency, low equipment requirement, etc., and is currently widely used in the field of nucleic acid detection. CRISPR technology is a revolutionary gene editing tool in the field of life sciences in recent years, with the characteristics of precision, efficiency and simplicity. Nucleic acid detection based on Cas nuclease relies on RNA-mediated Cas12a cleavage activity. When the relevant DNA or RNA target fragment appears, the activated Cas nuclease will cut the single-stranded non-specific nucleic acid sequence. Therefore, the target DNA can be detected by detecting the fluorescence of the non-specific single-stranded DNA fluorescent group. However, in nucleic acid detection, a small amount of target fragment in the sample needs to be amplified before the Cas nuclease cleavage reaction is carried out. Therefore, the combination of RPA isothermal amplification technology and CRISPR / Cas12a technology can realize the rapid and convenient detection of mouse hepatitis virus.

[0005] Currently, the RPA-CRISPR / Cas12a detection method has been applied to the detection of pathogenic microorganisms such as Toxoplasma gondii, respiratory syncytial virus, and Salmonella, but there is no RPA-CRISPR / Cas12a rapid detection method for mouse hepatitis virus. Because Cas12a has very high cis cleavage activity, in the RPA combined with CRISPR / Cas12a detection method, the very high cis cleavage activity of Cas12a may destroy a small amount of nucleic acid template, thereby inhibiting the RPA amplification reaction, causing the fluorescence signal to weaken, affecting the sensitivity of the detection, and making it more difficult to detect low concentrations of mouse hepatitis virus. Secondly, the traditional RPA-CRISPR / Cas12a two-step detection method mainly consists of RPA amplification and subsequent two-step reactions of CRISPR / Cas12a. This two-step reaction needs to open the reaction tube and perform pipetting operation, and the liquid transfer step is easy to cause aerosol pollution, which in turn leads to false positive results, affecting the accuracy of the detection results. The recognition of Cas12a to general double-stranded DNA (dsDNA) substrate needs PAM sequence dependence, which also limits its universality, and the recognition of single-stranded DNA (ssDNA) substrate has universality but poor specificity. Therefore, when detecting mouse hepatitis virus, the specificity of the detection and the universality to different virus strains may be affected due to the limitation of the target sequence. In addition, the one-step reaction method has a greater difficulty in system optimization, and the combination of RPA amplification and CRISPR / Cas12a detection needs to optimize the reaction conditions of both, including temperature, time, reagent concentration, etc. Different mouse hepatitis virus samples may have different characteristics, and it is difficult to find a universal optimal reaction system, otherwise it may affect the detection effect. In summary, there is a difficulty in establishing the RPA-CRISPR / Cas12a rapid detection method for mouse hepatitis virus. Through the establishment of the RPA-CRISPR / Cas12a rapid detection method for mouse hepatitis virus, the clinical detection level of the laboratory and the experimental animal breeding institution can be effectively improved, the quality of experimental animals can be improved, and the safety of experimental animals can be better guaranteed. In addition, it also provides a reference for the optimization of detection technology for other viruses. SUMMARY

[0006] To solve the problems in the prior art, one of the purposes of the present application is to provide a sequence combination for rapid detection of mouse hepatitis virus based on CRISPR / Cas12a-RPA, which comprises RPA primer pair sequence, crRNA sequence and ssDNA probe sequence. The RPA primer pair sequence is: The upstream primer is CATTATACTACTCTTTATTACTATCATACT. The downstream primer is GTCCTGATAAACAACCTTATGCTATTAACAAA. The crRNA sequence is: UAAUUUCUACUAAGUGUAGAUAAUUGCGUGUAUGCGCUAAA. The ssDNA probe sequence is: tgtgtatcttggattttctatagtgtttactat(FAM-dT)(THF)(BHQ1-dT)agtgtccattgtaa-C3 Spacer.

[0007] The second object of the application is to provide a rapid detection kit for mouse hepatitis virus, which comprises RPA primer pair sequences, crRNA sequences and ssDNA probe sequences.

[0008] Preferably, the kit further comprises a mouse hepatitis virus negative control standard, RNase-free water, an RPA reaction buffer, an NEB buffer, Lba Cas12a nuclease, a dry powder RPA reaction microsphere containing a recombinase polymerase and magnesium acetate with a concentration of 280 mM.

[0009] The kit comprises a reaction system for performing RPA amplification reaction and a system for performing CRISPR / Cas12a reaction.

[0010] The rapid detection kit for mouse hepatitis virus is used in the detection of mouse hepatitis virus.

[0011] A method for rapidly detecting mouse hepatitis virus, comprising the following steps: (1) extracting total RNA from the sample to be detected, and reverse transcribing the total RNA into cDNA; (2) preparing an RPA reaction system using the cDNA as a template; (3) preparing a CRISPR / Cas12a reaction premix system; (4) adding the CRISPR / Cas12a reaction premix system to the wall of the RPA reaction system, mixing well and incubating, and then judging the detection result according to the fluorescence intensity, if the fluorescence intensity of the detection system is higher than that of the negative control, the sample is judged to be positive, indicating that the sample contains mouse hepatitis virus, if the fluorescence intensity of the detection system is similar to that of the negative control, the sample is judged to be negative, indicating that no mouse hepatitis virus is detected in the sample.

[0012] Preferably, the sample to be detected in step (1) is mouse feces, mouse liver, mouse lung or mouse brain tissue.

[0013] Preferably, the preparation method of the RPA reaction system in step (3) is as follows: 29.5 microliters of RPA reaction buffer, 2.4 microliters of upstream primer, 2.4 microliters of downstream primer, 13.2 microliters of cDNA and nuclease-free water are fully mixed, then the dry powder RPA reaction microspheres containing recombinant enzyme polymerase are added, and 2.5 microliters of 280 mM magnesium acetate is added after fully resuspending and mixing.

[0014] Preferably, the preparation method of the CRISPR / Cas12a reaction premix system in step (4) is as follows: 5 microliters of NEB buffer, 5-8 microliters of crRNA, 4-5 microliters of fluorescent probe and 3 microliters of Lba Cas12a nuclease are fully mixed.

[0015] Preferably, the incubation condition in step (4) is 40-42 DEG C constant temperature reaction for 40-60 minutes. The beneficial effects of the present application are as follows: (1) Good primer conservation and specificity: the primers or probes designed based on the conserved region of the mouse hepatitis virus MHV M gene can specifically detect different MHV strains, avoiding missed detection due to strain variation; after subsequent actual detection and analysis, the primers are determined to have good specificity and do not have cross-reaction with other non-homologous coronaviruses; detection of different concentrations of viral nucleic acid templates can also determine that the detection sensitivity of the primers is good, and the lowest can detect 10 2 copies / microliter of virus.

[0016] (2) Reduce aerosol pollution in the detection process: the traditional RPA-CRISPR / Cas12a detection method mainly consists of two steps of initial amplification reaction and subsequent addition of CRISPR / Cas12a components. This two-step reaction needs to open the reaction tube and perform pipetting operation, and the liquid transfer step is easy to cause aerosol pollution, which further leads to false positive results and affects the accuracy of subsequent detection. Therefore, the present detection method adopts one-tube reaction step, and the RPA reaction premix and the CRISPR / Cas12a reaction premix are prepared in advance, the RPA reaction premix is added to the dry powder RPA reaction microspheres containing recombinant enzyme polymerase, and the CRISPR / Cas12a reaction premix is added to the wall of the tube, the two reaction liquids are mixed, the reaction is activated, and the reaction is placed on a metal bath for constant temperature reaction. During the reaction, the reaction tube does not need to be opened again, which reduces the possibility of aerosol pollution and reduces the generation of false positive results.

[0017] (3) Realize fast detection: the fast amplification characteristics of RPA are combined with the fast detection characteristics of CRISPR / Cas12a, the whole detection process can be completed in 1 hour, the detection period is greatly shortened, the demand of fast detection of mouse hepatitis virus in clinical and laboratory research can be met, the infected mouse can be found in time, and the corresponding prevention and control measures can be taken, at the same time, the RPA amplification reaction only needs to be reacted under constant temperature conditions, the thermal cycle process of conventional PCR detection is not needed, and the one-step detection method of RPA-CRISPR / Cas12a is simple to operate, the professional level requirement of the operator is low, the requirement of the instrument equipment is low. After detection, the complex subsequent analysis process of the detection result is not needed, only the fluorescence detector or the naked eye observation of the fluorescence signal can be used to judge the result, so that the application in the primary laboratory and the on-site detection can be promoted. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 It is the agarose gel electrophoresis result of the PCR product of different primers in embodiment 1, in the figure, M is DL2000; 1 is the amplification product of F1-R1; 2 is the amplification product of F2-R2; 3 is the amplification product of F3-R3.

[0019] Figure 2 It is the RPA-CRISPR / Cas12a detection result of different primers in embodiment 1, in the figure, 1 is the reaction product of F1-R1; 2 is the reaction product of F2-R2; 3 is the reaction product of F3-R3.

[0020] Figure 3 It is the fluorescence level of the RPA-CRISPR / Cas12a detection of different primers in embodiment 1, in the figure, 1 is the reaction product of F1-R1; 2 is the reaction product of F2-R2; 3 is the reaction product of F3-R3.

[0021] Figure 4 It is the detection result of the mouse hepatitis virus positive sample in embodiment 3.

[0022] Figure 5 It is the RPA-CRISPR / Cas12a detection result of different reaction temperatures in embodiment 4.

[0023] Figure 6 It is the fluorescence level of the RPA-CRISPR / Cas12a detection of different reaction temperatures in embodiment 4.

[0024] Figure 7 It is the RPA-CRISPR / Cas12a detection result of different reaction times in embodiment 4.

[0025] Figure 8 It is the fluorescence level of the RPA-CRISPR / Cas12a detection of different reaction times in embodiment 4.

[0026] Figure 9 RPA-CRISPR / Cas12a detection results of different coronaviruses in Example 5.

[0027] Figure 10 Fluorescence levels of RPA-CRISPR / Cas12a detection of different coronaviruses in Example 5.

[0028] Figure 11 RPA-CRISPR / Cas12a detection results of different viral loads in Example 6.

[0029] Figure 12 Fluorescence intensity of RPA-CRISPR / Cas12a detection of different viral loads in Example 6.

[0030] Figure 13 PCR detection results of clinical samples in Example 7, where 1-9 are different mouse fecal cDNA samples; 10 is a negative control.

[0031] Figure 14 RPA-CRISPR / Cas12a detection results of clinical samples in Example 7, where 1-9 are different mouse fecal cDNA samples; 10 is a negative control.

[0032] Figure 15 Fluorescence levels of RPA-CRISPR / Cas12a detection of clinical samples in Example 7, where 1-9 are different mouse fecal cDNA samples; 10 is a negative control. DETAILED DESCRIPTION

[0033] The technical solutions provided by the present application will be described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present application.

[0034] Main reagents: Twist AmpTM Basic kit (TABAS03KIT, purchased from TwistDX Company in the United Kingdom), mouse hepatitis virus positive nucleic acid standard (purchased from Suzhou Xishan Detection Company), mouse hepatitis virus negative control standard (purchased from Suzhou Xishan Detection Company), porcine transmissible gastroenteritis virus positive nucleic acid standard (purchased from Beijing Zhongke Gene Co., Ltd.), TIANGEN plasmid extraction kit (DP123), Eastep Super total RNA extraction kit (purchased from Prolmage Biological Reagent Co., Ltd.), Eastep RT Master Mix Kit reverse transcription kit (purchased from Prolmage Biological Reagent Co., Ltd.), Lba Cas12a nuclease (purchased from NEB Biotechnology Co., Ltd.), crRNA (synthesized by Shanghai Shengong Biological Company), fluorescent probe (synthesized by Shanghai Shengong Biological Company). Example 1 Design, synthesis and screening of RPA amplification primers The conserved region of the M gene of the mouse hepatitis virus MHV-A59 strain (AY910861.1) in GenBank was used as the target gene, and specific RPA amplification primers were designed. A total of three pairs of primers were designed and synthesized, and the primer sequences are shown in Table 1.

[0035] Table 1: Sequences of three pairs of primers Primer screening: The synthesized primers were diluted to 10 µM, and 3 pairs of primers were used for PCR reaction respectively. After the completion of PCR reaction, the reaction products were subjected to agarose gel electrophoresis, and the best reaction primers were screened by electrophoresis results. The PCR reaction system is shown in Table 2, wherein the template is mouse hepatitis virus positive nucleic acid standard.

[0036] Table 2: PCR reaction system After the preparation of the PCR reaction system, the reaction tube was placed in the PCR instrument for reaction, 92℃ pre-denaturation for 30s, 92℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30s, denaturation to extension step for 35 cycles, 72℃ final extension for 5min, and the reaction product was subsequently subjected to agarose gel electrophoresis. The agarose gel electrophoresis results are shown in Figure 1 The reaction of the upstream primer M-F1 and the downstream primer M-R1 obtained a product with high concentration, strong specificity and good detection effect, so it was preliminarily determined to be used as the primer for the subsequent RPA-CRISPR / Cas12a detection system.

[0037] After further establishing the RPA-CRISPR / Cas12a detection method, the primers were screened again, and the detection results are shown in Figures 2-3As shown, it can be determined that the upstream primer M-F1 and the downstream primer M-R1 have the best detection effect, stronger fluorescence intensity, and higher relative fluorescence intensity value (Table 3), so this pair of primers will be used as the RPA-CRISPR / Cas12a one-step detection reaction primers in the future.

[0038] Table 3 RPA-CRISPR / Cas12a detection fluorescence level of different primers Example 2 crRNA and fluorescent probe design and synthesis crRNA design: According to the sequence of the RPA amplification product (5' cattatactactctttattactatcat actacagttcggttacacgagccgtagcatgtttatttatgttgtgaaaatgataatcttgtggttaatgtggccactgactattgttttgtgtattttcaattgcgtgtatgcgctaaataatgtgtatcttggattttctatagtgtttactatagtgtccattgtaatctggattatgtattttgttaatagcataaggttgtttatcaggac 3'), a crRNA complementary to the sequence is designed, which can guide the Cas12a protein to specifically recognize and bind the RPA amplification product. The designed crRNA sequence is: 5' UAAUUUCUACUAAGUGUAGAUAAUUGCGUGUAUGCGCUAAA 3' Fluorescent probe design: FAM fluorescent chromogenic group is modified at the 5' end of the ssDNA reporter molecule, BHQ I quenching group and blocking group are modified at the 3' end. When Cas12a forms a complex with crRNA and recognizes the PAM site (TTTC) and target sequence, it will start the formal cleavage activity to cut the target sequence, and the trans-cleavage activity will cut the ssDNA, so that the fluorescent group and the fluorescent quenching group are separated, the quenching effect is weakened, and the fluorescent group emits fluorescence. The designed fluorescent probe sequence is: tgtgtatcttggattttctatagtgtttactat(FAM-dT)(THF)(BHQ1-dT)agtgtccattgtaa-C3 Spacer.

[0039] Example 3 Preliminary establishment of RPA-CRISPR / Cas12a reaction system After the screening of primers, the RPA-CRISPR / Cas12a detection system was initially established. The RPA reaction premix and CRISPR / Cas12a reaction premix were prepared on ice. The composition of the RPA reaction system is shown in Table 4.

[0040] Table 4 RPA reaction premix system After preparation, 47.5 μL of RPA reaction premix was added to one tube of dry powder RPA reaction microspheres (one of the reagents in the Twist Amp™ Basic kit). The whole microspheres were resuspended by blowing and mixing. 2.5 μL of 280 mM magnesium acetate (MgOAc) (one of the reagents in the Twist Amp™ Basic kit) was added and mixed thoroughly. The reaction solution was concentrated at the bottom of the tube after a brief centrifugation, and the RPA reaction system was obtained.

[0041] The composition of the CRISPR / Cas12a reaction premix is shown in Table 5.

[0042] Table 5 CRISPR / Cas12a reaction premix system After the CRISPR / Cas12a premix was mixed thoroughly, it was added to the RPA reaction system. After a brief centrifugation, the reaction tube was placed in a metal bath and incubated at 42°C for 60 minutes. After incubation, the reaction tube was placed in a gel imager. The detection result could be judged according to the fluorescence intensity. If the fluorescence intensity of the detection system was higher than that of the negative control, the sample was judged to be positive, indicating that the sample contained mouse hepatitis virus. If the fluorescence intensity of the detection system was similar to that of the negative control, the sample was judged to be negative, indicating that no mouse hepatitis virus was detected in the sample. The detection results of the mouse hepatitis virus positive sample are shown in Figure 4 The fluorescence intensity of the positive sample was significantly higher than that of the negative control, indicating that the detection method was effective.

[0043] Example 4 Optimization of RPA-CRISPR / Cas12a reaction system Reaction temperature optimization: The RPA-CRISPR / Cas12a reaction system was prepared using the optimal primers selected in Example 3. The detection was performed at 34°C, 36°C, 38°C, 40°C, 42°C, and 44°C, respectively, and the reaction time was 40 min. After the reaction was completed, the gel imager was used for observation and the fluorescence intensity was detected by the enzyme label instrument. The detection results are shown in Figures 5-6 and Table 6. The fluorescence level was the highest and the relative fluorescence intensity was the strongest when the reaction temperature was 42°C. Therefore, the optimal reaction temperature was selected as 42°C according to the detection results.

[0044] Table 6 Fluorescence levels of RPA-CRISPR / Cas12a detection at different reaction temperatures Reaction time optimization: According to the above test results, 42°C is the optimal reaction temperature. The RPA-Cas12a reaction system is prepared using the optimal primer, and the reaction is carried out at 42°C. The reaction time is 20 min, 40 min, 60 min, and 80 min, respectively. After the reaction is completed, the fluorescence intensity is observed and detected by a gel imager. The detection results are shown in Table 6 and Table 7. The fluorescence level is the highest and the fluorescence intensity is the strongest when the reaction time is 60 min. Therefore, according to the detection results, the optimal reaction time can be determined as 60 minutes. In summary, the optimal reaction temperature of RPA-CRISPR / Cas12a one-tube reaction for detecting mouse hepatitis virus is 42°C, and the reaction time is 60 minutes. Figures 7-8

[0045] Table 7 Fluorescence levels of RPA-CRISPR / Cas12a detection at different reaction times Example 5 Method specificity detection Specificity experiment: The positive nucleic acid standard of mouse hepatitis virus, the negative control standard of mouse hepatitis virus, and the positive nucleic acid standard of other common coronaviruses such as bovine coronavirus (BCV), canine coronavirus (CCV), and porcine transmissible gastroenteritis virus (TGEV) were used as templates for detection according to the detection methods of Example 3-Example 4. The detection results are shown in Table 8 and Table 9. Only the positive control sample of mouse hepatitis virus showed a significant fluorescence signal and the relative fluorescence intensity value was significantly higher than that of other viruses and negative control samples. The fluorescence intensity of other species-derived coronaviruses was lower than that of the negative control sample of mouse hepatitis virus, indicating that the detection method has good specificity and can accurately distinguish mouse hepatitis virus from other viruses. Figures 9-10 Table 8 Fluorescence levels of RPA-CRISPR / Cas12a detection of different coronaviruses Example 6 Method sensitivity detection Sensitivity experiment: The positive nucleic acid standard of mouse hepatitis virus was diluted by 10 times gradient, and 10 4 , 10 3 ​​,10 2 ,10 copies / µL of serial dilution samples. The detection was performed according to the one-tube detection method of Example 3~Example 4 using these dilution samples as templates. The detection results are shown in Table 9 and Figure 2. Figures 11-12 and Table 9, the results show that the relative fluorescence intensity of the sample reaction at 10 2 copies / µL is higher than that of the negative control, so it is judged that the minimum detection limit of the detection method is 10 2 copies / µL, that is, it can detect 100 copies of mouse hepatitis virus nucleic acid per microliter of sample, indicating that the detection method has good sensitivity.

[0046] Table 9 RPA-CRISPR / Cas12a detection fluorescence intensity of different virus load Example 7 Clinical sample detection Several mice in the laboratory were selected, and their fresh fecal samples were collected. About 200 mg of fecal sample was added to a centrifuge tube containing 1 ml of fecal lysis solution, and shaken well to fully lyse the fecal sample. The lysed sample was centrifuged at 12000 rpm for 10 minutes, and the supernatant was transferred to a clean centrifuge tube. The total RNA in the fecal sample was extracted according to the instructions of the Eastep Super total RNA extraction kit. After the total RNA extraction was completed, the reverse transcription process was completed according to the operation process of the Eastep RT Master Mix Kit reverse transcription kit instructions, and the obtained cDNA sample was stored at -20℃ for standby.

[0047] According to the screening results of Example 1~Example 2, the primers, crRNA and fluorescent probes were synthesized, and the sequences are shown in Table 10.

[0048] Table 10 Sequence list The primers, crRNA and fluorescent probes shown in Table 10 were used to prepare RPA reaction premix and CRISPR / Cas12a reaction premix on ice, and the reaction system composition is shown in Table 4 (the mouse hepatitis virus positive control standard in Table 4 is replaced by the cDNA obtained in this embodiment).

[0049] After preparation, add 47.5 µL of the RPA reaction mix to the RPA dry powder reaction microspheres (one of the reagents in the Twist Amp™ Basic kit). Mix by pipetting until the microspheres are resuspended. Add 2.5 µL of 280 mM magnesium acetate (MgOAc) (one of the reagents in the Twist Amp™ Basic kit) and mix thoroughly. Centrifuge briefly to concentrate the reaction mixture at the bottom of the tube.

[0050] The CRISPR / Cas12a reaction premix system is shown in Table 5. The CRISPR / Cas12a premix was thoroughly mixed and added to the wall of the RPA reaction tube. After rapid centrifugation, the reaction tube was placed in a metal bath and incubated at 42°C for 60 minutes. After incubation, the reaction tube is placed in a gel imager for imaging. The test results can be judged based on the fluorescence intensity. If the fluorescence intensity of the detection system is higher than that of the negative control, the sample is judged to be positive, indicating that the sample contains mouse hepatitis virus. If the fluorescence intensity of the detection system is similar to that of the negative control, the sample is judged to be negative, indicating that mouse hepatitis virus is not detected in the sample. At the same time, to eliminate errors caused by naked eye observation and misjudgment of weakly positive samples, the relative fluorescence intensity can also be measured using a microplate reader. If the value is higher than that of the negative sample, it can be judged as positive; if the value is lower than the negative control, it is judged as negative.

[0051] Analysis of test results: The RPA-CRISPR / Cas12a one-tube reaction method was used for detection. At the same time, the samples were detected by PCR (PCR reaction was carried out according to Example 1), and the detection results of the two methods were compared. A total of 10 samples were tested, of which No. 1 to No. 9 were nucleic acid samples extracted from mouse feces, and No. 10 was a mouse hepatitis virus negative standard. According to the PCR results, Figure 13 As shown, samples 2, 6, and 7 were judged to be positive for mouse hepatitis virus. The results of the RPA-CRISPR / Cas12a one-step detection method are as follows Figure 14 As shown, samples No. 2, No. 6, and No. 7 can be judged to be mouse hepatitis virus positive. According to the fluorescence intensity data in Table 11, the relative fluorescence intensity of sample No. 1 is slightly higher than that of the mouse hepatitis virus negative sample, so it is judged to be a suspicious sample. The detection results of this method are consistent with the PCR detection results, so the detection effect is good and can be used in clinical practice.

[0052] Table 11 Fluorescence intensity of clinical samples detected by RPA-CRISPR / Cas12a Through the verification of the above specific embodiments, the sequence combination for rapidly detecting mouse hepatitis virus based on RPA-CRISPR / Cas12a and the application thereof have the advantages of rapidness, sensitivity, strong specificity, simple operation and the like, and can be effectively applied to the detection of mouse hepatitis virus, thereby providing strong technical support for mice and related scientific research work.

Claims

1. A sequence combination for rapid detection of mouse hepatitis virus based on CRISPR / Cas12a-RPA, characterized by: The sequence combination includes RPA primer pair sequence, crRNA sequence, and ssDNA probe sequence; The RPA primer pair sequences are: Upstream primer: CATTATACTACTCTTTATTACTATCATACT; Downstream primer: GTCCTGATAAACAACCTTATGCTATTAACAAA; The crRNA sequence is: UAAUUUCUACUAAGUGUAGAUAAUUGCGUGUAUGCGCUAAA; The ssDNA probe sequence is: tgtgtatcttggattttctatagtgtttactat(FAM-dT)(THF)(BHQ1-dT)agtgtccattgtaa-C3Spacer.

2. A rapid detection kit for mouse hepatitis virus, characterized in that: The kit comprises the sequence combination for rapid detection of mouse hepatitis virus based on CRISPR / Cas12a-RPA according to claim 1.

3. The rapid detection kit for mouse hepatitis virus according to claim 2, characterized in that: The kit also contains a mouse hepatitis virus negative control standard, RNase-free water, RPA reaction buffer, NEB buffer, Lba Cas12a nuclease, dry powder RPA reaction microspheres containing recombinase polymerase, and 280 mM magnesium acetate.

4. The rapid detection kit for mouse hepatitis virus according to claim 2 or 3, characterized in that: The kit includes a reaction system for performing an RPA amplification reaction and a system for performing a CRISPR / Cas12a reaction.

5. Use of the rapid detection kit for mouse hepatitis virus according to any one of claims 2 to 4 in detecting mouse hepatitis virus.

6. The use according to claim 5, characterized in that: The steps for detecting mouse hepatitis virus are as follows: (1) Extract total RNA from the sample to be tested and reverse transcribe the total RNA into cDNA; (2) Prepare the RPA reaction system using cDNA as template; (3) Prepare the CRISPR / Cas12a reaction premix system; (4) Add the CRISPR / Cas12a reaction premix system to the wall of the RPA reaction system tube, mix well, and incubate. After incubation, judge the test result based on the fluorescence intensity. If the fluorescence intensity of the detection system is higher than that of the negative control, the sample is judged to be positive, indicating that the sample contains mouse hepatitis virus. If the fluorescence intensity of the detection system is similar to that of the negative control, the sample is judged to be negative, indicating that mouse hepatitis virus is not detected in the sample.

7. The use according to claim 6, characterized in that: The sample to be tested in step (1) is mouse feces, mouse liver, mouse lung or mouse brain tissue.

8. The use according to claim 6, characterized in that: The preparation method of the RPA reaction system in step (3) is as follows: 29.5 µL of RPA reaction buffer, 2.4 µL of upstream primer, 2.4 µL of downstream primer and 1 µg of cDNA are mixed, and RNase-free water is added to 47.5 µL and mixed thoroughly. After mixing, the mixture is added to the dry powder RPA reaction microspheres containing recombinase polymerase, and after fully resuspending and mixing, 2.5 µL of 280 mM magnesium acetate is added.

9. The use according to claim 6, characterized in that: The preparation method of the CRISPR / Cas12a reaction premix system in step (4) is as follows: 5µL of NEB buffer, 5-8µL of crRNA, 4-5µL of fluorescent probe and 3µL of Lba Cas12a nuclease are thoroughly mixed.

10. The use according to claim 6, characterized in that: The incubation condition in step (4) is a constant temperature reaction at 40-42°C for 40-60 minutes.

Images