Soybean TFL1a gene and knockout method and application thereof

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a soybean TFL1a gene and a knockout method and application thereof. The soybean TFL1a gene is edited through a CRISPR / Cas9 technology, a homozygous mutation experience is constructed to prove the function of the soybean TFL1a gene, and it is found that the gene regulates the number of soybean main stem nodes, the number of mutant strain nodes is increased, and the yield is increased. The method has the advantages that on the aspect of gene function analysis, the core function of the gene is determined, a plant type regulation gene pool is supplemented, and functional genomics research is deepened; in the aspect of high-quality germplasm innovation, the mutant breaks through the limitation of traditional breeding and provides a high-quality material for variety improvement; in industrial application, molecular targets and technical paths for plant type improvement and yield increase are provided, the number of sections can be directionally optimized, benefits can be improved, reference is provided for molecular design breeding, and the method is of great significance in germplasm creation, plant type change and yield increase.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a soybean TFL1a gene and a knockout method and application thereof. Background Art

[0002] The number of nodes in the soybean main stem is an important agronomic trait and a significant factor directly affecting the yield of soybean plants. The development of the soybean main stem can be divided into two stages: (1) the vegetative growth stage, in which leaf primordia are produced on both sides of the apical meristem (SAM) and axillary meristems are produced in the leaf axils; (2) the reproductive growth stage, in which the apical / axillary meristems transform into the inflorescence meristem (IM), which then differentiates into the lateral floral meristem (FM), which then produces flower buds. Plant morphology is determined by the properties and differentiation of the meristems, and is regulated and interacted by the genes of the vegetative apical meristem, inflorescence meristem, and floral meristem. The Terminal Flower 1 (TFL1) gene regulates the properties and differentiation of the apical meristem and acts as a suppressor of developmental stage transitions (Benlloch R, Berbel A, Serrano-Mislata A, et al. (2007) Floral Initiation and inflorescence architecture: a comparative view. Annals of Botany 100: 659-676.). In Arabidopsis tfl1 mutant plants, the apical inflorescence meristem prematurely transforms into the floral meristem, while indeterminate inflorescences transform into determinate inflorescences. Four TFL1 homologs exist in soybean: TFL1a, TFL1b (Dt1), TFL1c, and TFL1d. It has been reported that TFL1b can participate in the regulation of main stem development, flowering time and yield formation (Yue L., Li X., Fang C., Chen LY, Yang H., Yang J., Chen Z., Nan H., Chen L., Zhang Y., Li H., Hou X., Dong Z., Weller JL, Abe J., Liu B., Kong F. (2021) FT5a interferes with the Dt1-AP1 feedback loop to control flowering time and shoot determination in soybean. Journal of Integrative Plant Biology 00: 1-19.).TFL1c and TFL1d can be involved in regulating flowering time (Wang LS, Lin C, Li B, et al. (2023) Two soybean homologues of TERMINAL FLOWER 1 control flowering time under long day conditions. The Crop Journal 11: 704-712.). However, there are no reports on the role of the TFL1a gene in main stem development and yield formation.

[0003] CRISPR / Cas9-mediated gene editing is an accurate, rapid, and highly efficient genome editing technology developed in recent years. In this system, a designed target sequence is transcribed into a guide RNA (gRNA) within the cell. Guided by the gRNA, the endonuclease Cas9 recognizes the target gene and cleaves it, creating double-stranded DNA breaks. This triggers the cell's self-repair mechanism, which can cause insertions, deletions, or substitutions, disrupting the function of the target gene. Continuous improvements in CRISPR / Cas9 technology have made gene editing in soybeans simpler and faster. Therefore, leveraging CRISPR / Cas9 to uncover new functions for the TFL1a gene in soybean breeding would be of significant application value. Summary of the Invention

[0004] In order to overcome the shortcomings of the above-mentioned existing technologies, the present invention explored whether the soybean TFL1a gene is involved in regulating the number of main stem nodes and other functions. The soybean TFL1a gene (Glyma.03G194700) was targeted edited using CRISPR / Cas9 technology, and a TFL1a homozygous mutant was successfully constructed. The function of the soybean TFL1a gene in regulating the number of soybean main stem nodes was verified, which is of great significance for creating germplasm resources to change the plant type of soybean varieties and increase soybean yield.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] In a first aspect, the present invention provides an application of the TFL1a gene in regulating the number of nodes on the main stem of soybeans, that is, soybean plants with mutations in the TFL1a gene have increased number of nodes on the main stem.

[0007] The second aspect of the present invention provides the use of the TFL1a gene in increasing soybean yield, that is, soybean plants with TFL1a gene mutations have more main stem nodes and increased yield.

[0008] Preferably, the soybean plants after TFL1a gene mutation include mutants with G inserted in the second exon region of TFL1a gene, and mutants with TTG deleted in the second exon region of TFL1a gene and TT deleted in the third exon region of TFL1a gene.

[0009] Preferably, the soybean variety includes soybean Williams 82.

[0010] A third aspect of the present invention provides a method for breeding high-yield soybean varieties, which can also be referred to as a method for breeding soybeans with a large number of main stem nodes. Specifically, the method comprises editing the soybean TFL1a gene using CRISPR / Cas9 technology to construct a TFL1a homozygous mutant.

[0011] Preferably, the method for cultivating high-yield soybean varieties comprises the following steps:

[0012] S1. Two target sites, T1 and T2, were designed based on the exon sequence of the TFL1a gene. Two pairs of target primers were also designed. The target double-stranded linker was ligated to the gRNA expression cassette. After two rounds of PCR, the gRNA expression cassette was ligated to the pYLCRISPR / Cas9 vector. Escherichia coli competent cells were then transformed. After positive clone screening and plasmid extraction, a CRISPR / Cas9 knockout vector, pYLCRISPR / Cas9-TFL1a-T1T2 plasmid, containing the soybean TFL1a gene editing target sites T1 and T2, was constructed.

[0013] S2. The pYLCRISPR / Cas9-TFL1a-T1T2 plasmid was transformed into Agrobacterium competent cells. After culture, positive single clones were screened. Then, soybeans were stably transformed by Agrobacterium infection. After that, T0 generation transgenic positive plants were screened. After subculture, soybean TFL1a homozygous mutant strains were obtained.

[0014] More preferably, the sequence of target T1 is shown as SEQ ID NO.9, and the sequence of target T2 is shown as SEQ ID NO.10.

[0015] Furthermore, the target primers for target T1 are shown as SEQ ID NO.11 and SEQ ID NO.12, and the target primers for target T2 are shown as SEQ ID NO.13 and SEQ ID NO.14.

[0016] More preferably, the primers used in the first round of PCR include UF shown in SEQ ID NO.1 and gRNA-R shown in SEQ ID NO.2; for target site T1, the primers used in the second round of PCR include B1' shown in SEQ ID NO.3 and B2 shown in SEQ ID NO.4; for target site T2, the primers used in the second round of PCR include B2' shown in SEQ ID NO.5 and BL shown in SEQ ID NO.6.

[0017] More preferably, in step S2, soybean cotyledonary nodes are used as explants for Agrobacterium infection.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] This study used CRISPR / Cas9 technology to edit the soybean TFL1a gene, constructing a homozygous mutant to verify its function. The study found that the gene is involved in regulating the number of nodes on the soybean main stem. Plants with this gene mutation had an increased number of nodes and yield. This discovery is of great significance for developing germplasm resources to modify soybean plant types and increase soybean yield. Specifically, the present invention has the following advantages:

[0020] (1) In terms of gene function analysis, the core role of this gene in regulating the number of main stem nodes was clarified, which laid the foundation for exploring its potential functions, supplemented the soybean plant type regulation gene library, provided direct evidence for revealing the relationship between growth and development and yield, and deepened the research on soybean functional genomics.

[0021] (2) In terms of high-quality germplasm innovation, the mutants obtained have many nodes and high yield, breaking through the limitations of traditional breeding, realizing the directional creation of germplasm, providing high-quality materials for variety improvement, and accelerating the breeding process.

[0022] (3) In terms of industrial application, it provides molecular targets and technical pathways for plant type improvement and yield increase, which can optimize the number of nodes to adapt to the environment, increase yield stably, improve production efficiency, ensure supply, and provide reference for molecular design breeding of crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The electrophoresis diagram of the knockout vector construction; A is the first and second round PCR products of sgRNA expression cassette amplification (1-1 and 1-2 are the first and second round PCR products of Target1 sgRNA expression cassette amplification, 2-1 and 2-2 are the first and second round PCR products of Target2 sgRNA expression cassette amplification); B is the electrophoresis diagram of Escherichia coli DH5α colony PCR products (1, 2, 3, 4, 5, 6, 7, 8 are colony numbers); M is a 2kb DNA ladder.

[0024] Figure 2Schematic diagram of the Cas9 sgRNA expression vector with inserted editing sites T1 and T2; Schematic diagram of the Cas9 sgRNA expression vector, which is an expression vector with the pYLCRISPR / Cas9 vector as the backbone, carrying the herbicide (Bar) gene, Cas9 gene, AtU3d promoter, target site T1, target site T2 and sgRNA.

[0025] Figure 3 The editing effect of the target site was detected in transgenic hairy roots. The products of transgenic hairy roots amplified by target detection primers were sequenced, and the peaks near the target site were double peaks.

[0026] Figure 4 Screening map of T0 generation transgenic positive plants (1, 2, 3, 4, 5 are numbers of different lines); PCR product of plasmid backbone fragment, M is 2kb DNA ladder.

[0027] Figure 5 The results of screening for stable homozygous TFL1a mutants in the T1 generation; the sequencing peak diagram of the PCR product of the TFL1a gene fragment near the target site.

[0028] Figure 6 These are the phenotypic identification results of a stable homozygous soybean mutant of TFL1a. DETAILED DESCRIPTION

[0029] The following is a further description of specific embodiments of the present invention. It should be noted that the description of these embodiments is intended to facilitate understanding of the present invention and does not constitute a limitation of the present invention. In addition, the technical features involved in the various embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

[0030] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0031] The present invention uses the pYLCRISPR / Cas9 vector as a backbone to construct a Cas9 gRNA vector pYLCRISPR / Cas9-TFL1a-T1T2 inserted with the soybean TFL1a gene editing target sites T1 and T2, and transfects it into Agrobacterium K599 competent cells. Single clones are selected for PCR detection to confirm that pYLCRISPR / Cas9-TFL1a-T1T2 is successfully transfected. Then, soybean cotyledons are infected, and soybean cotyledon root hair DNA is extracted. PCR is used to identify the editing efficiency of the editing site.

[0032] In order to comprehensively and clearly present the technical solutions and significant advantages of the present invention, the present invention is described in detail below in conjunction with specific embodiments.

[0033] Example 1: Construction of a CRISPR / Cas9 knockout vector inserted with soybean TFL1a gene editing target sites T1 and T2

[0034] 1. Sources of main reagents and materials

[0035] Escherichia coli (E. coli) DH5α was purchased from Kangti Life Science. The gRNA vector and pYLCRISPR / Cas9 vector were constructed and maintained in our laboratory (for details, see the reference “Ma X., Zhang Q., Zhu Q., Liu W., Chen Y., Qiu R., Wang B., Yang Z., et al., A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants, Mol. Plant 8 (2015) 1274–1284.”). An endotoxin-free plasmid extraction kit was purchased from Kangwei Century; an agarose gel recovery kit was purchased from Quanshijin; KOD Plus Neo enzyme, Master Taq mix, restriction endonuclease Bsa I, T4 DNA ligase, CutSmart Buffer, kanamycin, spectinomycin, and DNAmaker were purchased from TaKaRa. Sequencing and primer synthesis were performed by Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd.

[0036] The adapter primers are as follows:

[0037] UF: 5'CTCCGTTTTACCTGTGGAATCG 3' (SEQ ID NO. 1);

[0038] gRNA-R: 5'CGGAGGAAAATTCCATCCAC 3' (SEQ ID NO. 2);

[0039] B1':5'TTCAGAGGTCTCTctcgACTAGTGGAATCGGCAGCAAAGG 3' (SEQ ID NO.3);

[0040] B2: 5'AGCGTGGGTCTCGtcagGGTCCATCCACTCCAAGCTC 3' (SEQ ID NO. 4);

[0041] B2':5'TTCAGAGGTCTCTctgaCACTGGAATCGGCAGCAAAGG 3' (SEQ ID NO.5);

[0042] BL: 5'AGCGTGGGTCTCGaccgACGCGTCCATCCACTCCAAGCTC 3' (SEQ ID NO. 6).

[0043] The sequencing primers are as follows:

[0044] SP1:5'GTCGGTGCTCCACATGTTGACC 3' (SEQ ID NO.7);

[0045] SP3: 5'TGCAATAACTTCGTATAGGCT 3' (SEQ ID NO. 8).

[0046] 2. Target primer design

[0047] Using the Glycine max Wm82.a6.v1 genome as a reference and the TFL1a (Glyma.03G194700) gene sequence from the Phytozome database (Phytozome(doe.gov)) (https: / / phytozome-next.jgi.doe.gov / ), we designed targets on the CRISPRdirect website (http: / / crispr.dbcls.jp). We found a 23-bp target sequence, Target1 (ATCTGAGAGAGCACTTGCACTGG, SEQ ID NO. 9), located in the second exon of TFL1a, and a 23-bp target sequence, Target2 (CAACAGATGCCACATTTGGTAGG, SEQ ID NO. 10), located in the third exon of TFL1a. Target primers were designed based on the target sequences.

[0048] The target primers are as follows:

[0049] T1F: 5'gtcATCTGAGAGAGCACTTGCAC 3' (SEQ ID NO. 11);

[0050] T1R: 5'aaacGTGCAAGTGCTCTCTCAGA 3' (SEQ ID NO. 12);

[0051] T2F: 5'gtcaCAACAGATGCCACATTTGGT 3' (SEQ ID NO. 13);

[0052] T2R: 5'aaacACCAAATGTGGCATCTGTTG 3' (SEQ ID NO. 14).

[0053] 3. Operation steps (1) Connection and amplification of target linker and gRNA expression cassette

[0054] 1) Amplification of target double-stranded adapters: Add T1F and T1R to 0.5× TE to make a 100 μmol / L solution. Take 1 μL of each forward and reverse primer and add them to a PCR tube. Add 98 μL of ddH2O to make 100 μL. Place the tube in a PCR instrument and set the PCR program to 90°C for 30 seconds. Cool and anneal at room temperature.

[0055] Add T2F and T2R to 0.5×TE to make a 100 μmol / L solution, take 1 μL of the forward and reverse primers respectively and add them to the PCR tube, add 98 μL ddH2O to 100 μL, then place it in the PCR instrument and set the PCR program to 90℃, 30s, and cool to room temperature for annealing.

[0056] 2) Enzymatic ligation of the double-stranded adapter and the gRNA expression cassette. Prepare a 10 μL enzyme ligation reaction system: 2 μL of 10 ng / μL gRNA vector, 0.5 μL of 100 μmol / L target 1 or 2 double-stranded adapter, 0.5 μL of 10 U / μL Bsa I, 0.2 μL T4 DNA ligase, 1 μL of 10× NEB T4 DNA ligase buffer, 1 μL of 10× NEB Cut SmartBuffer, and 4.8 μL ddH2O. Then, set the PCR program to: 5 cycles, each cycle at 37°C for 5 min followed by 20°C for 5 min.

[0057] 3) 2nd round of PCR:

[0058] In the first round of PCR, amplify the gRNA expression cassette: first prepare 15μL PCR reaction system: 2μL of the PCR product in the second step, 0.3μL high-fidelity enzyme KOD Plus Neo, 1.5μL KOD Plus Neo Buffer, 0.6μL MgSO4, 1.5μL dNTPs, 10μmol / L UF 0.2μL, 10μmol / L gRNA-R 0.2μL, ddH2O is added to 15μL. Then set the PCR program to: 95℃2min; 10cycles—95℃15s, 55℃15s, 68℃10s; 20cycles—95℃15s, 60℃15s, 68℃10s, 16℃ insulation. Finally, perform 1% agarose gel electrophoresis to check whether the target band of about 500bp appears ( Figure 1 ).

[0059] In the second round of PCR, the gRNA with Target1 (the product of the first round of PCR) was connected to the specific linker to construct a complete expression cassette containing the promoter, target and gRNA: first prepare a 20μL reaction system: KOD Plus Neo Buffer 2μL, dNTPs Mix 2μL, KOD Plus Neo 0.4μL, B1' primer 0.15μL, B2 primer 0.15μL, first round PCR product dilution 1μL, and sterile water to 20μL. Then set the PCR program to: 95℃2min, 28cycles—95℃10s, 58℃15s, 68℃20s, and keep warm at 16℃. Finally, perform 1% agarose gel electrophoresis to check whether there is a 500bp band, recover the target band, and use Quick Gel Extraction Kit DNA gel rapid purification kit for purification ( Figure 1 ).

[0060] Connect the gRNA with Target2 (first round PCR product) to the specific linker to construct a complete expression cassette containing the promoter, target and gRNA: first prepare a 20μL reaction system: KOD Plus Neo Buffer 2μL, dNTPs Mix 2μL, KOD Plus Neo 0.4μL, B2' primer 0.15μL, BL primer 0.15μL, first round PCR product dilution 1μL, and sterile water to 20μL. Then set the PCR program to: 95℃2min, 28cycles—95℃10s, 58℃15s, 68℃20s, 16℃ insulation. Finally, perform 1% agarose gel electrophoresis to check whether there is a 500bp band, recover the target band, and use Quick Gel Extraction Kit DNA gel rapid purification kit for purification ( Figure 1 ).

[0061] (2) Connecting the gRNA expression cassette to the pYLCRISPR / Cas9 vector

[0062] Prepare a 15 μL reaction system: 1.5 μL Cut Smart Buffer, 0.5 μL CRISPR / Cas9 plasmid, and 1 μL BsaI. Add the purified product from the previous step (target 1 or 2) to a concentration of 60–70 ng / μL, and add ddH2O to bring the volume up to 15 μL. Set the PCR program to: 37°C for 5 minutes, 10°C for 5 minutes, 20°C for 5 minutes, and 37°C for 5 minutes, for 15 cycles.

[0063] (3) Transformation of E. coli competent cells

[0064] Add 10 μL of the ligation reaction solution from the previous step to competent E. coli DH5α cells. Incubate on ice for 30 minutes, then in a 42°C water bath for 30 seconds, and then in an ice bath for another 2 minutes. Add 500 μL of LB culture medium in a clean bench and incubate at 37°C with shaking at 220 rpm for 1 hour. Then, spread the culture medium onto LB solid medium containing spectinomycin (Table 1) and incubate at 37°C in a 37°C incubator for 12 hours.

[0065] (4) Screening of Escherichia coli positive clones

[0066] First, prepare a 10 μL reaction system: 5 μL Master Taq mix, 0.2 μL primers SP1 and SP3, 4.6 μL sterile water, and a small amount of colonies (not included in the volume). Then set the PCR program to: 95°C for 2 minutes; 35 cycles—95°C for 30 seconds, 58°C for 30 seconds, 72°C for 90 seconds; 72°C for 2 minutes. Finally, perform 1% agarose gel electrophoresis to check whether a target band of about 1000 bp appears. Select positive clones for sequencing, and extract plasmids from the positive clones with correct sequencing to obtain the pYLCRISPR / Cas9-TFL1a-T1T2 plasmid ( Figure 1 、 2 ).

[0067] Example 2: Hairy root transformation and target editing efficiency detection

[0068] 1. Sources of main reagents and materials

[0069] The soybean variety used was Glycine max L. Merrill Williams 82 (W82) (purchased commercially). Agrobacterium rhizogenes K599 was maintained in our laboratory (purchased from Kangti Life Science). Kanamycin, rifampicin, spectinomycin, and a DNA maker were purchased from TaKaRa. Yeast extract, agarose, MES, DMSO, sodium chloride, and other commonly used reagents were all domestically produced analytical grade. A DNA extraction kit was purchased from Kangwei Century. Sequencing and primer synthesis were performed by Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd.

[0070] Target detection primers are as follows:

[0071] Target-F:5'ACACTCCCTTTCCTCAGCAG 3'(SEQ ID NO.15);

[0072] Target-R: 5'TGTTTTTTTGTCACTCTCTCATC 3' (SEQ ID NO. 16).

[0073] 2. Operation steps (1) Transformation of soybean hairy roots in vitro

[0074] 1) Transform the pYLCRISPR / Cas9-TFL1a-T1T2 plasmid into Agrobacterium tumefaciens K599 competent cells, culture at 28°C for two days, and then perform colony PCR to screen positive single clones.

[0075] 2) Willam 82 soybean seeds were surface-sterilized with 10% H₂O₂ for 1 minute and then rinsed with sterile deionized water. The sterilized seeds were then sown in germination medium (Table 1) and cultured in a soybean climatic chamber for one week (25°C, 12 hr light / 12 hr dark).

[0076] 3) Agrobacterium rhizogenes K599 containing the target plasmid was cultured at 28°C to an OD of approximately 0.6. A scalpel was used to smear the bacterial solution and then a grid pattern was drawn on the front of the soybean cotyledons. The cotyledons were then placed on a rooting medium and cultured in a soybean artificial climate chamber for approximately 15 days.

[0077] (2) Target editing efficiency detection

[0078] Extract DNA from the hairy roots growing from soybean cotyledon callus and amplify the TFL1a gene fragment: First, prepare a 30 μL reaction system: 15 μL Master Taq mix, 2 μL Target-F primer, 2 μL Target-R primer, 10 μL sterile water, and 1 μL DNA template. Then set the PCR program as follows: 95 °C for 2 min; 35 PCR cycles - 95 °C for 30 s, 59 °C for 30 s, 72 °C for 1 min; finally, 72 °C for 2 min. Finally, sequence the PCR product and calculate the editing efficiency of the target according to the sequencing results. The sequencing results show that there are double peaks from the target point onwards, indicating that the designed target can effectively edit the coding region of the TFL1a gene. The editing efficiencies of target 1 and target 2 are 77% and 78% respectively( Figure 3 ).

[0079] Table 1 Medium Formulation

[0080]

[0081] Note: "-" represents no need to add.

[0082] Example 3: Creation of TFL1a Stable Homozygous Soybean Mutants

[0083] 1. Sources of Main Reagents and Materials

[0084] The soybean variety is cultivated soybean (Glycine max L. Merrill) Willams82 (W82), and the Agrobacterium tumefaciens EHA101 is preserved in this laboratory (purchased from Kangti Life Science and Technology). Basta is purchased from Coolaber Co., Ltd., and kanamycin, rifampicin, spectinomycin, and DNA maker are all purchased from TaKaRa Co., Ltd. Yeast extract, agarose, MES, DMSO, sodium chloride, and other common reagents are mostly domestic analytical pure. The DNA extraction kit is purchased from ComWin Biotech Co., Ltd.; sequencing and primer synthesis are commissioned to Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd. to complete.

[0085] The skeleton detection primers are as follows:

[0086] SP1: 5’GTCGTGCTCCACATGTTGACC 3’(SEQ ID NO.7);

[0087] SP3: 5’TGCAATAACTTCGTATAGGCT 3’(SEQ ID NO.8).

[0088] The target detection primers are as follows:

[0089] Target-F:5'ACACTCCCTTTCCTCAGCAG 3'(SEQ ID NO.15);

[0090] Target-R: 5'TGTTTTTTTGTCACTCTCTCATC 3' (SEQ ID NO. 16).

[0091] 2. Operation steps (1) Stable transformation of soybean

[0092] 1) Transform the pYLCRISPR / Cas9-TFL1a-T1T2 plasmid into Agrobacterium tumefaciens EHA101 competent cells, culture at 28°C for two days, and then perform colony PCR to screen positive single clones.

[0093] 2) Sterilized soybean Williams 82 (W82) seeds were sown in germination medium and cultured in a soybean climatic chamber for 3 days (25°C, 12 hr light / 12 hr dark). Cotyledonary nodes were used as explants for Agrobacterium infection and rooting (see Table 1 for the culture medium used). Progeny plants were screened for Basta (phosphinothricin) resistance to obtain T0 generation stably transformed plants.

[0094] (2) Screening of T0 generation transgenic positive plants

[0095] Extract DNA from fresh leaves of T0 generation transgenic soybeans and amplify plasmid backbone fragments: first prepare 10 μL reaction system: 5 μL Master Taq mix, 0.2 μL primers SP1 and SP3, 3.6 μL sterile water, 1 μL DNA template. Then set the PCR program to: 95℃2min; 35 cycles—95℃30s, 58℃30s, 72℃90s; 72℃2min. Finally, perform 1% agarose gel electrophoresis to check whether the target band of about 1000bp appears. The results showed that strains 1, 3, 4, 5, and 6 were positive strains, and strain 2 was negative ( Figure 4 ).

[0096] (3) Screening of stable homozygous TFL1a mutants in the T1 generation

[0097] After harvesting seeds from the positive T0 plants, DNA was extracted from leaves of the T1 plants. The plasmid backbone fragment and the TFL1a gene fragment were amplified, and the PCR products were sequenced. The TFL1a gene fragment amplification method was as follows: A 30 μL reaction system was prepared: 15 μL Master Taq mix, 0.6 μL Target-F primer, 0.6 μL Target-R primer, 11.8 μL sterile water, and 2 μL DNA template. The PCR program was then set as follows: 95°C for 2 minutes; 35 cycles of 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 1 minute; and finally, 72°C for 2 minutes. The results showed that homozygous soybean TFL1a strains without the cas9 backbone were obtained, among which the tfl1a-1 strain had a 1bp insertion in the second exon (site 469, G); the tfl1a-2 strain had a 3bp deletion in the second exon (sites 467-469, TTG) and a 2bp deletion in the third exon (sites 983-984, TT) ( Figure 5 ).

[0098] Example 4: Phenotypic Identification of Stable Homozygous TFL1a Soybean Mutants

[0099] In July 2023, homozygous mutants tfl11a-1, tfl11a-2 and the control Williams82 (W82) were planted in the soybean field test base in Conghua District, Guangzhou (natural short-day conditions), and the number of nodes and yield phenotypes were counted at maturity. The results showed that tfl1a-1 and tfl1a-2 had more nodes and higher yield than W82 ( Figure 6 ).

[0100] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. It is apparent to those skilled in the art that various changes, modifications, substitutions, and variations of these embodiments may be made without departing from the principles and spirit of the present invention, and the changes still fall within the scope of protection of the present invention.

Claims

1. Application of TFL1a gene in regulating the number of nodes of soybean main stem, characterized in that: Soybean plants with TFL1a gene mutation have more main stem nodes.

2. Application of TFL1a gene in increasing soybean yield, characterized in that: Soybean plants with TFL1a gene mutations have more main stem nodes and higher yields.

3. The use according to claim 1 or 2, characterized in that Soybean plants with TFL1a gene mutations include mutants with G inserted in the second exon of the TFL1a gene, and mutants with TTG deleted in the second exon of the TFL1a gene and TT deleted in the third exon.

4. The use according to claim 1 or 2, characterized in that The soybean varieties include soybean Williams82.

5. A method for cultivating high-yield soybean varieties, characterized in that: The soybean TFL1a gene was edited using CRISPR / Cas9 technology to construct a TFL1a homozygous mutant.

6. The method for cultivating high-yield soybean varieties according to claim 5, characterized in that: The following steps are involved: S1. Two target sites, T1 and T2, were designed based on the exon sequence of the TFL1a gene. Two pairs of target primers were also designed. The target double-stranded linker was ligated to the gRNA expression cassette. After two rounds of PCR, the gRNA expression cassette was ligated to the pYLCRISPR / Cas9 vector. Escherichia coli competent cells were then transformed. After positive clone screening and plasmid extraction, a CRISPR / Cas9 knockout vector, pYLCRISPR / Cas9-TFL1a-T1T2 plasmid, containing the soybean TFL1a gene editing target sites T1 and T2, was constructed. S2. The pYLCRISPR / Cas9-TFL1a-T1T2 plasmid was transformed into Agrobacterium competent cells. After culture, positive single clones were screened. Then, soybeans were stably transformed by Agrobacterium infection. After that, T0 generation transgenic positive plants were screened. After subculture, soybean TFL1a homozygous mutant strains were obtained.

7. The method for cultivating high-yield soybean varieties according to claim 6, characterized in that: The sequence of target T1 is shown in SEQ ID NO.9, and the sequence of target T2 is shown in SEQ ID NO.

10.

8. The method for cultivating high-yield soybean varieties according to claim 7, characterized in that: The target primers for target T1 are shown as SEQ ID NO.11 and SEQ ID NO.12, and the target primers for target T2 are shown as SEQ ID NO.13 and SEQ ID NO.

14.

9. The method for cultivating high-yield soybean varieties according to claim 6, characterized in that: The primers used in the first round of PCR include UF shown in SEQ ID NO.1 and gRNA-R shown in SEQ ID NO.2; for target site T1, the primers used in the second round of PCR include B1' shown in SEQ ID NO.3 and B2 shown in SEQ ID NO.4; for target site T2, the primers used in the second round of PCR include B2' shown in SEQ ID NO.5 and BL shown in SEQ ID NO.

6.

10. The method for cultivating high-yield soybean varieties according to claim 6, characterized in that: In step S2, soybean cotyledonary nodes are used as explants for Agrobacterium infection.

Images