EB virus detection kit

Abstract

The invention relates to the technical field of kits, and discloses an EB (Epstein-Barr) virus detection kit, which comprises a virus detection kit based on combined use of a PCR (Polymerase Chain Reaction) isothermal amplification technology (RPA) and a magnetic particle chemiluminescence technology, the kit consists of a sample releasing agent, a standard solution, a quality control solution, a PCR amplification system and magnetic beads, and has a function of quantitatively detecting EB viruses in a sample. The kit is composed of a sample releasing agent, a standard solution, a quality control solution, a PCR amplification system and magnetic beads, and matched reagents are composed of a substrate solution A, a substrate solution B and a cleaning solution. Compared with conventional PCR (polymerase chain reaction), the EB virus detection kit has the following characteristics that a full-automatic detection process is adopted, so that personal errors are reduced; the detection process is cleaned in three steps, the detection specificity is improved, background signals are reduced, and the detection sensitivity is enhanced; the detection time is shortened to be within 35 minutes, the virus load can be directly detected, the method is suitable for large-batch sample screening, and the detection and screening efficiency is improved.

Description

Technical Field

[0001] The present invention relates to the technical field of kits, in particular to an Epstein-Barr virus detection kit. Background Art

[0002] Nasopharyngeal carcinoma (NPC) is a highly prevalent head and neck malignancy in southern and southeastern coastal areas of my country. Approximately 80% of global cases are concentrated in my country, posing a serious threat to public health. Although radiotherapy is highly effective for NPC, with a 5-year survival rate of up to 95% for early-stage patients, NPC is anatomically hidden and early symptoms (such as nasal congestion, tinnitus, and bloody discharge) are similar to those of common upper respiratory tract infections. Approximately 70% of patients are diagnosed in the advanced stage, often with cervical lymph node or distant metastasis, significantly reducing treatment effectiveness. Therefore, improving early diagnosis is crucial for improving prognosis.

[0003] Epstein-Barr virus (EBV) infection is closely associated with the development of nasopharyngeal carcinoma (NPC) and B lymphoma-related diseases. Studies have shown that over 95% of adults carry EBV, and nearly all non-keratinizing NPC tissue harbors latent EBV infection. The virus is primarily transmitted through saliva, infecting oropharyngeal epithelial cells and B lymphocytes, establishing a lifelong latent infection. B virus infection is highly prevalent and can occur in all seasons. It is transmitted through close oral contact, proliferating in pharyngeal lymphocytes, entering the bloodstream, and disseminating throughout the lymphatic system, disrupting immune function and inducing cell proliferation and transformation. Multiple studies have confirmed that plasma EBV DNA levels are an independent biomarker for NPC, useful for disease screening and staging. A major clinical challenge currently lies in achieving rapid and accurate quantitative detection of EBV DNA. This is crucial not only for early diagnosis but also for treatment selection and prognosis assessment.

[0004] Currently, EBV detection mainly includes two methods: serology and molecular biology. Serology determines the infection status by detecting antibodies such as VCA-IgA and EA-IgA. However, serology has obvious limitations: 1. It cannot distinguish between previous infection and active infection; 2. There is a window period for antibody production, and immunosuppressed patients may have false negative results; 3. It cannot reflect the activity of viral replication. Molecular biology tests such as real-time fluorescence quantitative PCR (qPCR) can directly detect viral nucleic acid, but traditional PCR requires a complex thermal cycler and a long detection process, which is difficult to meet the needs of large-scale screening. Therefore, we have proposed an EB virus detection kit. Summary of the Invention

[0005] In response to the shortcomings of existing EB virus detection kits, the present invention provides an EB virus detection kit that improves detection specificity, reduces background signals, and enhances detection sensitivity through a three-step magnetic cleaning process during the detection process; the detection time is shortened to within 35 minutes, and the viral load can be directly detected, making it suitable for large-scale sample screening, thereby solving the problems raised in the above-mentioned background technology.

[0006] The present invention provides the following technical solution: an Epstein-Barr virus detection kit, which consists of a sample releaser, a standard solution, a quality control solution, a PCR amplification system, and magnetic beads. The kit is used to quantitatively detect Epstein-Barr virus in a sample, the sample releaser is used to release the Epstein-Barr virus gene in the sample, the standard solution is used to establish a concentration-luminescence value standard curve, the PCR amplification system is used to identify sample DNA and amplify labeled double-stranded DNA fragments under constant temperature conditions, and the magnetic beads are used to bind to the labeled double-stranded DNA fragments and can be magnetically adsorbed.

[0007] Preferably, the reagents used in conjunction with the kit include substrate A solution, substrate B solution, and cleaning solution, wherein the substrate A solution contains a solution of luminol, Tris-HCl, p-iodophenol, and EDTA, with a pH of 8.5; the substrate B solution contains a solution of hydrogen peroxide and Tris-HCl, with a pH of 8.5; and the cleaning solution contains a solution of 1×PBS, Tween 20, BSA, and proclin 300, with a pH of 7.4.

[0008] Preferably, the sample release agent is a solution containing Tris-HCl, NaCl, ammonium chloride, KHCO3, Na2·EDTA, Triton X-100, NP-40, KCl, NaOH, betaine, and BSA, with a pH of 7.4.

[0009] Preferably, the standard solution is prepared by diluting the EB virus sequence plasmid with 1×TE buffer to a concentration gradient of 0, 10 2 , 10 4 , 10 6 , 10 8 , 10 10 The standard solution of copies / mL is prepared by diluting the EB virus sequence plasmid with 1×TE buffer to a concentration of 10 4 , 10 8 copies / mL of the control solution.

[0010] Preferably, the PCR amplification system is a solution containing primers, recombinase T4 UvsX, Bsu DNA polymerase, single-strand binding protein gp32, T4 UvsX protein, creatine kinase, dNTPs, and Mg²⁺.

[0011] Preferably, the primers include an upstream primer and a downstream primer, and the upstream primer is: Primer F (5′→3′): [AE]AAGCCCAGGACCAGTTCTACTCCTACACATG; The downstream primers are: Primer R (5′→3′): [FITC]AGCAGCGTGTTCACAAACTTGTTAAAGCAGA; The 5' end of the upstream primer is labeled with AE, and the 5' end of the downstream primer is labeled with FITC.

[0012] Preferably, the recombinase T4 UvsX concentration is 2-5 μg / μL, the Bsu DNA polymerase concentration is 5-8 U / μL, the single-stranded binding protein gp32 concentration is 0.2-0.5 μg / μL, the T4 UvsX protein concentration is 2-5 μg / μL, the creatine kinase concentration is 2-5 μg / μL, the dNTPs concentration is 200-500 μM, and the Mg²⁺ concentration is 1.5-2.5 mM.

[0013] Preferably, the magnetic beads are superparamagnetic nanoparticle beads coupled with goat anti-fluorescein isothiocyanate.

[0014] Preferably, the standard solution and the quality control solution are pre-packed into 2 mL EP tubes, respectively, and the sample release agent, PCR amplification system, and magnetic beads are pre-packed into a reagent boat. The EP tube and the reagent boat are assembled into the liner and then packaged in a packaging box.

[0015] A method for using an Epstein-Barr virus detection kit comprises using the Epstein-Barr virus detection kit in combination with a chemiluminescence immunoassay based on direct chemiluminescence, and includes the following steps: S1. Take 15 μL of sample and 135 μL of sample release agent in a reaction tube and incubate at 37°C for 5 min. S2. Place 15 μL of the diluted sample in step S1 into a new reaction tube, take 50 μL of the PCR amplification system into the new reaction tube, and incubate at 37°C for 20 min; S3. Take 30 μL of magnetic beads and place them in a new reaction tube as described in step S2. Incubate at 37°C for 5 min. After the reaction in step S4 and step S3 is completed, the beads are washed three times with 300 μL of washing solution. The washing method is to use the magnetic absorption function to adsorb the beads and wash away unbound impurities. S5. Add 200 μL of substrate solution to the liquid washed in step S4. After the reaction, use a photon counter to read the reading. The reading method is to use a four-parameter logistic curve fitting to generate a standard curve. Based on the fact that the luminescence value is proportional to the EB concentration, the sample test luminescence value is input to obtain the EB virus load in the sample.

[0016] Compared with the existing EB virus detection kit, the present invention has the following beneficial effects: 1. This EBV detection kit develops a new EBV nucleic acid detection system by combining recombinase polymerase amplification (RPA) technology with chemiluminescence detection. RPA technology has the following advantages: isothermal amplification (30-40°C), no need for thermal cycling; short reaction time; high sensitivity; and easy operation.

[0017] 2. The EB virus detection kit uses the technical principle that the recombinase combines with the primer to form a nucleoprotein complex, which recognizes the template DNA and initiates amplification with the assistance of the single-stranded binding protein. The amplified product is detected by a chemiluminescent labeled probe. The signal intensity is proportional to the viral load. It can quantitatively detect the EB virus load in the human body and improve the early diagnosis and treatment rate of nasopharyngeal carcinoma.

[0018] 3. Compared with conventional PCR, this EB virus detection kit has the following features: fully automatic detection process to reduce human errors; three-step cleaning during the detection process to improve detection specificity, reduce background signals, and enhance detection sensitivity; detection time is shortened to within 35 minutes, and viral load can be directly detected, which is suitable for large-scale sample screening and improves detection and screening efficiency. DETAILED DESCRIPTION

[0019] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0020] A Epstein-Barr virus detection kit includes a virus detection kit based on the combined use of PCR constant temperature amplification technology (RPA) and magnetic microparticle chemiluminescence technology, which has the function of quantitatively detecting Epstein-Barr virus in a sample. The kit consists of a sample release agent, a standard solution, a quality control solution, a PCR amplification system, and magnetic beads. The supporting reagents include substrate A solution, substrate B solution, and a cleaning solution.

[0021] Sample release agent: a solution containing Tris-HCl, NaCl, ammonium chloride, KHCO3, Na2·EDTA, Triton X-100, NP-40, KCl, NaOH, betaine, and BSA, pH = 7.4.

[0022] The concentration of Tris-HCl is 0.2-0.5 M, the concentration of NaCl is 0.25-0.4 M, the concentration of ammonium chloride is 0.15 M, the concentration of KHCO3 is 0.01 M, and the concentration of Na2 EDTA concentration is 0.1 mM, Triton X-100 concentration is 2%-5%, NP-40 concentration is 1%-2%, KCl concentration is 7-10 mg / mL, NaOH concentration is 25-50 mg / mL, betaine concentration is 10-30 mg / mL, and BSA concentration is 20-40 mg / mL.

[0023] Standard solution AF: dilute the EB virus sequence plasmid with 1×TE buffer to a concentration gradient of 0, 10 2 , 10 4 , 10 6 , 10 8 , 10 10 copies / mL of standard solution.

[0024] Quality control solution 1 / 2: dilute the EB virus sequence plasmid to a concentration of 10 with 1× TE buffer. 4 , 10 8 copies / mL of the control solution.

[0025] 1× TE buffer: a solution containing Tris-HCl and EDTA, pH=8.0.

[0026] The concentration of Tris-HCl is 1 M, and the concentration of EDTA is 0.5 M.

[0027] PCR amplification system: A solution containing primers, recombinase T4 UvsX, Bsu DNA polymerase, single-strand binding protein gp32, T4UvsX protein, creatine kinase, dNTPs, and Mg²⁺.

[0028] The primers include an upstream primer and a downstream primer; Upstream primer RPA-primer F (5'→3'): [AE]AAGCCCAGGACCAGTTCTACTCCTACACATG, Downstream primer RPA-primer R (5'→3'): [FITC]AGCAGCGTTGTTCACAAACTTGTTAAAGCAGA, The 5' end of the upstream primer was labeled with AE, and the 5' end of the downstream primer was labeled with FITC.

[0029] The above primers were designed based on the Epstein-Barr virus gene (GenBank: V01555). The gene amplification fragment is located at 88680-88845, a total of 166 bp, with a CG content of 48%. The amplified fragment is as follows: AAGCCCAGGACCAGTTCTACTCCTACACATGTAATGCGGACACATTCTCGCCTTCTTTGACCAGCTTTGCCTCCATCTGGGCACTTCTGACGCTTGTCTTAGTCATTATAGCCTCAGCCATCTACCTGATGTACGTCTGCTTTAACAAGTTTGTGAACACGCTGCT.

[0030] The concentration of recombinant enzyme T4 UvsX is 2-5 μg / μL, the concentration of Bsu DNA polymerase is 5-8 U / μL, the concentration of single-stranded binding protein gp32 is 0.2-0.5 μg / μL, the concentration of T4 UvsX protein is 2-5 μg / μL, the concentration of creatine kinase is 2-5 μg / μL, the concentration of dNTPs is 200 - 500 μM, and the concentration of Mg²⁺ is 1.5-2.5 mM.

[0031] The magnetic beads are superparamagnetic nanoparticle beads coupled with goat anti-fluorescein isothiocyanate (FITC), and the magnetic beads can be one of carboxyl magnetic beads and amino magnetic beads.

[0032] Supporting reagents: Substrate A solution: a solution containing luminol, Tris-HCl, p-iodophenol, and EDTA, pH = 8.5.

[0033] Supporting reagent substrate B solution: a solution containing hydrogen peroxide and Tris-HCl, pH=8.5.

[0034] Matching reagent cleaning solution: a solution containing 1× PBS, Tween 20, BSA, and proclin 300, pH=7.4.

[0035] The EB virus detection kit based on the PCR constant temperature amplification technology (RPA) combined with magnetic particle chemiluminescence technology can quantitatively detect the EB virus load in swabs, serum, plasma, and whole blood samples, but the preferred sample type is whole blood.

[0036] The standard solution AF and quality control solution 1 / 2 in the Epstein-Barr virus detection kit based on the PCR constant temperature amplification technology (RPA) combined with the magnetic microparticle chemiluminescence technology need to be pre-packed into 2 mL EP tubes respectively, and the sample release agent, PCR amplification system, and magnetic beads are pre-packed into the reagent boat. The EP tube and reagent boat are assembled into the inner liner and then packaged in a packaging box.

[0037] The aliquot volume of standard solution AF and quality control solution 1 / 2 is 200 μL / tube.

[0038] The sample release agent is dispensed into bottle b of the reagent boat, with a dispensing volume of 16 mL / bottle; the PCR amplification system is dispensed into bottle c of the reagent boat, with a dispensing volume of 6 mL / bottle; the magnetic beads are dispensed into bottle a of the reagent boat, with a dispensing volume of 4 mL / bottle.

[0039] The instructions for using the EB virus detection kit are as follows: Preferably, 15 μL of sample and 135 μL of sample release agent (diluted 10 times) are placed in a reaction tube and incubated at 37°C for 5 minutes; 15 μL of the diluted sample is placed in a new reaction tube, 50 μL of the PCR amplification system is placed in the reaction tube, and the mixture is incubated at 37°C for 20 minutes; 30 μL of magnetic beads are placed in a reaction tube and the mixture is incubated at 37°C for 5 minutes; after the reaction is completed, the sample is washed three times with 300 μL of washing solution, 200 μL of substrate solution is added for reading, and the luminescence value is proportional to the EB concentration using a four-parameter logistic curve fit.

[0040] Use a chemiluminescence immunoassay analyzer based on direct chemiluminescence. The specific detection steps are as follows: S1. Take 15 μL of sample and 135 μL of sample release agent in a reaction tube and incubate at 37°C for 5 min. S2. Place 15 μL of the diluted sample in step S1 into a new reaction tube, take 50 μL of the PCR amplification system into the new reaction tube, and incubate at 37°C for 20 min; S3. Take 30 μL of magnetic beads and place them in a new reaction tube as described in step S2. Incubate at 37°C for 5 min. After the reaction in step S4 and step S3 is completed, the beads are washed three times with 300 μL of washing solution. The washing method is to use the magnetic absorption function to adsorb the beads and wash away unbound impurities. S5. Add 200 μL of substrate solution to the liquid washed in step S4. After the reaction, use a photon counter to read the reading. The reading method is to use a four-parameter logistic curve fitting to generate a standard curve. Based on the fact that the luminescence value is proportional to the EB concentration, the sample test luminescence value is input to obtain the EB virus load in the sample.

[0041] The actual operation process is as follows: 1. Sample collection: Remove the patient's nasal secretions, gently insert the nasal swab deep into the nostril, leave it there for 15-30 seconds, then gently rotate it three times, slowly withdraw the nasal swab, and quickly place it into the virus sampling tube and tighten the tube cap; Serum / Plasma / Whole Blood: Samples should be collected according to the standard document WS / T 225-2024 "Collection and Processing of Blood Specimens for Clinical Chemistry Testing".

[0042] 2. Test the sample using a chemiluminescence immunoassay analyzer based on direct chemiluminescence as an example: 2.1 Sample and Processing: Take 15 μL of sample and 135 μL of sample release agent (diluted 10 times) in a reaction tube and incubate at 37°C for 5 minutes. This process will release the EB virus gene in the sample.

[0043] 2.2 PCR isothermal amplification (RPA): Transfer 15 μL of the diluted sample to a new reaction tube, and then transfer 50 μL of the PCR amplification system to the tube. Incubate at 37°C for 20 minutes. During this process, the primers will amplify many double-stranded DNA fragments labeled with both AE and FITC in the presence of the gene template, recombinase T4 UvsX, Bsu DNA polymerase, single-stranded binding protein gp32, T4UvsX protein, creatine kinase, dNTPs, and Mg²⁺.

[0044] 2.3 Sandwich complex formation: Take 30 μL of magnetic beads and place them in the reaction tube in step 2.2. Incubate at 37°C for 5 min. During this process, the magnetic beads coupled with goat anti-FITC will combine with the FITC-labeled end of the DNA product in step 2.2 to generate a magnetic bead-goat anti-FITC-FITC-DNA fragment-AE sandwich complex.

[0045] 2.4 Cleaning: Take 300 μL of cleaning solution and wash it in the above reaction tube for three times. Use the magnetic function of the instrument to adsorb the magnetic beads and wash away the unbound impurities.

[0046] 2.5 Add substrate and read the result: Take 200 μL of substrate solution and add it to the above reaction tube. After the reaction, read the photon counter.

[0047] 3. Result analysis: The luminescence value and concentration of the standard solution AF are fitted using a four-parameter logistic curve to generate a standard curve. The luminescence value of the sample test is input to obtain the EB virus load in the sample.

[0048] 4. Calibration and quality control methods: Calibration: Direct calibration is performed by testing 6 calibration solutions AF to generate a working calibration curve.

[0049] Quality control: When testing or calibrating samples, two levels of quality control solution (1 / 2) should be measured, and the quality control test values ​​should be within the quality control range.

[0050] The above-mentioned kit utilizes PCR amplification technology (RPA) at a constant temperature (30-40°C), eliminating the need for thermal cycling, resulting in a short reaction time, high sensitivity, and simple operation. It can also quantitatively detect the EBV load in the human body, improving the early diagnosis and treatment of nasopharyngeal carcinoma and enabling high-throughput testing.

[0051] The following is a verification of this kit and its usage.

[0052] Example 1: Linear Verification The high-value samples close to the upper limit of the linear range are divided by 1, 10 2 , 10 4 , 10 6 , 10 8 , 10 10 The sample was diluted to 6 concentrations at a ratio of , and the measurement was repeated 3 times for each concentration. The average value of the measured concentration and the dilution ratio were calculated. The linear correlation coefficient r was calculated by the least squares method, which should be no less than 0.9900. The results are shown in Table 1. The correlation coefficient r is 0.9999, and the dilution linearity is good.

[0053] Table 1

[0054] Example 2: Sensitivity Verification Use zero-concentration standard solution as the sample for detection, and repeat the measurement 20 times. Based on the 20 measured luminescence values, calculate the mean value M and standard deviation SD, calculate M+2SD, and perform two-point regression fitting based on the concentration-luminescence value between points A and B of the standard solution to obtain a linear equation. Substitute the M+2SD luminescence value to obtain the corresponding concentration value, which is the blank limit, which should be no more than 5 copies / mL. The results are shown in Table 2 below. The blank limit is 0.718 copies / mL, and the sensitivity is good.

[0055] Table 2

[0056] Example 3: Repeatability Use the kit to test quality control solution 1 and quality control solution 2, repeat the test 10 times for each quality control solution, and calculate the average value of the test results ( ) and standard deviation (SD), and the coefficient of variation (CV) was calculated according to the following formula. The coefficient of variation CV should not be greater than 10%. The results are shown in Tables 3 and 4 below. The coefficient of variation CV: quality control solution 1 is 2%, quality control solution 2 is 3%, and the repeatability is good.

[0057] ; Where: : The average value of 10 measured concentrations; : Concentration value measured each time.

[0058] Table 3

[0059] Table 4

[0060] Example 4: Accuracy EB pseudoviruses of known concentrations were diluted to 10 4 copies / mL and 10 8 The two concentrations of 100 copies / mL were measured three times, and the average value was calculated. The relative deviation of the two concentration samples was calculated according to the following formula. The results are shown in Table 5. The relative deviations of the tests were 2% and -6%, respectively, with good accuracy.

[0061] ; Where: B: relative deviation; M: mean of measured concentration; T: calibration concentration.

[0062] Table 5

[0063] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is limited by the appended claims and their equivalents.

Claims

1. An Epstein-Barr virus detection kit, characterized in that: The kit consists of a sample releaser, a standard solution, a quality control solution, a PCR amplification system, and magnetic beads. The kit is used to quantitatively detect Epstein-Barr virus in a sample. The sample releaser is used to release the Epstein-Barr virus gene in the sample. The standard solution is used to establish a concentration-luminescence value standard curve. The PCR amplification system is used to identify sample DNA under constant temperature conditions and amplify labeled double-stranded DNA fragments. The magnetic beads are used to bind to the labeled double-stranded DNA fragments and can be magnetically adsorbed.

2. An EB virus detection kit according to claim 1, characterized in that: The reagents used in the kit include substrate A solution, substrate B solution, and cleaning solution. The substrate A solution contains a solution of luminol, Tris-HCl, p-iodophenol, and EDTA, with a pH of 8.5; the substrate B solution contains a solution of hydrogen peroxide and Tris-HCl, with a pH of 8.5; and the cleaning solution contains a solution of 1×PBS, Tween 20, BSA, and proclin 300, with a pH of 7.

4.

3. An EB virus detection kit according to claim 1, characterized in that: The sample release agent is a solution containing Tris-HCl, NaCl, ammonium chloride, KHCO3, Na2·EDTA, Triton X-100, NP-40, KCl, NaOH, betaine, and BSA, with a pH of 7.

4.

4. An EB virus detection kit according to claim 1, characterized in that: The standard solution is prepared by diluting the EB virus sequence plasmid with 1×TE buffer to a concentration gradient of 0, 10 2 , 10 4 , 10 6 , 10 8 , 10 10 The standard solution of copies / mL is prepared by diluting the EB virus sequence plasmid with 1×TE buffer to a concentration of 10 4 , 10 8 copies / mL of the control solution.

5. An EB virus detection kit according to claim 2, characterized in that: The PCR amplification system is a solution containing primers, recombinase T4 UvsX, Bsu DNA polymerase, single-strand binding protein gp32, T4 UvsX protein, creatine kinase, dNTPs, and Mg²⁺.

6. An EB virus detection kit according to claim 5, characterized in that: The primers include an upstream primer and a downstream primer, and the upstream primer is: Primer F (5′→3′): [AE]AAGCCCAGGACCAGTTCTACTCCTACACATG; The downstream primers are: Primer R (5′→3′): [FITC]AGCAGCGTGTTCACAAACTTGTTAAAGCAGA; The 5' end of the upstream primer is labeled with AE, and the 5' end of the downstream primer is labeled with FITC.

7. The Epstein-Barr virus detection kit according to claim 5, wherein: The recombinant enzyme T4 UvsX concentration is 2-5 μg / μL, the Bsu DNA polymerase concentration is 5-8 U / μL, the single-strand binding protein gp32 concentration is 0.2-0.5 μg / μL, the T4 UvsX protein concentration is 2-5 μg / μL, the creatine kinase concentration is 2-5 μg / μL, the dNTPs concentration is 200 - 500 μM, and the Mg²⁺ concentration is 1.5-2.5 mM.

8. An Epstein-Barr virus detection kit according to claim 1, characterized in that: The magnetic beads are super-paramagnetic nanoparticle beads coupled with goat anti-fluorescein isothiocyanate.

9. The Epstein-Barr virus detection kit according to claim 1, wherein: The standard solution and quality control solution are pre-packed into 2 mL EP tubes respectively. The sample release agent, PCR amplification system, and magnetic beads are pre-packed into the reagent boat. The EP tube and the reagent boat are assembled into the liner and then packaged in a packaging box.

10. A method for using an Epstein-Barr virus detection kit, characterized in that: The EB virus detection kit according to claim 6 is used in combination with a chemiluminescence immunoassay based on the direct chemiluminescence method, and includes the following steps: S1. Take 15 μL of sample and 135 μL of sample release agent in a reaction tube and incubate at 37°C for 5 min. S2. Place 15 μL of the diluted sample in step S1 into a new reaction tube, take 50 μL of the PCR amplification system into the new reaction tube, and incubate at 37°C for 20 min; S3. Take 30 μL of magnetic beads and place them in a new reaction tube as described in step S2. Incubate at 37°C for 5 min. After the reaction in step S4 and step S3 is completed, the beads are washed three times with 300 μL of washing solution. The washing method is to use the magnetic absorption function to adsorb the beads and wash away unbound impurities. S5. Add 200 μL of substrate solution to the liquid washed in step S4. After the reaction, use a photon counter to read the reading. The reading method is to use a four-parameter logistic curve fitting to generate a standard curve. Based on the fact that the luminescence value is proportional to the EB concentration, the sample test luminescence value is input to obtain the EB virus load in the sample.

Images