Reaction liquid for amplifying nucleic acid

Abstract

Provided is a reaction solution for amplifying a nucleic acid, the reaction solution having coloration that is easily visible before a reaction and having no coloration that interferes with fluorescence from the amplified nucleic acid after the reaction. A reaction solution for amplifying a nucleic acid, the reaction solution having a pH of 7.5-10.5 and containing a colorant, the colorant being a water-soluble dye colorless in the reaction solution at a pH of 7.5-10.5 and at 40 DEG C or higher. A reaction solution for amplifying a nucleic acid, the reaction solution containing a color-changing agent and a colorant, the color-changing agent being an oxidizing agent, a reducing agent, or an acidifying agent, and the colorant being a water-soluble dye that changes color or becomes colorless in the reaction solution at 40 DEG C or higher in the presence of the color-changing agent.

Description

Technical Field

[0001] The present invention relates to a reaction solution for amplifying nucleic acid, a coloring composition to be added to the reaction solution, and a nucleic acid amplification method using the reaction solution. Background Art

[0002] In molecular biology research and clinical applications such as genetic testing, amplifying target nucleic acid molecules for analysis has become a common technique. Nucleic acid amplification methods include PCR (Polymerase Chain Reaction), LAMP (Loop-Mediated Isothermal Amplification), and SDA (Strand Displacement Amplification), but most of these methods require processing nucleic acids at temperatures exceeding 60°C.

[0003] As the method for detecting the amplified product after amplification, it is known that the solution after the amplification reaction is subjected to agarose gel electrophoresis, double-stranded nucleic acid is combined with fluorescent intercalator (ethidium bromide, SYBR (registered trademark) Green etc.), and the method (for example, non-patent literature 1) of observing specific fluorescence. Alternatively, it is also widely known that fluorescent intercalator, fluorescently labeled primer, fluorescently labeled probe etc. are combined with amplified product in nucleic acid amplification reaction, specific fluorescence is detected over time, and nucleic acid detection / quantification method (for example, patent literature 1) is carried out in real time. In particular, the latter does not need the complicated operations such as electrophoresis, and can quickly obtain detection / quantification result, therefore becomes the mainstream of nucleic acid amplification method.

[0004] Nucleic acid amplification is usually carried out by mixing a reaction solution with a specimen containing nucleic acid, but the amount of reaction solution and specimen used is very small, and it is difficult to visually confirm whether there is liquid, so pipetting errors are prone to occur. In nucleic acid amplification, even if a very small amount of specimen is mixed into other nucleic acid amplification systems, the risk of false positives caused by amplification is high, so the handling of the reaction solution and the specimen usually needs to be carried out carefully, and a state that is less prone to errors is desired. In order to solve this problem, for example, a method can be adopted in which a colorant that does not affect the nucleic acid amplification reaction is added to the reaction solution, making it easy to visually confirm the reaction solution. However, in real-time nucleic acid amplification using fluorescent labeled probes such as those described in Patent Document 1, depending on the fluorescent pigment used, there is a possibility that the absorption wavelength of the colorant interferes with the fluorescence wavelength and nucleic acid quantification cannot be accurately performed.

[0005] Patent Document 2 discloses a method for allowing a heat-labile, water-soluble substance to coexist with a substance that absorbs and / or fluoresces light at a permissive temperature in a nucleic acid amplification system. In this method, at the temperature before the nucleic acid amplification reaction, the water-soluble substance absorbs and / or fluoresces light, facilitating visual confirmation of the reaction solution. After the nucleic acid amplification reaction, the light-absorbing and / or fluorescent properties of the water-soluble substance disappear, preventing the water-soluble substance from interfering with detection using fluorescently labeled probes, etc. Fluorescent proteins are examples of such water-soluble substances.

[0006] Prior art literature

[0007] Patent Literature

[0008] Patent Document 1: Japanese Patent Application Laid-Open No. 2009-232871

[0009] Patent Document 2: Japanese Patent Application No. 2018-537991

[0010] Non-patent literature

[0011] Non-patent document 1: Molecular Cloning second edition, vol. 1, 6. 15 (1989) Summary of the Invention

[0012] Problems to be solved by the invention

[0013] However, the water-soluble substance described in Patent Document 2 is a protein, and there are still problems with its stable production and long-term storage stability.

[0014] The present invention aims to provide a reaction solution for nucleic acid amplification, which has a color that is easily visually confirmed before the reaction and does not interfere with fluorescence from the amplified nucleic acid after the reaction, a coloring composition for preparing the reaction solution, and a nucleic acid amplification method using the reaction solution.

[0015] Solutions to the Problem

[0016] The present inventors have discovered a highly stable low-molecular-weight dye that does not affect nucleic acid amplification and becomes colorless upon heating, thereby completing the present invention. Furthermore, the present inventors have discovered a highly stable low-molecular-weight dye that does not affect nucleic acid amplification and changes color or becomes colorless upon heating under certain conditions, thereby completing the present invention. Specifically, the present invention provides the following.

[0017] [1] A reaction solution for amplifying nucleic acid, wherein:

[0018] The reaction solution has a pH of 7.5 to 10.5 and contains a colorant.

[0019] The colorant is a water-soluble pigment that becomes colorless in a reaction solution at a pH of 7.5 to 10.5 and above 40°C.

[0020] [2] The reaction solution according to [1], wherein

[0021] The molecular weight of the water-soluble pigment is lower than 1000.

[0022] [3] The reaction solution according to [1] or [2], wherein

[0023] When heated at 80°C for 10 minutes, the absorbance at the maximum absorption wavelength in the visible light region decreases to less than 10%.

[0024] [4] The reaction solution according to any one of [1] to [3], wherein

[0025] The colorant is a non-fluorescent pigment.

[0026] [5] The reaction solution according to any one of [1] to [4], wherein

[0027] The colorant is triphenylmethane pigment.

[0028] [6] The reaction solution according to [5], wherein

[0029] The triphenylmethane dye is at least one compound selected from the group consisting of compounds represented by the following formulas (I) to (V).

[0030]

[0031]

[0032]

[0033]

[0034]

[0035] [7] A composition for coloring comprising a colorant to be added to a reaction solution for nucleic acid amplification, wherein:

[0036] The colorant is a water-soluble pigment that becomes colorless in a reaction solution at a pH of 7.5 to 10.5 and above 40°C.

[0037] [8] A method for amplifying a nucleic acid in a specimen, using the reaction solution described in any one of [1] to [6].

[0038] [9] A method for amplifying a nucleic acid in a sample, the method comprising:

[0039] The step of reacting the nucleic acid in the sample in the reaction solution,

[0040] The reaction solution comprises:

[0041] DNA polymerase or RNA polymerase;

[0042] At least one set of primers for amplifying a desired region of a nucleic acid;

[0043] deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs);

[0044] divalent metal ions;

[0045] pH buffers; and

[0046] colorants,

[0047] The pH of the reaction solution is 7.5-10.5,

[0048] The colorant is a water-soluble pigment that becomes colorless in a reaction solution at 40° C. or above.

[0049]

[10] The method according to [9], wherein

[0050] The colorant is a non-fluorescent pigment.

[0051]

[11] The method according to [9] or

[10] , wherein

[0052] The reaction solution further comprises an embedding ( ) fluorescent pigment.

[0053]

[12] The method according to any one of [9] to

[11] , wherein

[0054] The reaction solution further contains a probe bound to a fluorescent dye.

[0055]

[13] A method for simultaneously amplifying multiple regions of a nucleic acid in a sample, the method comprising:

[0056] A step of preparing a plurality of reaction solutions and reacting the nucleic acid in the sample simultaneously in each reaction solution.

[0057] The plurality of reaction solutions include:

[0058] DNA polymerase or RNA polymerase;

[0059] A primer set for amplifying desired regions on a nucleic acid, with at least one set corresponding to each region;

[0060] deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs);

[0061] divalent metal ions; and

[0062] pH buffers,

[0063] The pH of the reaction solution is 7.5-10.5,

[0064] The plurality of reaction solutions further contain colorants different from each other,

[0065] The colorants are all water-soluble pigments that become colorless in a reaction solution at 40° C. or above.

[0066]

[14] A method for simultaneously amplifying multiple regions of a nucleic acid in a sample, the method comprising:

[0067] A process of preparing one reaction solution and reacting multiple nucleic acids in a sample simultaneously.

[0068] The one reaction solution comprises:

[0069] DNA polymerase or RNA polymerase;

[0070] A primer set for amplifying desired regions on a nucleic acid, with at least one set corresponding to each region;

[0071] deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs);

[0072] divalent metal ions;

[0073] pH buffers; and

[0074] colorants,

[0075] The pH of the reaction solution is 7.5-10.5,

[0076] The colorant is a water-soluble pigment that becomes colorless in a reaction solution at 40° C. or above.

[0077]

[15] A reaction solution for nucleic acid amplification, comprising:

[0078] Color-changing agents, and

[0079] colorants,

[0080] Wherein, the color changing agent is an oxidizing agent, a reducing agent or an acidifying agent,

[0081] The colorant is a water-soluble pigment that changes color or becomes colorless in a reaction solution at 40° C. or higher in the presence of a color-changing agent.

[0082]

[16] The reaction solution according to

[15] , wherein

[0083] The colorant has a molecular weight of less than 1,000.

[0084]

[17] The reaction solution according to

[15] or

[16] , wherein

[0085] When heated at 80°C for 10 minutes, the absorbance at the maximum absorption wavelength in the visible light region decreases to less than 10%.

[0086]

[18] The reaction solution according to any one of

[15] to

[17] , wherein

[0087] The colorant is a non-fluorescent pigment.

[0088]

[19] The reaction solution according to any one of

[15] to

[18] , wherein

[0089] The water-soluble pigment comprises at least one compound selected from the compounds represented by the following formulas (VI) to (X),

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[20] A composition for coloring comprising a colorant to be added to a reaction solution for nucleic acid amplification,

[0096] The colorant is a water-soluble pigment that becomes colorless in a reaction solution at 40° C. or above in the presence of a color-changing agent.

[0097] The color changing agent is an oxidizing agent, a reducing agent or an acidifying agent.

[0098]

[21] A method for amplifying nucleic acid in a specimen, using the reaction solution described in any one of

[15] to

[19] .

[0099]

[22] A method for amplifying a nucleic acid in a sample, the method comprising:

[0100] The step of reacting the nucleic acid in the sample in the reaction solution,

[0101] Wherein, the reaction solution comprises:

[0102] DNA polymerase or RNA polymerase;

[0103] At least one set of primers for amplifying a desired region of a nucleic acid;

[0104] deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs);

[0105] divalent metal ions;

[0106] color-changing agents; and

[0107] colorants,

[0108] The color changing agent is an oxidizing agent, a reducing agent or an acidifying agent,

[0109] The colorant is a water-soluble pigment that changes color or becomes colorless in a reaction solution at 40° C. or higher in the presence of a color-changing agent.

[0110]

[23] The method according to

[22] , wherein

[0111] The colorant is a non-fluorescent pigment.

[0112]

[24] The method according to

[22] or

[23] , wherein

[0113] The reaction solution further contains an intercalating fluorescent dye.

[0114]

[25] The method according to

[22] or

[23] , wherein

[0115] The reaction solution further contains a probe bound to a fluorescent dye.

[0116]

[26] A method for simultaneously amplifying multiple regions of a nucleic acid in a sample, the method comprising:

[0117] A step of preparing a plurality of reaction solutions and reacting the nucleic acid in the sample simultaneously in each reaction solution.

[0118] The plurality of reaction solutions include:

[0119] DNA polymerase or RNA polymerase;

[0120] A primer set for amplifying desired regions on a nucleic acid, with at least one set corresponding to each region;

[0121] deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs);

[0122] divalent metal ions; and

[0123] Color-changing agent,

[0124] The color changing agent is an oxidizing agent, a reducing agent or an acidifying agent,

[0125] The plurality of reaction solutions further contain colorants different from each other,

[0126] The colorant is a water-soluble pigment that changes color or becomes colorless in a reaction solution at 40° C. or above.

[0127]

[27] A method for simultaneously amplifying multiple regions of a nucleic acid in a sample, the method comprising:

[0128] A step of preparing one reaction solution and reacting the nucleic acid regions in the sample simultaneously in the one reaction solution.

[0129] The one reaction solution comprises:

[0130] DNA polymerase or RNA polymerase;

[0131] A primer set for amplifying desired regions on a nucleic acid, with at least one set corresponding to each region;

[0132] deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs);

[0133] divalent metal ions;

[0134] color-changing agents; and

[0135] colorants,

[0136] The colorant is a water-soluble pigment that changes color or becomes colorless in a reaction solution at 40° C. or above.

[0137] This specification incorporates the disclosures of Japanese Patent Application Nos. 2023-049524 and 2023-049530 upon which the present application claims priority.

[0138] Effects of the Invention

[0139] According to the present invention, in a nucleic acid amplification reaction, the reaction solution can be easily visually confirmed and handled before the reaction, and after the reaction, the coloring of the reaction solution does not interfere with the fluorescence from the amplified nucleic acid, thereby achieving more accurate nucleic acid detection / quantification. BRIEF DESCRIPTION OF THE DRAWINGS

[0140] Figure 1 These are photographs showing the appearance of reaction solutions under non-heating and heating conditions in Test Examples 1 and 3 in Example 1. The numerical values ​​below each well indicate the absorbance of the solution at 625 nm (Test Example 1) and 617 nm (Test Example 3).

[0141] Figure 2 These are the absorption spectra of the reaction solutions under non-heating and heating conditions of Test Example 1 in Example 1.

[0142] Figure 3 These are the absorption spectra of the reaction solutions under non-heating and heating conditions in Experiment 2 of Example 1.

[0143] Figure 4 These are the absorption spectra of the reaction solutions under non-heating and heating conditions in Test Example 3 in Example 1.

[0144] Figure 5 These are the absorption spectra of the reaction solutions under non-heating and heating conditions in Test Example 4 in Example 1.

[0145] Figure 6 These are the absorption spectra of the reaction solutions under non-heating and heating conditions in Test Example 5 in Example 1.

[0146] Figure 7 These are photographs showing the appearance of reaction solutions under non-heating and heating conditions in Test Examples 6 to 9 in Example 2. The results of visual color determination are shown below each well.

[0147] Figure 8 These are photographs showing the appearance of the reaction solution after refrigeration for 27 hours under non-heating and heating conditions in Test Example 10 in Example 3. The results of visual color determination are shown below each well.

[0148] Figure 9 Graphs showing temporal changes in fluorescence intensity of the reaction solutions of Test Examples 11 to 13 in Example 4. A represents temporal changes in fluorescence intensity of FAM, and B represents temporal changes in fluorescence intensity of ROX.

[0149] Figure 10 This is a graph showing the temporal changes in fluorescence intensity of the reaction solutions of Test Examples 11 and 13 to 16 in Example 4. A represents the temporal changes in fluorescence intensity of FAM, and B represents the temporal changes in fluorescence intensity of ROX.

[0150] Figure 11 This is a graph showing the temporal changes in fluorescence intensity of Test Examples 17 to 19 in Example 5.

[0151] Figure 12 These are the absorption spectra of the reaction solutions under non-heating and heating conditions in Test Example 20 in Example 6.

[0152] Figure 13 These are the absorption spectra of the reaction solutions under non-heating and heating conditions in Test Example 21 in Example 6.

[0153] Figure 14 These are the absorption spectra of the reaction solutions under non-heating and heating conditions in Test Example 22 in Example 6.

[0154] Figure 15 These are the absorption spectra of the reaction solutions under non-heating and heating conditions in Test Example 23 in Example 6.

[0155] Figure 16 These are the absorption spectra of the reaction solutions under non-heating and heating conditions in Test Example 24 in Example 6.

[0156] Figure 17 This is a graph showing the temporal changes in the fluorescence intensity of ROX in the reaction solutions of Test Examples 25 to 30 in Example 7.

[0157] Figure 18 This is a graph showing the temporal changes in the fluorescence intensity of ROX in the reaction solutions of Test Examples 25 and 30 to 34 in Example 8.

[0158] Figure 19 This is a graph showing the temporal changes in the fluorescence intensity of FAM in the reaction solutions of Test Examples 25 and 35 to 39 in Example 9. DETAILED DESCRIPTION

[0159] In this specification, "%" indicating the concentration of an aqueous solution represents weight %, unless otherwise specified. Unless otherwise specified, the term "A to B" (A and B are numerical values) in this specification means "A or greater and B or less." Unless otherwise specified, compounds described in this specification include any geometric isomers, optical isomers, solvates, and salts that may exist.

[0160] 1. Reaction solution I for nucleic acid amplification

[0161] A first embodiment of the present invention is a reaction solution for amplifying nucleic acid, having a pH of 7.5 to 10.5 and containing a colorant. The colorant is a water-soluble dye that becomes colorless in a reaction solution at a pH of 7.5 to 10.5 and at 40° C. or higher.

[0162] In this specification, "nucleic acid amplification" is not particularly limited as long as it can amplify the nucleic acid sequence, and includes any known nucleic acid amplification. As known nucleic acid amplification, for example, PCR (Polymerase Chain Reaction) method, LCR (Ligase Chain Reaction) method, SDA (Strand Displacement Amplification) method, RCA (Rolling Circle Amplification) method, CPT (Cycling Probe Technology) method, Q-Beta Replicase Amplification Technology method, ICAN (Isothermal and Chimeric primer-initiated Amplification of Nucleic Acids) method, LAMP (Loop-Mediated Isothermal Amplification of DNA) method, NASBA (Nucleic acid Sequence-based Amplification method) method, and TMA (Transcription mediated amplification method) method and other known methods can be mentioned, but are not limited to these. The Q-Beta Replicase Amplification Technology method, RCA method, NASBA method, SDA method, TMA method, LAMP method, ICAN method, etc. are methods for performing amplification reactions at a constant temperature, while other methods such as PCR and LCR method are methods for performing amplification reactions through temperature cycling.

[0163] In this specification, "nucleic acid" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The above-mentioned nucleic acid amplification can be the amplification of DNA or the amplification of RNA, and is preferably the amplification of DNA with high structural stability. When the nucleic acid to be detected / measured contained in the specimen is RNA, the RNA can be directly amplified, but it is preferred to use a reverse transcriptase such as Tth DNA polymerase on the RNA to construct a DNA (cDNA) with a complementary sequence, and perform an amplification reaction using the cDNA as a template.

[0164] In this specification, a "reaction solution" refers to a test solution used to initiate a reaction in the liquid. In this embodiment, it is a test solution used to initiate nucleic acid amplification in the liquid. The reaction solution of this embodiment, excluding the colorant described below, may contain any known composition depending on the nucleic acid amplification method being used.

[0165] In this specification, a "colorant" refers to a substance having a maximum absorption wavelength in the visible light region under the conditions of 20-25°C and a pH of 6.0-7.0 in an aqueous solution. The "visible light region" herein refers to the range of 380-800 nm. In this embodiment, the colorant is a water-soluble pigment. "Water-soluble" refers to a substance having a higher solubility in water than in water and solvents with an HLB value of 10 or less.

[0166] In this embodiment, the colorant must be colorless in an aqueous solution at a pH of 7.5 to 10.5 and at a temperature of 40°C or higher. Specifically, it must be colorless by warming or heating the solution under weakly alkaline conditions. In this specification, "colorless" of the aqueous solution means that the maximum absorption peak in the visible light region is reduced to less than 10% of the initial absorption peak.

[0167] The colorant of this embodiment preferably has its absorbance at the maximum absorption wavelength in the visible light region reduced to 20% or less, particularly 10% or less, and further reduced to 5% or less, by heating at 80°C for 10 minutes at pH 7.5 to 10.5.

[0168] On the other hand, the colorant preferably does not turn colorless under the conditions of room temperature (e.g., 20-25°C) and a weakly acidic to neutral (e.g., pH 6.0-7.0) aqueous solution. Furthermore, it is preferred that the colorant does not turn colorless even when heated or warmed under weakly acidic to neutral conditions. Furthermore, it is preferred that the colorant can be stored under weakly acidic to neutral conditions at room temperature or refrigerated for a long period of time (e.g., several days to several months) while retaining its color. Furthermore, it is preferred that the colorant, after turning colorless by heating or warming under weakly alkaline conditions (e.g., pH 7.5-10.5), does not recolor even when the temperature is lowered. This allows analysis even after the reaction solution after nucleic acid amplification has been refrigerated.

[0169] In this embodiment, the colorant is a water-soluble pigment, and is not particularly limited as long as it is a pigment that becomes colorless in an aqueous solution at pH 7.5 to 10.5 and 40° C. or higher. A low molecular weight substance is preferred, and specifically, a substance having a molecular weight of less than 1000 is preferred. Examples of water-soluble pigments include triphenylmethane pigments, thiazine pigments, Azine pigments, azine pigments, phenazine pigments, Tonene pigments, phenanthridine pigments, azo pigments, lactone pigments, sultone pigments, indigo pigments, cyanine pigments, oxonol pigments, styryl pigments, porphyrin pigments, thio Tonne pigments, squaric acid pigments, crotonic acid pigments, Pigments, dithiol metal salt pigments, naphthoquinone pigments, anthraquinone pigments, indophenol pigments, coumarin pigments, ketocoumarin pigments, pyran Salt pigments, thiopyrans Salt-based, thiazole-based pigments, quinoline-based pigments, benzophenone-based pigments, thiobenzophenone-based pigments, and mixtures thereof. Non-fluorescent pigments are particularly preferred, and triphenylmethane-based pigments are further preferred. In this specification, "non-fluorescent pigments" refer to all pigments that do not have the property of emitting long-wavelength excitation light relative to absorbed light. For example, it refers to a pigment in which the difference between the wavelength of the irradiated light and the wavelength of the transmitted light on the aqueous solution is less than 10nm. In this specification, "triphenylmethane-based pigments" refer to pigments having a structure shown in the following formula (XI) or (XII).

[0170]

[0171]

[0172] In formula (VI) and (VII), R, R, R' and R'' are independently selected from substituted and unsubstituted aryl groups such as phenyl, naphthyl, anthracenyl, etc. The aryl group may be substituted with a functional group such as amino, hydroxyl, carbonyl, carboxyl, sulfonic acid, alkyl, and / or other functional groups.

[0173] In the present embodiment, as the triphenylmethane dye, at least one compound selected from the group consisting of compounds represented by the following formulae (I) to (V) can be appropriately used.

[0174]

[0175] The compound represented by formula (I) is a bluish-green water-soluble pigment called methyl green (CI42585) and has a maximum absorption wavelength of 632 nm.

[0176]

[0177] The compound represented by formula (II) is a bluish-green water-soluble pigment called methyl green (CI42590), and has maximum absorption wavelengths of 629 nm and 423 nm.

[0178]

[0179] The compound represented by formula (III) is a green water-soluble pigment called malachite green, and its maximum absorption wavelength is 617 nm.

[0180]

[0181] The compound represented by formula (IV) is a green water-soluble pigment called Brilliant Green SF Yellow, and has a maximum absorption wavelength of 632 nm.

[0182]

[0183] The compound represented by formula (V) is a reddish-purple water-soluble pigment called acid fuchsin, and has a maximum absorption wavelength of 546 nm.

[0184] The concentration of the colorant in the reaction solution is not particularly limited as long as the coloration of the solution can be visually confirmed, but is preferably 0.005% by weight or less, and more preferably 0.001% by weight or less.

[0185] In addition to the colorant, the reaction solution of this embodiment also contains other components required for amplifying the sequence of the desired region from the nucleic acid serving as a template. The other components herein vary depending on the method of nucleic acid amplification. The following examples illustrate the components required for nucleic acid amplification using real-time PCR.

[0186] The reaction solution used for nucleic acid amplification in real-time PCR generally contains at least the following components:

[0187] - DNA polymerase or RNA polymerase, preferably DNA polymerase;

[0188] - at least one set of forward primers and reverse primers for amplifying a desired region on a nucleic acid;

[0189] - deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), preferably dNTPs;

[0190] - divalent metal ions, preferably magnesium ions (Mg 2+ );

[0191] -pH buffer.

[0192] The reaction solution used for nucleic acid amplification is typically at a weak alkaline pH of approximately 7.5 to 10.5, particularly approximately 8.0 to 9.0. In one embodiment, the reaction solution comprises a primer set for amplifying a single region and the aforementioned colorant. In another embodiment, the reaction solution for nucleic acid amplification comprises a primer set for amplifying multiple regions, at least one primer set for each region, and the aforementioned colorant.

[0193] As the above-mentioned DNA polymerase, there is no particular limitation, and for example, Taq DNA polymerase, Tth DNA polymerase, KOD DNA polymerase, Bst DNA polymerase, Bsu DNA polymerase, etc. can be used. As the above-mentioned pH buffer, conventional pH buffers commonly used in real-time PCR such as Good buffers such as Tris, phosphate buffer, and HEPES can be used. 2+When, for example, the concentration can be set to about 2 mM.

[0194] In the real-time PCR method, the reaction solution for amplifying nucleic acid further includes an intercalating fluorescent pigment or a fluorescently labeled probe. An intercalating fluorescent pigment is a pigment that emits fluorescence in combination with double-stranded nucleic acid. By measuring the given fluorescence in the reaction solution, the double-stranded nucleic acid after purification in the reaction solution can be quantified. Examples of such intercalating fluorescent pigments include SYBR (registered trademark) Green, TB Green, and Eva Green. On the other hand, a fluorescently labeled probe has a sequence complementary to a portion of the above-mentioned desired region and emits fluorescence by binding to the region in the amplified product. Such fluorescently labeled probes are not particularly limited and can use TaqMan (registered trademark) probes. As the fluorescent pigment used in the fluorescently labeled probe, any one of fluorescein (FAM), HEX, X-rhodamine (ROX), Cy3 (registered trademark), Cy5 (registered trademark), Cy5.5 (registered trademark), fluorescein isothiocyanate (FITC), Yakima Yellow (registered trademark), VIC, Tex615, Texas Red, JOE, and MAX can be used. When amplifying multiple regions of a nucleic acid, fluorescently labeled probes having complementary sequences in each region are used, and these fluorescent probes have different fluorescent labels, so that multiple nucleic acid regions can be detected / quantified in real time in one nucleic acid amplification system (multiplex PCR).

[0195] In addition to the above-mentioned components, the reaction solution of this embodiment may further contain a stabilizer, a preservative, a recombinase, an enzyme such as a nuclease, SSB, and the like.

[0196] The reaction solution of this embodiment preferably contains DNA polymerase and dNTPs as a reaction solution for amplifying DNA. In the case where the desired nucleic acid contained in the specimen is RNA, the reaction solution of this embodiment preferably contains a DNA polymerase having reverse transcriptase or reverse transcription activity. Thus, instead of implementing nucleic acid amplification from RNA, cDNA is first generated and then amplified by DNA polymerase.

[0197] The reaction solution of this embodiment can be stored in a state containing a colorant, or it can be divided into a test solution containing a colorant at a concentration of about 10 to 1000 times, and a test solution containing other components for storage. In this case, the test solution containing the colorant is diluted and added to the test solution containing other components just before being mixed with the specimen. Usually, nucleic acid amplification, especially the reaction solution of real-time PCR is weakly alkaline. Since it is stored for a long time under weakly alkaline conditions, the colorant has the possibility of becoming colorless without being accompanied by the nucleic acid amplification reaction. Therefore, the colorant itself is preferably stored in the state of an aqueous solution under weakly acidic to neutral conditions. It should be noted that the above-mentioned "test solution containing other components" does not necessarily have to be one test solution, and the components can also be separated and stored in multiple test solutions.

[0198] The reaction solution of the present embodiment can be a reaction solution prepared by mixing two or more test solutions prepared and preserved as different test solutions before the nucleic acid amplification reaction is about to be carried out. For example, during PCR, a test kit can be made that comprises a test solution (enzyme solution) containing an enzyme (polymerase) and a test solution (primer solution) containing a mixed primer. At this time, a colorant can be added to either or both of the enzyme solution and the primer solution just before mixing, or it can be added after mixing. Alternatively, it is also possible to preserve it in a state where the colorant is added to either or both of the enzyme solution and the primer solution in advance. In the case where a colorant is added in advance and preserved, it is preferably only added to a primer solution that is difficult to be affected by the effects of pH, etc. Alternatively, in the case where the above-mentioned test kit also possesses an extracting solution for extracting DNA from a specimen before the PCR reaction, a colorant can be added in advance to the extracting solution or a colorant can be added just before use. The extracting solution described herein refers to a test solution that is not separated from the nucleic acid in the sample and is directly mixed with the enzyme solution and the primer solution.

[0199] 2. Coloring Composition I

[0200] A second embodiment of the present invention is a coloring composition. The coloring composition of this embodiment includes a colorant to be added to a nucleic acid amplification reaction solution, wherein the colorant is a water-soluble dye that becomes colorless in a reaction solution at a pH of 7.5 to 10.5 and at 40° C. or higher.

[0201] The composition of this embodiment can be added to an aqueous solution along with DNA polymerase, dNTPs, divalent metal ions, etc., to prepare the reaction solution described in "1. Reaction Solution 1 for Nucleic Acid Amplification." Alternatively, the composition of this embodiment can be added to an existing commercially available reaction solution for nucleic acid amplification. In this embodiment, unless otherwise specified or there is no particular conflict, the definitions of terms such as "colorant," "colorless agent," and "water-soluble pigment" are the same as those described in "1. Reaction Solution 1 for Nucleic Acid Amplification."

[0202] The composition of this embodiment comprises at least a colorant and a carrier. The carrier is preferably a solvent, more preferably water. The composition of this embodiment may further comprise a pH buffer, a primer, a fluorescently labeled probe, etc. The composition of this embodiment preferably has a pH of 5.8 to 7.2, more preferably 6.0 to 7.0, and most preferably 7.0.

[0203] The composition of this embodiment preferably contains the colorant at a concentration of 0.01 to 0.001% by weight, particularly 0.005 to 0.0025% by weight. More specifically, the colorant is preferably contained at a concentration of 2 to 100 times, and more preferably 5 to 10 times, the concentration in the buffer used for nucleic acid amplification.

[0204] 3. Method I for Amplifying Nucleic Acids in a Specimen

[0205] The third embodiment of the present invention is a method for amplifying nucleic acids in a specimen. The method of this embodiment uses the colorant described in the section "1. Reaction solution I for amplifying nucleic acids," i.e., a water-soluble pigment that becomes colorless in a reaction solution at a pH of 7.5 to 10.5 and above 40°C. More specifically, the method of this embodiment uses the reaction solution described in the section "1. Reaction solution I for amplifying nucleic acids." It should be noted that, unless otherwise specified or there is no particular contradiction, the definitions of terms in this embodiment are the same as those described in the section "1. Reaction solution I for amplifying nucleic acids."

[0206] In this specification, "specimen" refers to a substance that has been made suitable for nucleic acid amplification by pretreatment, etc. from a "sample" in which the target nucleic acid is present or suspected to be present. "Sample" is not particularly limited as long as the target nucleic acid is present or suspected to be present, and includes any of animals, plants, microorganisms, viruses, etc. Among them, samples collected from an object that is a living organism, that is, biological samples, are also included. The "object" mentioned here refers to, for example, mammals and birds. Birds refer to animals belonging to the class Aves of the subphylum Chordata, and examples include: chickens, domestic ducks, quails, geese, wild ducks, turkeys, budgerigars, parrots, mandarin ducks, swans, etc. Mammals include humans and animals other than humans belonging to the class Mammalia of the subphylum Chordata, including: primates including humans and chimpanzees; pet animals such as dogs and cats; livestock animals such as cattle, pigs, horses, sheep, goats, etc.; rodents such as mice and rats; mammals kept in zoos, etc. The object in this specification is preferably human. As a biological sample, there is no particular limitation, and it can be, for example, nasal swab fluid, pharyngeal swab fluid, nasal secretions, saliva, sputum, mouthwash, blood (for example, whole blood, serum, plasma), urine, feces, milk, tissue or cell extract, or a mixture thereof. In addition, the sample is not limited to a biological sample, for example, it also includes a sample obtained from food, sewage, etc. According to its properties, the structure of the target nucleic acid, etc., the sample can be subjected to pretreatments such as nucleic acid extraction. In particular, in the nucleic acid amplification method of the present embodiment, it is preferred that the specimen does not contain substances that hinder enzyme reactions and fluorescence detection. As such pretreatments, it is possible to cite: for example, protein deformation / decomposition based on surfactants, etc., solvent extraction, solvent precipitation, column purification, etc.

[0207] One method of this embodiment includes reacting nucleic acids in a sample in a reaction solution, wherein the reaction solution contains a DNA polymerase or RNA polymerase; at least one set of primers for amplifying a desired region of the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); a divalent metal ion; a pH buffer; and a colorant, wherein the pH of the reaction solution is 7.5 to 10.5, and the colorant is a water-soluble pigment that becomes colorless in a reaction solution at or above 40°C. This method allows mixing the sample and the reaction solution during the nucleic acid amplification reaction while the reaction solution is colored, i.e., in a state where the reaction solution can be easily visually confirmed. Furthermore, amplification of the desired region of the nucleic acid and colorization of the colorant can subsequently be achieved simultaneously, and the colorant has no or minimal effect on detection of the amplified product.

[0208] Another method of the present embodiment is a method for simultaneously amplifying multiple regions of a nucleic acid in a specimen, comprising: preparing multiple reaction solutions and simultaneously reacting the nucleic acids in the specimen in each reaction solution; the multiple reaction solutions containing: a DNA polymerase or an RNA polymerase; at least one primer set for each desired region of the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); a divalent metal ion; and a pH buffer; the pH of the reaction solutions being between 7.5 and 10.5; and the multiple reaction solutions containing different colorants, each of which is a water-soluble pigment that becomes colorless at a temperature above 40°C. This method involves aliquoting a single specimen into multiple reaction solutions, allowing the multiple reaction solutions to react simultaneously.

[0209] A plurality of reaction solutions preferably amplify regions that are different from each other. It is not necessary to amplify a region with one reaction solution, and a plurality of reaction solutions that amplify multiple regions can be used. Alternatively, a reaction solution that only amplifies a region and a reaction solution that amplifies multiple regions can be used in combination.

[0210] Multiple reaction solutions contain different colorants. It is particularly preferred to use multiple colorants with different maximum absorption wavelengths (different hues). In the operation before amplifying nucleic acid, when one nucleic acid is dispensed into multiple reaction solutions, by distinguishing the colors according to the reaction solutions, that is, according to the type of nucleic acid to be amplified, it is easy to visually confirm each category, thereby reducing the risk of operator dispensing errors. It should be noted that the above-mentioned multiple reaction solutions may include only one colorless reaction solution that does not contain a colorant.

[0211] Yet another aspect of the method of this embodiment is a method for simultaneously amplifying multiple regions of a nucleic acid in a specimen, the method comprising: preparing a reaction solution and reacting multiple nucleic acids in the specimen simultaneously, the reaction solution comprising: DNA polymerase or RNA polymerase, primers for amplifying desired regions on the nucleic acid and at least one group corresponding to each region, deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), divalent metal ions, a pH buffer, and a colorant, the pH of the reaction solution being 7.5 to 10.5, and the colorant being a water-soluble pigment that becomes colorless in a reaction solution above 40°C.

[0212] This method is a method for simultaneously amplifying multiple nucleic acid regions in one reaction solution. This method is suitable for example for multiplex PCR. When simultaneously amplifying multiple nucleic acid regions in one reaction solution, it is necessary to use a variety of fluorescently labeled probes described later. In order to amplify / detect multiple nucleic acids, it is preferred to be able to select the fluorescent pigment to be used from fluorescent pigments with more different fluorescence. However, when the colorant contained in the reaction solution interferes with the fluorescence of a certain range of wavelengths, the fluorescent pigment that can be selected in this part will be limited. In this method, since the colorant becomes colorless in the nucleic acid amplification reaction, it is not necessary to consider the influence of the interference on fluorescence, and a suitable fluorescent pigment can be selected from more candidates.

[0213] In the method of the present embodiment, the colorant is not particularly limited as long as it is a water-soluble pigment that becomes colorless in a reaction solution at pH 7.5 to 10.5 and above 40°C, and is particularly preferably a non-fluorescent pigment. The method of the present embodiment preferably further comprises a fluorescent intercalator or a fluorescently labeled probe in the reaction solution. By using a fluorescent intercalator or a fluorescently labeled probe, nucleic acid amplification and detection can be performed simultaneously. Since the fluorescent intercalator is easy to use, it is particularly useful when only one region is amplified in one reaction solution. On the other hand, the fluorescently labeled probe can be used to combine a plurality of probes with different fluorescent pigments, and is therefore useful when amplifying multiple regions in one reaction solution (e.g., multiplex PCR).

[0214] 4. Reaction Solution II for Nucleic Acid Amplification

[0215] The fourth embodiment of the present invention is a reaction solution for amplifying nucleic acid, which contains a color-changing agent and a colorant. The above-mentioned color-changing agent is an oxidizing agent, a reducing agent or an acidifying agent, and the above-mentioned colorant is a water-soluble pigment that changes color or becomes colorless in a reaction solution above 40°C in the presence of the color-changing agent.

[0216] In this specification, a "color-changing agent" refers to a chemical that changes the maximum absorption wavelength of a solution of a colorant, described later, or reduces its absorbance. Chemicals that reduce the absorbance of a solution of a colorant are particularly preferred; in this case, the color-changing agent is also referred to as a "decolorizing agent." Specifically, a color-changing agent is an oxidizing agent, a reducing agent, or an acidifying agent. The oxidizing agent described herein is not particularly limited and may be one or more oxidizing agents selected from, for example, hydrogen peroxide, potassium permanganate, potassium chlorate, potassium dichromate, sodium bromate, potassium bromate, halogens, concentrated sulfuric acid, nitric acid, sodium hypochlorite, chlorine dioxide, chloramines, osmium tetroxide, dimethyl sulfoxide, and m-chloroperbenzoic acid. The reducing agent is not particularly limited and may be, for example, one or more reducing agents selected from the group consisting of sodium borohydride, sodium cyanoborohydride, sodium bisulfite, sodium sulfite, sodium dithionite, potassium metabisulfite, sodium thiosulfate, glutathione, ascorbic acid, 2-ethanethiol, DL-dithiothreitol, 1-thioglycerol, cysteine, tributylphosphine, aminoethylthiol, and tris(2-carboxyethyl)phosphine. The acidifying agent is not particularly limited and may be, for example, one or more acidifying agents selected from the group consisting of hydrochloric acid, sulfuric acid, nitric acid, acetic acid, formic acid, oxalic acid, citric acid, and lactic acid.

[0217] The concentration of the color-changing agent in the reaction solution is preferably set to a concentration that shifts the maximum absorption wavelength of the colorant (described later) or reduces absorbance, while not hindering nucleic acid amplification. Furthermore, the concentration of the color-changing agent is preferably adjusted to a level at which the reaction solution does not change color or becomes colorless before heating. The concentration of the color-changing agent can be appropriately adjusted depending on the type of color-changing agent and colorant used, and can be, for example, 0.1 to 1000 mM, particularly 0.5 to 500 mM, and further preferably 1 to 100 mM.

[0218] In this embodiment, the colorant needs to change color or become colorless in the presence of a color-changing agent in an aqueous solution at 40° C. or higher. In this specification, "color change" of an aqueous solution means a change of 20 nm or more in the maximum absorption wavelength in the visible light region.

[0219] In this embodiment, the colorant preferably becomes colorless in an aqueous solution at or above 40°C in the presence of a color-changing agent. Colorlessness, i.e., the intensity of the absorption peak in the visible light region is suppressed to a low level, allows detection and measurement of various fluorescent signals generated during nucleic acid amplification reactions without interference from the colorant. In particular, the absorbance at the maximum absorption wavelength in the visible light region is preferably reduced to 20% or less, particularly preferably to 10% or less, and even more preferably to 5% or less, by heating at 80°C for 10 minutes in the presence of a color-changing agent.

[0220] On the other hand, the colorant preferably does not change color or become colorless at room temperature (eg, 20-25° C.) in the absence of a color-changing agent. Furthermore, in the absence of a color-changing agent, the colorant does not change color or become colorless even without heating or warming.

[0221] In this embodiment, the colorant is a water-soluble pigment, and is not particularly limited as long as it changes color or becomes colorless in an aqueous solution at 40°C or above in the presence of a color-changing agent. A low molecular weight substance is preferred, and specifically, a substance having a molecular weight of less than 1000 is preferred. Examples of water-soluble pigments include thiazine pigments, Azine pigments, azo pigments, azine pigments, triphenylmethane pigments, phenazine pigments, Tonene pigments, phenanthridine pigments, lactone pigments, sultone pigments, indigo pigments, cyanine pigments, oxonol pigments, styryl pigments, porphyrin pigments, thio Tonne pigments, squaric acid pigments, crotonic acid pigments, Pigments, dithiol metal salt pigments, naphthoquinone pigments, anthraquinone pigments, indophenol pigments, coumarin pigments, ketocoumarin pigments, pyran Salt pigments, thiopyrans Salt-based, thiazole-based pigments, quinoline-based pigments, benzophenone-based pigments, thiobenzophenone-based pigments and mixtures thereof. Non-fluorescent pigments are particularly preferred, and thiazine-based pigments are further preferred. Azo pigments and oxazine pigments.

[0222] In the present embodiment, as the colorant, at least one compound selected from the group consisting of compounds represented by the following formulae (VI) to (X) can be appropriately used.

[0223]

[0224] The compound represented by formula (VI) is a thiazine-based pigment, a blue water-soluble pigment called methylene blue, and has a maximum absorption wavelength of 664 nm.

[0225]

[0226] The compound represented by formula (VII) is a thiazine-based pigment, a blue water-soluble pigment called thioninyl acetate, and has a maximum absorption wavelength of 598 nm.

[0227]

[0228] The compound represented by formula (VIII) is a thiazine-based pigment, a blue water-soluble pigment called toluidine blue, and has a maximum absorption wavelength of 628 nm.

[0229]

[0230] The compound represented by formula (IX) is Azine-based pigment is a blue water-soluble pigment called brilliant cresol blue, and its maximum absorption wavelength is 624 nm.

[0231]

[0232] The compound represented by formula (X) is an azo dye, a red water-soluble dye called Basic Red 29, and has a maximum absorption wavelength of 509 nm.

[0233] The concentration of the colorant in the reaction solution is not particularly limited as long as the coloration of the solution can be visually confirmed, but is preferably 0.002% by weight or less, and more preferably 0.001% by weight or less.

[0234] In addition to the colorant, the reaction solution of this embodiment also contains other components required for amplifying the sequence of the desired region from the nucleic acid serving as a template. These other components vary depending on the method of nucleic acid amplification. The following examples illustrate the components required for nucleic acid amplification using real-time PCR.

[0235] The reaction solution used to amplify nucleic acids in real-time PCR usually contains at least the following components:

[0236] - DNA polymerase or RNA polymerase, preferably DNA polymerase;

[0237] - at least one set of forward primers and reverse primers for amplifying a desired region on a nucleic acid;

[0238] - deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), preferably dNTPs;

[0239] - divalent metal ions, preferably magnesium ions (Mg 2+ );as well as

[0240] -pH buffer.

[0241] The reaction solution used for nucleic acid amplification is typically at a weakly alkaline pH of 7.5 to 10.5, particularly 8.0 to 9.0. In one embodiment, the reaction solution comprises a primer set for amplifying a single region, and the aforementioned color-changing agent and colorant. In another embodiment, the reaction solution for nucleic acid amplification comprises a primer set for amplifying multiple regions, at least one primer set per region, and the aforementioned color-changing agent and colorant.

[0242] As the above-mentioned DNA polymerase, there is no particular limitation, and for example, Taq DNA polymerase, Tth DNA polymerase, KOD DNA polymerase, Bst DNA polymerase, Bsu DNA polymerase, etc. can be used. Existing pH buffers commonly used in real-time PCR, such as Good buffers such as Tris, phosphate buffer, and HEPES, can be used. In the case where the above-mentioned divalent metal ion is Mg 2+ When, for example, the concentration can be set to about 2 mM.

[0243] In the real-time PCR method, the reaction solution for amplifying nucleic acid further includes an intercalating fluorescent pigment or a fluorescently labeled probe. An intercalating fluorescent pigment is a pigment that emits fluorescence in combination with double-stranded nucleic acid. By measuring the given fluorescence in the reaction solution, the double-stranded nucleic acid after purification in the reaction solution can be quantified. Examples of such intercalating fluorescent pigments include SYBR (registered trademark) Green, TB Green, and Eva Green. On the other hand, a fluorescently labeled probe has a sequence complementary to a portion of the above-mentioned desired region and emits fluorescence by binding to the region in the amplified product. Such fluorescently labeled probes are not particularly limited and can use TaqMan (registered trademark) probes. As the fluorescent pigment used in the fluorescently labeled probe, any one of fluorescein (FAM), HEX, X-rhodamine (ROX), Cy3 (registered trademark), Cy5 (registered trademark), Cy5.5 (registered trademark), fluorescein isothiocyanate (FITC), Yakima Yellow (registered trademark), VIC, Tex615, Texas Red, JOE, and MAX can be used. When amplifying multiple regions of a nucleic acid, fluorescently labeled probes having complementary sequences in each region are used, and these fluorescent probes have different fluorescent labels, so that multiple nucleic acid regions can be detected / quantified in real time in one nucleic acid amplification system (multiplex PCR).

[0244] In addition to the above-mentioned components, the reaction solution of this embodiment may further contain a stabilizer, a preservative, a recombinase, an enzyme such as a nuclease, SSB, and the like.

[0245] The reaction solution of this embodiment preferably contains DNA polymerase and dNTPs as a reaction solution for amplifying DNA. In the case where the desired nucleic acid contained in the specimen is RNA, the reaction solution of this embodiment preferably contains reverse transcriptase or a DNA polymerase with reverse transcription activity. Thus, instead of implementing nucleic acid amplification from RNA, cDNA is first generated, and then the cDNA is amplified by DNA polymerase.

[0246] The reaction solution of this embodiment can be stored in a state containing a colorant, or it can be divided into a test solution containing a colorant at a concentration of about 10 to 1000 times and a test solution containing other components for storage. In such a case, the test solution containing the colorant is diluted and added to the test solution containing other components just before mixing with the specimen. Alternatively, it can be stored in the form of a test solution containing a colorant at a concentration of about 10 to 1000 times and a test solution containing other components. In such a case, the test solution containing the colorant is diluted and added to the test solution containing other components just before mixing with the specimen. Alternatively, it can be stored in the form of a test solution containing a colorant at a concentration of about 10 to 1000 times, a test solution containing a color-changing agent at a concentration of about 10 to 1000 times, and a test solution containing other components. In such a case, the test solution containing the colorant and the test solution containing the color-changing agent are diluted and added to the test solution containing other components just before mixing with the specimen. Due to long-term storage in the presence of a color-changing agent, the colorant has the potential to change color or become colorless even without undergoing a nucleic acid amplification reaction. Therefore, the colorant and color-changing agent are preferably stored as separate test solutions. It should be noted that the "test solution containing other components" mentioned above does not necessarily have to be a single test solution; the components may also be stored separately in multiple test solutions.

[0247] The reaction solution of the present embodiment can be prepared by mixing two or more test solutions prepared and preserved as different test solutions before the nucleic acid amplification reaction is about to be carried out. For example, in the case of PCR, a test kit can be made that comprises a test solution (enzyme solution) containing an enzyme (polymerase) and a test solution (primer solution) containing a mixed primer. At this time, a colorant can be added to either or both of the enzyme solution and the primer solution before mixing. It can also be preserved in a state in which a colorant is added to either or both of the enzyme solution and the primer solution in advance, but in this case, it is preferably added in advance only to a test solution that does not contain a color-changing agent component in the enzyme solution or the primer solution. Alternatively, in the case where the above-mentioned test kit has an extracting solution for extracting DNA from a specimen before the PCR reaction, a colorant is added in advance to the extracting solution or a colorant is added just before use. The extracting solution described herein refers to a test solution that is directly mixed with the enzyme solution and the primer solution without being separated from the nucleic acid in the sample.

[0248] The color-changing agent can be stored in a state pre-added to the primer solution, preferably added to the enzyme solution, primer solution, colorant solution, or any mixture thereof immediately before the PCR reaction. The color-changing agent can also be pre-added to the extract, as long as it does not interfere with nucleic acid extraction. It should be noted that in any case, it is necessary to avoid adding the color-changing agent and colorant to the same test solution for storage.

[0249] 5. Coloring Composition II

[0250] A fifth embodiment of the present invention is a coloring composition in which the colorant is a water-soluble pigment that changes color or becomes colorless in a reaction solution at 40° C. or higher in the presence of a color-changing agent, and the color-changing agent is an oxidizing agent, a reducing agent, or an acidifying agent.

[0251] The composition of this embodiment can be used to prepare the reaction solution described in "4. Reaction Solution for Nucleic Acid Amplification" by adding DNA polymerase, dNTPs, divalent metal ions, and the like together with a color-changing agent to an aqueous solution. Furthermore, the composition of this embodiment can be added together with a color-changing agent to an existing commercially available reaction solution for nucleic acid amplification. In this embodiment, unless otherwise specified or there is no particular contradiction, the definitions of terms such as "colorant," "color-changing agent," "color change," "colorless," and "water-soluble dye" are the same as those in "1. Reaction Solution for Nucleic Acid Amplification I," "2. Coloring Composition I," and "4. Reaction Solution for Nucleic Acid Amplification II."

[0252] The composition of this embodiment comprises at least a colorant and a carrier. The carrier herein is preferably a solvent, more preferably water. The composition of this embodiment may further comprise a pH buffer, a primer, a fluorescently labeled probe, etc. The composition of this embodiment preferably has a pH of 5.0 to 9.0, more preferably 6.0 to 8.0, and most preferably 7.0.

[0253] The composition of this embodiment preferably contains the colorant at a concentration of 0.01 to 0.001% by weight, particularly preferably 0.005 to 0.0025% by weight. More specifically, the colorant is preferably contained at a concentration of 2 to 100 times, and more preferably 5 to 10 times, the concentration in the buffer used for nucleic acid amplification.

[0254] 6. Method II for Amplifying Nucleic Acids in Specimens

[0255] The sixth embodiment of the present invention is a method for amplifying nucleic acids in a specimen. The method of this embodiment uses a colorant described in the item "1. Reaction solution I for amplifying nucleic acids" or "4. Reaction solution II for amplifying nucleic acids", that is, a water-soluble pigment that changes color or becomes colorless in a reaction solution above 40°C in the presence of a color-changing agent. More specifically, the method of this embodiment uses the reaction solution described in the item "4. Reaction solution II for amplifying nucleic acids". It should be noted that, unless otherwise specified or there is no particular contradiction, the definition of the terms in this embodiment is the same as that described in any of the items "1. Reaction solution I for amplifying nucleic acids", "3. Method I for amplifying nucleic acids in a specimen" and "4. Reaction solution II for amplifying nucleic acids".

[0256] One method of the present embodiment includes a step of reacting the nucleic acid in the specimen in a reaction solution, wherein the reaction solution contains: DNA polymerase or RNA polymerase, at least one set of primers for amplifying the desired region on the nucleic acid, deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), divalent metal ions, a pH buffer, a color-changing agent, and a colorant, wherein the colorant is a water-soluble pigment that changes color or becomes colorless in a reaction solution above 40°C in the presence of the color-changing agent. This method allows mixing the specimen and the reaction solution in a state where the reaction solution is colored, that is, in a state where the reaction solution is easy to visually confirm, during the nucleic acid amplification reaction. In addition, thereafter, the amplification of the desired region of the nucleic acid and the color change or colorlessness of the colorant can be achieved simultaneously, and the colorant does not affect the detection of the amplification product, or the effect caused is extremely small.

[0257] Another method of the present embodiment is a method for simultaneously amplifying multiple regions of a nucleic acid in a specimen. The method includes the steps of preparing multiple reaction solutions and simultaneously reacting the nucleic acid in the specimen in each reaction solution. The multiple reaction solutions contain a DNA polymerase or an RNA polymerase, at least one set of primers corresponding to each desired region on the nucleic acid for amplification, deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), a divalent metal ion, and a color-changing agent. The multiple reaction solutions contain different colorants, each of which is a water-soluble pigment that changes color or becomes colorless in the reaction solution at a temperature of 40°C or above in the presence of the color-changing agent. This method involves injecting a single specimen into multiple reaction solutions and reacting the multiple reaction solutions simultaneously.

[0258] A plurality of reaction solutions preferably amplify regions that are different from each other. It is not necessary to amplify a region with a single reaction solution, and a plurality of reaction solutions that amplify a plurality of regions can be used. Alternatively, a reaction solution that amplifies only a single region and a reaction solution that amplifies a plurality of regions can be used in combination.

[0259] Multiple reaction solutions contain different colorants. In particular, it is preferred to use multiple colorants with different absorption wavelengths (different hues). In the operation before amplifying nucleic acid, when one nucleic acid is dispensed into multiple reaction solutions, by distinguishing the colors according to the reaction solutions, that is, according to the type of nucleic acid to be amplified, it is easy to visually confirm the various categories, thereby reducing the risk of operator dispensing errors. It should be noted that the above-mentioned multiple reaction solutions may include only one colorless reaction solution that does not contain a colorant.

[0260] Yet another aspect of the method of this embodiment is a method for simultaneously amplifying multiple regions of a nucleic acid in a specimen, the method comprising: preparing a reaction solution and simultaneously reacting regions of the nucleic acid in the specimen in the reaction solution, the reaction solution comprising: DNA polymerase or RNA polymerase, at least one set of corresponding primers for each region of the desired region on the nucleic acid for amplification, deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), divalent metal ions, a color-changing agent, and a colorant, wherein the colorant is a water-soluble pigment that changes color or becomes colorless in a reaction solution above 40°C in the presence of the color-changing agent.

[0261] This method is a method for simultaneously amplifying multiple nucleic acid regions in one reaction solution. This method is suitable for example for multiplex PCR. When simultaneously amplifying multiple nucleic acid regions in one reaction solution, it is necessary to use a variety of fluorescently labeled probes described later. In order to amplify / detect multiple nucleic acids, it is preferred to be able to select the fluorescent pigment used from fluorescent pigments with more different fluorescence. However, in the case where the colorant contained in the reaction solution interferes with the fluorescence of a certain wavelength, the fluorescent pigment that the corresponding part can select will be limited. In this method, since the colorant changes color or becomes colorless in the nucleic acid amplification reaction, the influence of interference on fluorescence can be avoided, and suitable fluorescent pigments can be selected from more candidates.

[0262] In the method of this embodiment, the reaction solution may contain a pH buffer. As a pH buffer, an existing pH buffer commonly used for real-time PCR, such as Tris, phosphate buffer, HEPES, or other Good buffer, can be used. The pH of the reaction solution can be adjusted to pH 7.5 to 10.5, particularly pH 8.0 to 9.0. The above-mentioned colorant is not particularly limited as long as it is a water-soluble pigment that changes color or becomes colorless in a reaction solution above 40°C in the presence of a color-changing agent, and is particularly preferably a non-fluorescent pigment. In the method of this embodiment, the reaction solution further preferably contains a fluorescent intercalator or a fluorescently labeled probe. By using a fluorescent intercalator or a fluorescently labeled probe, nucleic acid amplification and detection can be performed simultaneously. Since the fluorescent intercalator is easy to use, it is particularly useful when only one region is amplified in one reaction solution. On the other hand, the fluorescently labeled probe can be used in combination with different fluorescent pigments in a plurality of probes, and is therefore useful when amplifying multiple regions in one reaction solution (e.g., multiplex PCR).

[0263] Example

[0264] Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following description is not intended to limit the present invention to the scope of the Examples.

[0265] [Example 1] Colorization of Colorant by Heating

[0266] (1) Test Example 1

[0267] Methyl green (CI42585) (formula (I) below) was added to a PCR reaction solution containing no primers or probes (TaqPath (trademark) 1-Step Multiplex Master Mix (No ROX), pH 8.3-8.9) at 0.0025% (w / v) to prepare a colorant solution. The colorant solution was dispensed into a 96-well V-bottom white microtiter plate at 50 μL / well and allowed to stand at room temperature for 5 minutes (non-heated) or heated in a 95°C heating block for 5 minutes (heated). The coloration of the colorant solution under non-heated and heated conditions was visually confirmed. In addition, the absorption spectra of each non-heated and heated colorant solution were obtained using a spectrophotometer.

[0268]

[0269] (2) Test Example 2

[0270] The same test as in Test Example 1 was conducted except that methyl green (CI42590) (the following formula (II)) was used instead of methyl green (CI42585).

[0271]

[0272] (3) Test Example 3

[0273] The same test as in Test Example 1 was conducted except that malachite green (the following formula (III)) was used instead of methyl green (CI42585).

[0274]

[0275] (4) Test Example 4

[0276] The same test as in Test Example 1 was conducted except that Brilliant Green SF Yellow (the following formula (IV)) was used instead of Methyl Green (CI42585).

[0277]

[0278] (5) Test Example 5

[0279] The same test as in Test Example 1 was conducted except that Brilliant Green SF Yellow (the following formula (V)) was used instead of Methyl Green (CI42585).

[0280]

[0281] (6) Results

[0282] Figure 1 Photographs of the colorant solutions of Test Examples 1 and 3, under non-heating and heating conditions, are shown. The numerical values ​​below each well indicate the absorbance of the solution at 625 nm (Test Example 1) and 617 nm (Test Example 3). In both Test Examples 1 and 3, blue coloration was observed under non-heating conditions, and it was confirmed that this coloration was eliminated by heating. Figures 2 to 6 The absorption spectra before and after heating are shown for each colorant solution of Examples 1 to 5. In all colorant solutions, it was confirmed that the absorbance at the maximum absorption wavelength under non-heating significantly decreased after heating.

[0283] [Example 2] pH effect test

[0284] (1) Test Example 6

[0285] A colorant solution was prepared by adding methyl green (CI42585) to a pH 7.0 50 mM Tris solution to a concentration of 0.0025% (w / v). This colorant solution was dispensed into a 96-well V-bottom white microtiter plate at 50 μL / well. The plate was then allowed to stand at room temperature for 5 minutes (unheated) or heated in a 95°C heating block for 2 minutes (heated). Coloration of the colorant solution under both unheated and heated conditions was visually verified.

[0286] (2) Test Example 7

[0287] The same test as in Test Example 6 was conducted except that a 50 mM Tris solution at pH 8.0 was used instead of the 50 mM Tris solution at pH 7.0.

[0288] (3) Test Example 8

[0289] The same test as in Test Example 6 was conducted except that a 50 mM Tris solution at pH 9.0 was used instead of the 50 mM Tris solution at pH 7.0.

[0290] (4) Test Example 9

[0291] The same test as in Test Example 6 was conducted except that 50 mM phosphate buffer at pH 8.0 was used instead of 50 mM Tris solution at pH 7.0.

[0292] (5) Results

[0293] Figure 7Photographs of the colorant solutions of Test Examples 6 to 9 under non-heating and heating conditions are shown. The results of visual color determination are shown below each well. In Test Example 6, there was almost no difference in coloration between non-heating and heating, while in Test Examples 7 and 8, the solution became significantly colorless. In particular, Test Example 8, which had a high pH, ​​showed significant colorlessness. Compared to Test Example 7 at the same pH, Test Example 9, which used a phosphate buffer, showed a higher degree of colorlessness. The above shows that methyl green becomes colorless when heated under weakly alkaline conditions, but does not become colorless when heated under neutral conditions.

[0294] [Example 3] Coloring / colorless stability of colorant

[0295] (1) Test Example 10

[0296] Methyl green (CI42585) was added to TaqPath (trademark) 1-Step Multiplex Master Mix (No ROX) to a concentration of 0.0025% (w / v) to prepare a colorant solution. 50 μL / well of the colorant solution was dispensed into a 96-well V-bottom white microtiter plate and allowed to stand at room temperature for 2 minutes (non-heated) or heated in a 95°C heating block for 2 minutes (heated). The plate was then left to stand under refrigerated conditions (1-4°C) for 27 hours, and the coloration of the colorant solution under non-heated and heated conditions was visually confirmed. Furthermore, absorption spectra were obtained using a spectrophotometer for each non-heated and heated colorant solution.

[0297] (2) Results

[0298] Figure 8 The appearance of the unheated and heated colorant solutions after refrigerated storage for 27 hours is shown. Visual color determination results are shown below each well. It was confirmed that the unheated colorant solution did not become colorless even under weakly alkaline conditions after 27 hours of refrigerated storage. On the other hand, the colorant that became colorless by heating did not recolor even after refrigerated storage for 27 hours, confirming that the colorless amplification product solution can be refrigerated for at least 27 hours.

[0299] [Example 4] Effect of Real-time PCR on Colorants

[0300] (1) Test Example 11

[0301] The DOCK2 SNP (G / A) detection reagent was prepared under the following conditions. Primer sets (sequence numbers 1 and 2) and fluorescently labeled probes (sequence numbers 3 and 4) corresponding to the G allele and A allele of DOCK2 were prepared respectively. The base sequences of each primer and probe are shown in Table 1. For the fluorescent labeling, FAM was used in the probe for the G allele, and ROX was used in the probe for the A allele. The primer set corresponding to the G / A allele and the fluorescently labeled probe were added to TaqPath (trademark) 1-Step Multiplex Master Mix (No ROX) to prepare a reaction solution for amplifying nucleic acid.

[0302]

[0303] Synthetic DNA corresponding to the DOCK2 G allele and A allele was added to the above-mentioned nucleic acid amplification reaction solution at concentrations of 500, 5,000, 50,000, and 500,000 copies / test, respectively, to serve as template DNA. Each reaction solution was dispensed into a real-time PCR microplate, sealed, and reacted according to the temperature conditions shown in Table 2.

[0304]

[0305] (2) Test Example 12

[0306] The same test as in Test Example 11 was performed except that methyl green (CI42585) was further added to the reaction solution for nucleic acid amplification so as to be 0.0025% (w / v).

[0307] (3) Test Example 13

[0308] The same test as in Test Example 11 was performed except that PrecisionBlue (trademark) (BioRad) was further added to the reaction solution for nucleic acid amplification so as to be 0.005% (v / v).

[0309] (4) Test Example 14

[0310] The same test as in Test Example 11 was conducted except that malachite green was further added to the reaction solution for nucleic acid amplification so as to be 0.0005% (w / v).

[0311] (5) Test Example 15

[0312] The same test as in Test Example 11 was conducted except that Brilliant Green SF Yellow was further added to the above-mentioned reaction solution for nucleic acid amplification so as to be 0.00125% (w / v).

[0313] (6) Test Example 16

[0314] The same test as in Test Example 11 was conducted except that acid fuchsin was further added to the reaction solution for nucleic acid amplification so as to be 0.001% (w / v).

[0315] (7) Results

[0316] Figure 9 The temporal changes in fluorescence intensity of real-time PCR in Test Examples 11 to 13 are shown. Figure 9 A shows the temporal change of FAM fluorescence intensity, Figure 9 B shows the change over time of ROX fluorescence intensity. In addition, Table 3 shows the Cq values ​​relative to each template DNA copy number in Test Examples 11 to 13. About the fluorescence intensity of FAM, compared with Test Example 11, a tendency of overall decline can be seen in Test Example 12 with the addition of methyl green, but no significant decrease in brightness is observed. In addition, the Cq value obtains the same result in any test example. On the other hand, about the fluorescence intensity of ROX, in Test Example 12, no significant difference is observed between the fluorescence intensity and the Cq value and Test Example 11, but in Test Example 13, a significant decrease in fluorescence intensity is observed, and differences also occur in the Cq value. Thus, it is confirmed that methyl green does not affect the nucleic acid amplification of real-time PCR, nor does it produce interference with the fluorescent signal.

[0317]

[0318] Figure 10 The temporal changes in fluorescence intensity during real-time PCR in Test Examples 11 and 13 to 16 are shown. Figure 10 A shows the temporal changes in FAM fluorescence intensity in real-time PCR using 50,000 copies / test of template DNA. Figure 10 B shows the time variation of the ROX fluorescence intensity in the real-time PCR using the template DNA of 500 copies / tests. About the fluorescence intensity of FAM, it was confirmed that all the same fluorescence intensity was shown. On the other hand, about the fluorescence intensity of ROX, only Test Example 13 significantly reduced, but other test examples all showed the same fluorescence intensity. Thus, for malachite green, brilliant green SF yellow, acid fuchsin, it was confirmed that it did not affect the nucleic acid amplification of real-time PCR, nor did it produce interference with the fluorescent signal.

[0319] [Example 5] Effect of Colorant on Isothermal Nucleic Acid Amplification

[0320] As isothermal nucleic acid amplification, nucleic acid amplification using TRIAmp was performed. The primers used in the TRIAmp reaction were identical to the forward primer DRa21 (SEQ ID NO: 5) and the reverse primer DRb19 (SEQ ID NO: 6) whose sequences were the same as those of the repetitive sequence of Mycobacterium tuberculosis described in International Publication No. 2021 / 124681 as the target nucleic acid.

[0321] Forward primer: cggggttttgggtctgacgac (SEQ ID NO: 5)

[0322] Reverse primer: cccgagaggggacggaaac (SEQ ID NO: 6)

[0323] A primer mix containing 20 μM of each primer was prepared. Next, a 2× TRIAmp buffer mixture consisting of 40 mM Tris buffer (pH 8.8), 20 mM potassium chloride, 20 mM ammonium sulfate, 0.2% Tween (registered trademark) 20, 1.8 M betaine, 1.6 mM deoxynucleoside triphosphates, and 12 mM magnesium sulfate was prepared. 2 μL of the DNA sample was added to 12.5 μL of the TRIAmp buffer mixture, 2 μL of the primer mix, 8 units of Bst DNA polymerase, and 5 μL of a 10,000-fold diluted SYBR Green I solution, for a total of 25 μL of TRIAmp reaction solution. The DNA sample used was a solution of 100 pg / μL of DNA extracted and purified from the Mycobacterium bovis BCG strain. As a control, a control reaction solution was prepared by adding PBS containing no DNA in place of the DNA sample.

[0324] (1) Test Example 17

[0325] The TRIAmp reaction solution and the control reaction solution were reacted at 68° C. for 1 hour using a real-time PCR apparatus (LightCycler 96) manufactured by Roche, and fluorescence was measured over time.

[0326] (2) Test Example 18

[0327] The test was conducted in the same manner as in Test Example 17, except that 0.00125% (w / v) of Brilliant Green SF Yellow was added to the reaction solution for nucleic acid amplification.

[0328] (3) Test Example 19

[0329] The test was conducted in the same manner as in Test Example 17, except that 0.001% (w / v) of acid fuchsin was added to the reaction solution for nucleic acid amplification.

[0330] (4) Results

[0331] Figure 11 The time-dependent changes in fluorescence intensity for the negative and positive controls for each test example are shown. Table 4 also shows the Tt values ​​(in minutes) for each test example and the color tones before and after the reaction. During isothermal nucleic acid amplification at 68°C, Brilliant Green SF Yellow and Acid Fuchsin were confirmed to be colorless. Furthermore, the nucleic acid amplification reaction demonstrated similar results to those obtained under conditions without the addition of a colorant.

[0332]

[0333] [Example 6] Colorization of Colorant by Heating in the Presence of a Reducing Agent

[0334] (1) Test Examples 20 to 24

[0335] In a 0.5 mL polypropylene tube for PCR, 50 μL of colorant solutions containing the dyes and sodium sulfite at the concentrations shown in Table 5 were prepared. Each colorant solution was heated in a 95°C heating block for 5 minutes. Absorption spectra of the unheated and heated aqueous solutions were obtained using a spectrophotometer.

[0336]

[0337] (2) Results

[0338] Figures 12 to 16 Absorption spectra of the unheated and heated colorant solutions of Test Examples 20 to 24 are shown. In Test Examples 20 to 23, the absorption peak observed in the unheated state almost disappeared. In Test Example 24, the maximum absorption wavelength shifted to the lower wavelength side, confirming discoloration. Furthermore, the peak area under the peak (AUC) was significantly reduced.

[0339] [Example 7] Effect of Methylene Blue on Real-Time PCR

[0340] (1) Test Example 25

[0341] A reagent for DOCK2 SNP (G / A) detection was prepared under the following conditions. Primer sets corresponding to the G allele and A allele of DOCK2 (sequence numbers 1 and 2 in Table 1) and fluorescently labeled probes (sequence numbers 3 and 4 in Table 1) were prepared, respectively. Fluorescent labels used FAM for the G allele probe and ROX for the A allele probe. The primer set corresponding to the G / A allele and the fluorescently labeled probe were added to TaqPath (trademark) 1-Step Multiplex Master Mix (No ROX) to prepare a reaction solution for nucleic acid amplification.

[0342] As template DNA, synthetic DNA corresponding to the DOCKS2 G allele and A allele was added to the above-mentioned nucleic acid amplification reaction solution at concentrations of 500, 5,000, 50,000, and 500,000 copies / test, respectively. Each reaction solution was dispensed into a real-time PCR microplate, sealed, and reacted under the temperature conditions shown in Table 2.

[0343] (2) Test Examples 26 to 29

[0344] The same test as in Test Example 25 was performed except that methylene blue and sodium nitrite were added to the above-mentioned reaction solution for nucleic acid amplification in the amounts shown in Table 6.

[0345]

[0346] (3) Test Example 30

[0347] The same test as in Test Example 25 was conducted except that Precision Blue (trademark) (BioRad) was further added to the reaction solution for nucleic acid amplification so as to be 0.005% (v / v).

[0348] (4) Results

[0349] Figure 17 The time-dependent changes in the fluorescence intensity of ROX in real-time PCR of Test Examples 25 to 30 are shown. It can be confirmed that the addition of methylene blue and sodium sulfite did not hinder the PCR reaction. In Test Examples 26 and 30, which did not contain sodium nitrite, the fluorescence of ROX was disturbed. On the other hand, in Test Examples 27 to 29, in which methylene blue and sodium sulfite were added simultaneously, it was confirmed that the fluorescence of ROX was not disturbed, and the same real-time PCR as in Test Example 6 could be achieved.

[0350] [Example 8] Effect of Toluidine Blue on Real-Time PCR

[0351] (1) Test Examples 31 to 34

[0352] The same test as in Test Example 25 was performed except that toluidine blue and sodium nitrite were added to the above-mentioned reaction solution for amplifying nucleic acid in the amounts shown in Table 7.

[0353]

[0354] (2) Results

[0355] Figure 18The following table shows the time-dependent changes in the fluorescence intensity of ROX during real-time PCR in Test Examples 25, 30, and 34. It was confirmed that the addition of toluidine blue and sodium sulfite did not inhibit the PCR reaction. In Test Example 31, which did not contain sodium nitrite, it was confirmed that ROX fluorescence was disturbed, but the fluorescence intensity was restored by the addition of sodium sulfite.

[0356] [Example 9] Effect of Basic Red 29 on Real-time PCR

[0357] (1) Test Examples 35 to 39

[0358] The same test as in Test Example 25 was conducted except that Basic Red 29 and sodium nitrite were added to the above-mentioned reaction solution for nucleic acid amplification in the amounts shown in Table 8.

[0359]

[0360] (2) Results

[0361] Figure 19 The following table shows the time-dependent changes in FAM fluorescence intensity during real-time PCR in Test Examples 25, 35, and 39. It was confirmed that the addition of Basic Red 29 and sodium sulfite did not inhibit the PCR reaction. In Test Example 35, which did not contain sodium nitrite, it was confirmed that FAM fluorescence was disturbed, but the addition of sodium sulfite restored the fluorescence intensity.

[0362] All publications, patents and patent applications cited in this specification should be incorporated into this specification in their entirety by reference.

Claims

1. A reaction solution for amplifying nucleic acid, wherein: The reaction solution has a pH of 7.5 to 10.5 and contains a colorant. The colorant is a water-soluble pigment that becomes colorless in a reaction solution at a pH of 7.5 to 10.5 and above 40°C.

2. The reaction solution according to claim 1, wherein The molecular weight of the water-soluble pigment is lower than 1000.

3. The reaction solution according to claim 1, wherein When heated at 80°C for 10 minutes, the absorbance at the maximum absorption wavelength in the visible light region decreases to less than 10%.

4. The reaction solution according to claim 1, wherein The colorant is a non-fluorescent pigment.

5. The reaction solution according to claim 1, wherein The colorant is triphenylmethane pigment. The reaction solution according to claim 5, wherein The triphenylmethane dye is at least one compound selected from the compounds represented by the following formulas (I) to (V), ， ， ， ， 。 7. A composition for coloring comprising a colorant to be added to a reaction solution for nucleic acid amplification, wherein: The colorant is a water-soluble pigment that becomes colorless in a reaction solution at a pH of 7.5 to 10.5 and above 40°C. A method for amplifying a nucleic acid in a sample, comprising using the reaction solution according to any one of claims 1 to 6.

9. A method for amplifying a nucleic acid in a sample, the method comprising: The step of reacting the nucleic acid in the sample in the reaction solution, The reaction solution comprises: DNA polymerase or RNA polymerase, at least one set of primers for amplifying a desired region on a nucleic acid, deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), Divalent metal ions, pH buffers, and colorants, The pH of the reaction solution is 7.5-10.5, The colorant is a water-soluble pigment that becomes colorless in a reaction solution at 40° C. or above.

10. The method according to claim 9, wherein: The colorant is a non-fluorescent pigment.

11. The method according to claim 10, wherein: The reaction solution further contains an intercalating fluorescent dye.

12. The method according to claim 9, wherein The reaction solution further contains a probe bound to a fluorescent dye.

13. A method for simultaneously amplifying multiple regions of a nucleic acid in a sample, the method comprising: A step of preparing a plurality of reaction solutions containing the following components and reacting the nucleic acid in the sample simultaneously in each reaction solution. The plurality of reaction solutions include: DNA polymerase or RNA polymerase, For amplifying desired regions on nucleic acid, each region corresponds to at least one set of primers, deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), Divalent metal ions, and pH buffers, The pH of the reaction solution is 7.5-10.5, The plurality of reaction solutions further contain colorants different from each other, The colorants are all water-soluble pigments that become colorless in a reaction solution at 40° C. or above.

14. A method for simultaneously amplifying multiple regions of a nucleic acid in a sample, the method comprising: A step of preparing a reaction solution containing the following components and reacting multiple nucleic acids in a sample simultaneously. The one reaction solution comprises: DNA polymerase or RNA polymerase, For amplifying desired regions on nucleic acid, each region corresponds to at least one set of primers, deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), Divalent metal ions, pH buffers, and colorants, The pH of the reaction solution is 7.5-10.5, The colorant is a water-soluble pigment that becomes colorless in a reaction solution at 40° C. or above.

15. A reaction solution for nucleic acid amplification, comprising a color-changing agent and a colorant. in, The color changing agent is an oxidizing agent, a reducing agent or an acidifying agent, The colorant is a water-soluble pigment that changes color or becomes colorless in a reaction solution at 40° C. or higher in the presence of a color-changing agent. The reaction solution according to claim 15 , wherein The colorant has a molecular weight of less than 1,000.

17. The reaction solution according to claim 15, wherein When heated at 80°C for 10 minutes, the absorbance at the maximum absorption wavelength in the visible light region decreases to less than 10%.

18. The reaction solution according to claim 15, wherein The colorant is a non-fluorescent pigment.

19. The reaction solution according to claim 15, wherein The water-soluble pigment comprises at least one compound selected from the compounds represented by the following formulas (VI) to (X), ， ， ， ， 。 20. A composition for coloring comprising a colorant to be added to a reaction solution for nucleic acid amplification, in, The colorant is a water-soluble pigment that becomes colorless in a reaction solution at 40° C. or above in the presence of a color-changing agent. The color changing agent is an oxidizing agent, a reducing agent or an acidifying agent. A method for amplifying a nucleic acid in a sample, comprising using the reaction solution according to any one of claims 15 to 19.

22. A method for amplifying a nucleic acid in a sample, the method comprising: The step of reacting the nucleic acid in the sample in the reaction solution, Wherein, the reaction solution comprises: DNA polymerase or RNA polymerase, at least one set of primers for amplifying a desired region on a nucleic acid, deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), Divalent metal ions, Color-changing agents, and colorants, The color changing agent is an oxidizing agent, a reducing agent or an acidifying agent, The colorant is a water-soluble pigment that changes color or becomes colorless in a reaction solution at 40° C. or higher in the presence of a color-changing agent.

23. The method according to claim 22, wherein The colorant is a non-fluorescent pigment.

24. The method according to claim 22, wherein The reaction solution further contains an intercalating fluorescent dye.

25. The method according to claim 22, wherein The reaction solution further contains a probe bound to a fluorescent dye.

26. A method for simultaneously amplifying multiple regions of a nucleic acid in a sample, the method comprising: A step of preparing a plurality of reaction solutions and reacting the nucleic acid in the sample simultaneously in each reaction solution. The plurality of reaction solutions include: DNA polymerase or RNA polymerase, For amplifying desired regions on nucleic acid, each region corresponds to at least one set of primers, deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), Divalent metal ions, and Color-changing agent, The color changing agent is an oxidizing agent, a reducing agent or an acidifying agent, The plurality of reaction solutions further contain colorants different from each other, The colorant is a water-soluble pigment that changes color or becomes colorless in a reaction solution at 40° C. or above.

27. A method for simultaneously amplifying multiple regions of a nucleic acid in a sample, the method comprising: A step of preparing a reaction solution containing the following components and reacting the nucleic acid regions in the sample simultaneously in the reaction solution. The one reaction solution comprises: DNA polymerase or RNA polymerase, For amplifying desired regions on nucleic acid, each region corresponds to at least one set of primers, deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), Divalent metal ions, Color-changing agents, and colorants, The colorant is a water-soluble pigment that changes color or becomes colorless in a reaction solution at 40° C. or above.

Images