Method for increasing rice yield

Abstract

The invention belongs to the technical field of plant genetic engineering, discloses a method for increasing the yield of rice, and aims to solve the technical problem that the yield is reduced due to reduction of photosynthetic efficiency caused by light inhibition of rice under high-light-intensity illumination. According to the method, the expression quantity of the OsJAB1 gene in a target plant is increased, the content of vitamin C in the plant is increased, the photosynthetic electron transfer efficiency is improved, dry matter accumulation and grain development are promoted, and finally the rice yield is increased.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant genetic engineering, and particularly relates to a method for increasing the yield of rice, in particular a method for increasing the yield of rice by using OsJAB1 protein. BACKGROUND

[0002] Rice (Oryza sativa L.) is a major food crop in the world, and increasing the yield of rice through biological breeding technology has become an important direction of agricultural scientific research. Photosynthesis is the material basis for crop yield formation, and its efficiency directly affects the biomass and grain yield of rice.

[0003] Although sufficient light is a necessary condition for photosynthesis, excessive light will cause "photoinhibition" phenomenon, which damages the photosynthetic organs of rice, reduces the conversion efficiency of light energy, and reduces the accumulation of photosynthetic products. This phenomenon is particularly prominent in the northwest and south rice-growing areas of China with strong light, often leading to incomplete grain filling and a 10%-15% reduction in yield, which has become a key factor limiting the high and stable yield of rice.

[0004] Current methods to alleviate photoinhibition rely on cultivation measures (such as adjusting planting density, optimizing water and fertilizer management) or breeding stress-tolerant varieties. Although these methods have certain effects, they generally have problems such as complex operation, high cost, and difficulty in popularization, and have not fundamentally solved the problem of oxidative damage to the photosynthetic system under high light stress. High light intensity induces the accumulation of a large amount of reactive oxygen species (ROS), which exceeds the clearance capacity of the plant's endogenous antioxidant system, leading to damage to the structure of the thylakoid membrane, a decrease in photosynthetic enzyme activity, and an increase in photorespiration, further weakening the net photosynthetic efficiency. Existing breeding methods cannot simultaneously improve yield and enhance high light resistance and antioxidant capacity, and cannot break through the physiological bottleneck of rice in high light environments.

[0005] Therefore, from a molecular level, precise regulation of the antioxidant defense system of rice can reduce oxidative damage caused by high light and maintain photosynthetic electron transport efficiency, thereby significantly improving photosynthetic efficiency and material accumulation under strong light conditions, which has become a core technical problem that needs to be solved in current rice genetic improvement. SUMMARY

[0006] To achieve the above-mentioned application purposes, the present application realizes the following technical solutions: A method for increasing the yield of rice, comprising the following steps: overexpressing a gene encoding OsJAB1 protein in rice to increase the activity and / or content of the OsJAB1 protein, increase the size of rice grains, and thereby increase the yield of rice; OsJAB1 wherein the gene encoding OsJAB1 protein is OsJAB1. OsJAB1 ​The nucleotide sequence of the gene is shown in SEQ ID NO.1. OsJAB1 The amino acid sequence of the OsJAB1 protein encoded by the gene is shown in SEQ ID NO.2.

[0007] Furthermore, the OsJAB1 Genes also exist in the following forms: (2) A DNA molecule that has a nucleotide sequence identity of more than 75% with the nucleotide sequence shown in SEQ ID NO. 1 and encodes a protein associated with increasing plant yield; (3) A DNA molecule derived from rice that has more than 90% identity with the nucleotide sequence shown in SEQ ID NO. 1 and encodes a protein associated with increasing crop yield; (4) A DNA molecule that hybridizes with the nucleotide sequence shown in SEQ ID NO. 1 under stringent conditions and encodes a protein in plants that is related to increasing crop yield.

[0008] Furthermore, the OsJAB1 The OsJAB1 protein encoded by the gene also exists in the following forms: (1) A protein derived from the amino acid sequence of SEQ ID NO. 2 that is associated with increased plant yield, obtained by substituting and / or deleting and / or adding one or more amino acid residues; (2) A protein derived from rice that has 95% or more identity with the amino acid sequence shown in SEQ ID NO. 2 and is associated with increasing rice yield.

[0009] Furthermore, overexpression in rice OsJAB1 Gene, including the following steps: (1) Insert the nucleotide sequence shown in SEQ ID NO.1 into the cloning site of the pCAMBIA1307 vector Spe I and Sal I The recombinant plasmid pCAMBIA1307- OsJAB1 ; (2) The recombinant plasmid pCAMBIA1307- OsJAB1 Introducing Agrobacterium to obtain recombinant Agrobacterium; (3) Transforming rice plants with the recombinant Agrobacterium described in step (2) to obtain homozygous transgenic lines that can be stably inherited.

[0010] Furthermore, the recombinant plasmid pCAMBIA1307- OsJAB1 The construction method is as follows: (1) Design specific primers F1 and R1 and use PCR amplification OsJAB1 Gene; (2) Use restriction endonucleasesSpe I and Sal I double enzyme cutting the PCR amplification product obtained in step (1), to obtain a double enzyme cutting product; the pCAMBIA1307 vector; (3) using restriction endonuclease Spe I and Sal I double enzyme cutting the pCAMBIA1307 vector, to obtain a vector skeleton; (4) connecting the double enzyme cutting product obtained in step (2) and the vector skeleton obtained in step (3), to obtain the recombinant plasmid pCAMBIA1307- OsJAB1 ; The nucleotide sequence of the specific primer F1 is shown in SEQ ID NO. 3, and the nucleotide sequence of the specific primer R1 is shown in SEQ ID NO. 4. Beneficial effects

[0011] The application effectively improves the content of endogenous vitamin C in plants by overexpressing the gene in rice, and ensures the stable operation of photosynthesis under high light intensity. The method improves the actual photochemical efficiency (ETR) of rice and the carbon assimilation capacity, and promotes the accumulation of photosynthetic products. Ultimately, the thousand-grain weight of seeds is significantly increased, and the yield of rice is significantly improved. OsJAB1 BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 is OsJAB1 A schematic diagram of a plant overexpression vector.

[0013] Figure 2 is OsJAB1 A result graph of expression level detection in different overexpression transgenic materials (OE2 and OE3).

[0014] Figure 3 is OsJAB1 A result graph of vitamin C (AsA) content in overexpression transgenic materials (OE2 and OE3).

[0015] Figure 4 is OsJAB1 A result graph of photosynthetic electron transport efficiency (ETR) of overexpression transgenic materials (OE2 and OE3) under low (36 umol / m 2 .s), medium (336 umol / m 2 .s) and high light intensity (611, 801 and 1251 umol / m 2 .s).

[0016] Figure 5 is OsJAB1 Photos of grain size of overexpression transgenic materials (OE2 and OE3) and WT rice.​

[0017] Figure 6 is OsJAB1 Figure of result of overexpressing transgenic material (OE2 and OE3) and WT rice thousand-grain weight. DETAILED DESCRIPTION

[0018] In order to better understand the technical solutions in the present application, the present application will be further described in detail below in combination with embodiments. Embodiment 1

[0019] I. Construction of recombinant plasmid 1. Extract total RNA from rice Zhonghua 11, and then reverse transcribe to obtain cDNA.

[0020] 2. Take the cDNA obtained in step 1 as a template, and use specific primers F1 (SEQ ID NO. 3) and R1 (SEQ ID NO. 4) to perform PCR amplification, and recover the PCR amplification product.

[0021] 3. Use restriction endonucleases Spe I and Sal I to double-enzyme cut the PCR amplification product obtained in step 2, and recover the enzyme cutting product.

[0022] 4. Use restriction endonucleases Spe I and Sal I to double-enzyme cut the pCAMBIA1307 vector, and recover the vector skeleton.

[0023] 5. Connect the enzyme cutting product obtained in step 3 and the vector skeleton obtained in step 4 to obtain the recombinant plasmid pCAMBIA1307- OsJAB1 . The schematic diagram of elements of the recombinant plasmid pCAMBIA1307- OsJAB1 is shown in Figure 1 .

[0024] II. Obtaining of transgenic rice OsJAB1 1. Introduce the recombinant plasmid pCAMBIA1307- into Agrobacterium LBA4404 to obtain recombinant Agrobacterium. OsJAB1 2. Suspend the recombinant Agrobacterium obtained in step 1 in liquid ASAA medium to obtain a bacterial liquid with OD 600nm value = 0.3.

[0025] Liquid ASAA medium: liquid NB medium containing 2 mg / L 2,4-D and 100 μM / L AS.

[0026]

[0027] ​3. Take the seeds of rice Zhonghua 17, sterilize them with 75% ethanol, then place them on solid NB medium plates, and incubate them in the dark at 28°C for 2 weeks. Then transfer the callus to new solid NB medium plates, and incubate them in the dark at 28°C for 2 weeks. Finally, transfer the callus to new solid NB medium plates, and incubate them in the dark at 28°C for 2 weeks.

[0028] 4. After step 3 is completed, place the embryogenic callus particles that naturally disperse and have a light yellow color on subculture medium plates, and incubate them in the dark at 28°C for 3 days.

[0029] Subculture medium: solid NB medium containing 2 mg / L 2,4-D.

[0030] 5. After step 4 is completed, take the callus, soak it in the bacterial solution obtained in step 2 for 15 minutes, and gently shake it during the soaking.

[0031] 6. After step 5 is completed, take the callus, absorb the surface bacterial solution with filter paper, and then place it on co-culture medium plates, and incubate it in the dark at 22°C for 3 days.

[0032] Co-culture medium: solid NB medium containing 2 mg / L 2,4-D and 100 μM AS.

[0033] 7. After step 6 is completed, take the callus, place it on selection medium plates, and incubate it in the dark at 28°C for 2 weeks. Then transfer the callus to new selection medium plates, and incubate it in the dark at 28°C for 2 weeks. Finally, transfer the callus to new selection medium plates, and incubate it in the dark at 28°C for 2 weeks.

[0034] Selection medium: solid NB medium containing 2 mg / L 2,4-D and 50 mg / L hygromycin.

[0035] 8. After step 7 is completed, take the fresh callus that grows vigorously and has a milky white or light yellow color, place it on pre-differentiation medium plates, and incubate it in the dark at 28°C for 1 week. Then incubate it in the light at 28°C for 2 weeks. Then transfer it to differentiation medium plates, and incubate it in the light at 28°C to obtain differentiated seedlings.

[0036] Pre-differentiation medium: solid NB medium containing 5 mg / L ABA and 0.5 mg / L NAA.

[0037] Differentiation medium: solid NB medium containing 0.5 mg / L NAA and 3 mg / L 6-BA.

[0038] 9. After step 8 is completed, transfer the differentiated seedlings that grow well to a triangular flask containing solid MS medium, and incubate them in the light at 28°C for 1-2 weeks. Then transplant them to a greenhouse, and continue to cultivate them until the seeds are harvested, which are T1 generation seeds.

[0039] 10. The T1 generation seeds are cultivated into plants, i.e. T1 generation plants, and the T1 generation plants are selfed to obtain T2 generation seeds.

[0040] 12. The T2 generation seeds are cultivated into plants, i.e. T2 generation plants, and the T2 generation plants are selfed to obtain T3 generation seeds.

[0041] 13. The T3 generation seeds are cultivated into plants, i.e. T3 generation plants.

[0042] For a T1 generation plant, if the following two conditions are met, the T1 generation plant is a single copy inserted transgenic plant: ① the T1 generation plant has hygromycin resistance; ② the number ratio of hygromycin resistant plants to non-hygromycin resistant plants in the T2 generation plants obtained by selfing the T1 generation plant substantially accords with 3:1.

[0043] For a T2 generation plant, if the following three conditions are met, the T2 generation plant and its offspring are a homozygous transgenic line: ① the T2 generation plant has hygromycin resistance; ② the T1 generation plant thereof is a single copy inserted transgenic plant; ③ all the T3 generation plants sampled and detected have hygromycin resistance.

[0044] III. Detection of expression level of gene in transgenic line OsJAB1 Two lines, i.e. OE2 line and OE3 line, are obtained from the homozygous transgenic lines obtained in the above steps, and the T3 generation plants of the two lines are identified. Rice Zhonghua 17 is used as a wild type WT control of the transgenic lines.

[0045] Total RNA is extracted from 4-week-old rice plants of the two lines respectively, and is reversely transcribed into cDNA. The cDNA is used as a template to identify the expression level of the gene by quantitative PCR. OsJAB1

[0046] PCR identification OsJAB1 The primers of the gene are shown in Table 1.

[0047] Table 1 Primer name Primer sequence (5'-3') F2 GGTAACTCGGGATAGCTC (SEQ ID NO. 5) R2 TGCTTCAACCATAGGCTCAG (SEQ ID NO. 6) The expression level of the gene in the rice Zhonghua 17 plants is taken as 1, and the relative expression level of the gene in the plants of the transgenic lines is calculated. OsJAB1 OsJAB1 The relative expression level of the gene in the plants of the transgenic lines.

[0048] It can be known that, compared with the wild type plants, the expression amounts of the gene in the OE2 and OE3 lines are both significantly improved, and the expression amount of the gene in the OE3 line is the highest, which indicates that Figure 2 OsJAB1 OsJAB1 OsJAB1 ​​​​​​The gene has been successfully integrated into the genome of Zhonghua 17 rice and can be stably inherited.

[0049] 4. Determination of Vitamin C Content High-performance liquid chromatography (HPLC) was used to determine the AsA content in leaves. 0.5 g of fresh leaves were ground with liquid nitrogen, extracted with 5% metaphosphoric acid, and centrifuged at high speed. The supernatant was filtered through a 0.22 µm filter and injected. The HPLC column was a C18 column, the mobile phase was 0.1% phosphoric acid, and the detection wavelength was 254 nm.

[0050] Depend on Figure 3 Compared with wild-type plants, the overexpressed OsJAB1 The AsA content in OE2 and OE3 lines of the gene was significantly higher than that in wild-type plants, indicating that the overexpression of OsJAB1 The gene can significantly increase the content of AsA in rice leaves.

[0051] 5. ETR detection T3 rice plants of the OE2 and OE3 lines, as well as Zhonghua 17 (WT) rice, were grown in pots in a greenhouse. Zhonghua 17 (WT) and T3 rice plants of the OE2 and OE3 lines were grown in pots at the tillering stage (30 days after planting) under natural conditions in July in Beijing. The plants were kept in the dark for 12 hours and then exposed to varying light intensities.

[0052] The light treatments were: 36 (simulated low light intensity), 336 (simulated medium light intensity), and 611, 801, and 1251 µmol m -2 s -1 (simulating high light intensity), and using a chlorophyll fluorimeter to detect photosynthetic electron transport efficiency (ETR).

[0053] Depend on Figure 4 It can be seen that at low light intensity of 36µmol m -2 s -1 and medium light intensity 336µmol m -2 s -1 Under light treatment, overexpressed OsJAB1 There was no significant difference in ETR between the OE2 and OE3 lines with the gene and the wild-type line; however, at high light intensities of 611, 801, and 1251 µmol m -2 s -1 Compared with the wild-type strain, the overexpressed OsJAB1 The ETR of OE2 and OE3 strains with the gene was significantly increased, with the ETR at 801 μmol m -2 s -1 ETR was the largest under high light intensity treatment, indicating that overexpression in riceOsJAB1 The gene can significantly improve ETR, thereby promoting dry matter accumulation.

[0054] Seven, thousand-grain weight determination After the plants mature, 801 µmol m -2 s -1 The weight of 1000 grains of OE2, OE3 and WT rice under high light intensity treatment was randomly weighed (oven dried to constant weight).

[0055] From Figure 5 It can be seen that, compared with the wild type strain, the grain of the overexpressed OsJAB1 OE2 and OE3 strains of the gene is significantly larger. From Figure 6 It can be seen that, compared with the wild type strain, the thousand-grain weight of the overexpressed OsJAB1 OE2 and OE3 strains of the gene is significantly increased. This shows that the overexpressed OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJAB1 OsJ gene can make the grain of rice larger, thereby increasing the thousand-grain weight, and ultimately leading to yield increase.

[0056] In summary, by overexpressing the OsJAB1 gene in rice, the present application significantly enhances the antioxidant capacity of rice under high light intensity stress, maintains the efficient operation of photosynthetic electron transfer, improves the photosynthesis efficiency, thereby promoting the accumulation of dry matter, and ultimately significantly improves the grain yield of rice. The technical solution provided by the present application optimizes the physiological metabolism process of rice at the gene level through precise molecular biology means, solves the problem of yield reduction caused by photoinhibition, provides a solid theoretical basis and practical method for breeding new rice varieties with high yield, high quality and wide adaptability, and has immeasurable value for guaranteeing global food security and promoting sustainable agricultural development.

Claims

1. A method for increasing yield in rice, characterized by, The method comprises the following steps: Overexpression of OsJAB1 in rice OsJAB1 gene, making the OsJAB1 Increased expression increases rice grain size, thereby increasing rice yield; Among them, the OsJAB1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. OsJAB1 The amino acid sequence of the OsJAB1 protein encoded by the gene is shown in SEQ ID NO.

2.

2. The method of claim 1, wherein, The OsJAB1 The gene also exists in the following form: (2) a DNA molecule having more than 75% identity with the nucleotide sequence shown in SEQ ID NO. 1 and encoding a protein related to the increase of plant yield; (3) a DNA molecule derived from rice and having more than 90% identity with the nucleotide sequence shown in SEQ ID NO. 1 and encoding a protein related to the increase of crop yield; (4) a DNA molecule hybridizing with the nucleotide sequence shown in SEQ ID NO. 1 under stringent conditions and encoding a protein related to the increase of crop yield.

3. The method of claim 1, wherein, The OsJAB1 The OsJAB1 protein encoded by the gene also exists in the following forms: (1) a protein related to the increase of plant yield derived from substitution and / or deletion and / or addition of one or several amino acid residues of the amino acid sequence shown in SEQ ID NO. 2; (2) a protein derived from rice and having more than 95% identity with the amino acid sequence shown in SEQ ID NO. 2 and related to the increase of rice yield.

4. The method of claim 1, wherein, Overexpression in rice OsJAB1 Gene, including the following steps: (1) The nucleotide sequence as shown in SEQ ID NO. 1 is inserted into the cloning site of pCAMBIA1307 vector Spe I between Sal I , to obtain the recombinant plasmid pCAMBIA1307- OsJAB1 ; (2) introducing the recombinant plasmid pCAMBIA1307- OsJAB1 into Agrobacterium to obtain a recombinant Agrobacterium; (3) transforming the Agrobacterium of step (2) into rice plants to obtain stably heritable homozygous transgenic lines.

5. The method of claim 4, wherein, The recombinant plasmid pCAMBIA1307- OsJAB1 was constructed as follows: (1) Design specific primers F1 and R1, and amplify the target gene by PCR OsJAB1 gene; (2) Restriction enzyme digestion of the PCR product obtained in step (1) to obtain a digested product; and Spe I with Sal I double enzyme digestion of the PCR product obtained in step (1) to obtain a digested product; and (3) The pCAMBIA1307 vector was digested with restriction endonuclease Spe I and Sal I The pCAMBIA1307 vector was digested with restriction endonuclease (4) connecting the double enzyme digestion product obtained in step (2) and the vector skeleton obtained in step (3) to obtain the recombinant plasmid pCAMBIA1307- OsJAB1 ; wherein the nucleotide sequence of the specific primer F1 is shown in SEQ ID NO. 3 and the nucleotide sequence of the specific primer R1 is shown in SEQ ID NO. 4.

Images