Indel molecular marker related to delphinidin synthesis capability in broccoli and application of Indel molecular marker
By applying Indel molecular markers and their primer sets to broccoli, the ability to synthesize delphinidin was rapidly identified, solving the problem of screening high delphinidin varieties in existing technologies and improving the efficiency and quality of broccoli breeding.
Patent Information
- Application Number
- CN202511261546.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-05
- Publication Date
- 2025-10-24
AI Technical Summary
Existing technologies lack rapid and accurate molecular methods for screening high-alpinx varieties, making it difficult to effectively improve the anthocyanin synthesis capacity of broccoli and affecting its nutritional quality.
We will provide Indel molecular markers and their primer sets related to delphinidin synthesis in broccoli, identify whether broccoli has delphinidin synthesis ability by PCR amplification and electrophoresis analysis, and develop corresponding kits for assisted breeding.
This technology enables rapid screening of specific individual plants with delphinidin synthesis capabilities during the seedling stage, reducing field planting workload and improving the cultivation progress and accuracy of high-quality specialty broccoli.
Smart Images
Figure CN120829987A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biotechnology, and particularly relates to an Indel molecular marker related to the synthesis ability of delphinidin in Brassica oleracea and application thereof. BACKGROUND
[0002] Brassica oleracea L. var. italica Plenck belongs to the Brassica oleracea L. var. italica Plenck of the Brassicaceae family. Unlike most leafy cabbage-type vegetables, the edible part of Brassica oleracea is the flower ball formed by the swelling of many flower buds, which mainly includes short and thick flower stems and flower buds. Anthocyanin is a kind of flavonoid secondary metabolite unique to plants, and is also a water-soluble natural pigment widely existing in plants. At the same time, anthocyanin is rich in various antioxidants, can relieve eye fatigue, and prevent cardiovascular and cerebrovascular diseases, so food materials with high anthocyanin content are often widely loved by consumers. Therefore, breeding of high-anthocyanin Brassica oleracea is an important direction to improve the quality of Brassica oleracea.
[0003] Research has found that delphinidin (also known as delphinidin, delphinidin) is the main anthocyanin in high-anthocyanin Brassica oleracea materials, and increasing the content of delphinidin in Brassica oleracea can effectively improve the nutritional quality of Brassica oleracea.
[0004] Molecular marker-assisted selection breeding is an important means of current crop molecular breeding, but the current research on the synthesis mechanism of delphinidin in Brassica oleracea and the function of related genes is still relatively scarce, and there is still a lack of a molecular method for quickly and accurately screening high-delphinidin varieties, and it is urgent to carry out research on high-quality variety improvement and anthocyanin synthesis mechanism of Brassica oleracea. SUMMARY
[0005] In order to solve the above problems existing in the prior art, the present application provides an Indel molecular marker related to the synthesis ability of delphinidin in Brassica oleracea, a primer and application thereof.
[0006] The first aspect of the present application provides an Indel molecular marker related to the synthesis ability of delphinidin in Brassica oleracea, the size of the Indel molecular marker is 212 bp, the nucleotide sequence is as shown in SEQ ID NO: 1; and: the size of the Indel molecular marker is 169 bp, and the nucleotide sequence is as shown in SEQ ID NO: 2.
[0007] The second aspect of the present application provides a primer set for identifying / assisting in identifying an Indel molecular marker related to the synthesis ability of delphinidin in Brassica oleracea, the primer set comprising a forward primer as shown in SEQ ID NO: 3, and a reverse primer as shown in SEQ ID NO: 4:
[0008] Forward primer: 5'-TTACAAGGCGTCGCTGGTA -3';
[0009] Reverse primer: 5'-CGAACCAATAGCAAGGCT -3'.
[0010] The third aspect of the present application provides a kit for identifying / assisting in identifying the delphinidin synthesis ability of Brassica oleracea, which comprises the primer set provided in the second aspect of the present application.
[0011] The fourth aspect of the present application provides a method for identifying / assisting in identifying whether Brassica oleracea has the delphinidin synthesis ability, which comprises the operation of identifying the Indel molecular marker related to the delphinidin synthesis ability of Brassica oleracea provided in the first aspect of the present application.
[0012] The use of the Indel molecular marker related to the delphinidin synthesis ability of Brassica oleracea provided in the first aspect of the present application, and / or the primer set for identifying / assisting in identifying the Indel molecular marker related to the delphinidin synthesis ability of Brassica oleracea provided in the second aspect of the present application, and / or the kit for identifying / assisting in identifying the delphinidin synthesis ability of Brassica oleracea provided in the third aspect of the present application, and / or the method for identifying / assisting in identifying whether Brassica oleracea has the delphinidin synthesis ability provided in the fourth aspect of the present application in identifying / assisting in identifying whether Brassica oleracea has the delphinidin synthesis function, and the use in the breeding / assisting in breeding of Brassica oleracea also belong to the protection scope of the present application.
[0013] The use of the Indel molecular marker provided in the present application for detecting the germplasm material or field breeding material of Brassica oleracea can quickly screen specific single plants with the delphinidin synthesis ability at the seedling stage, thereby effectively reducing the workload of field planting, improving the cultivation progress and accuracy of high-quality characteristic Brassica oleracea, and having important theoretical and practical significance for cultivating new varieties of high-quality functional Brassica oleracea. The method for identifying / assisting in identifying whether Brassica oleracea has the delphinidin synthesis ability provided in the present application is simple in operation and saves resources. The various operation steps of the method synergize with each other and achieve excellent results. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 The BSA mapping results of the mapping population constructed by crossing the Brassica oleracea germplasm material with the delphinidin synthesis ability and the Brassica oleracea germplasm material without the delphinidin synthesis ability in Example 1, and the results of fine mapping of the candidate gene by using the segregating population are shown.
[0015] Figure 2The nucleotide composition difference of the delphinidin coding protein in the BoC1 gene located in Example 1 in the Brassica oleracea germplasm material with delphinidin synthesis ability and the Brassica oleracea germplasm material without delphinidin synthesis ability, and the protein sequence of the BoC1 gene in the Brassica oleracea germplasm material with delphinidin synthesis ability and the Brassica oleracea germplasm material without delphinidin synthesis ability are shown.
[0016] Figure 3 The column chart of the delphinidin content in the Brassica oleracea germplasm material with delphinidin synthesis ability and the Brassica oleracea germplasm material without delphinidin synthesis ability in Example 1, and the electrophoretogram of the identification results of the PCR amplification reaction product are shown.
[0017] Figure 4 The column chart of the delphinidin content in the Brassica oleracea germplasm material with delphinidin synthesis ability and the Brassica oleracea germplasm material without delphinidin synthesis ability in Example 2, and the electrophoretogram of the identification results of the PCR amplification reaction product are shown. DETAILED DESCRIPTION
[0018] In order to make the technical solutions, objectives and advantages of the present application clearer, the present application will be further described in detail below with specific examples. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present application, and are not used to limit the present application.
[0019] In the first aspect of the present application, the Indel molecular marker related to the delphinidin synthesis ability in Brassica oleracea is provided, the size of the Indel molecular marker is 212 bp, the nucleotide sequence composition is shown in sequence 1 (SEQ ID NO: 1) in the sequence listing; and: the size of the Indel molecular marker is 169 bp, the nucleotide sequence composition is shown in sequence 2 (SEQ ID NO: 2) in the sequence listing.
[0020] Sequence 1 (SEQ ID NO: 1):
[0021] TTACAAGGCGTCGCTGGTA AAATGAAACGTCTACACAAGAGGTTCGACGCTTTTCTATCGTCGATCTTGGAAGAGCACGAGACGATGAAGAACGGCCAGGATCAAAAGCACACGGACATGCTTAGCACTTTAATCTCGCTTAAGGGAACTGATTTTGACGGTGAGGGTGGAACTCTAACGGATACTGAGATCAA AGCCTTGCTATTGGTTCG.
[0022] Sequence 2 (SEQ ID NO: 2):
[0023] TTACAAGGCGTCGCTGGTA AAATGAAACGTCTACACAAGAGGTTCGACGCTTTTCTATCGTCGATCTTGGAAGAGCACGAGACGATGAAGAACGGCCAGGATCAAAAGCACACGGACATGCTTAGCACTTTAATCTCGCTACTGAGATCAA AGCCTTGCTATTGGTTCG .
[0024] The underlined part in sequence 1 and sequence 2 is the sequence of the forward primer and the reverse primer.
[0025] The Indel molecular marker is located in the range of 641318023-64131591 of chromosome 9 of Brassica oleracea. The reference genome used is JZS2.0, and the website is http: / / www.brassicadb.cn / # / Download / .
[0026] In the second aspect of the present application, a primer set for identifying / assisting in identifying the Indel molecular marker related to the delphinidin synthesis ability in Brassica oleracea provided in the first aspect of the present application is provided, which comprises a forward primer (C9-IF) shown in sequence 3 (SEQ ID NO: 3) in the sequence list and a reverse primer (C9-IR) shown in sequence 4 (SEQ ID NO: 4) in the sequence list.
[0027] Sequence 3 (SEQ ID NO: 3):
[0028] 5'-TTACAAGGCGTCGCTGGTA-3';
[0029] Sequence 4 (SEQ ID NO: 4):
[0030] 5'-CGAACCAATAGCAAGGCT-3'.
[0031] In the third aspect of the present application, a kit for identifying / assisting in identifying the delphinidin synthesis ability in Brassica oleracea is provided, and the kit comprises the primer set for identifying / assisting in identifying the Indel molecular marker related to the delphinidin synthesis ability in Brassica oleracea provided in the second aspect of the present application.
[0032] According to the third aspect of the present application, the kit can further comprise at least one of a PCR amplification buffer, dNTP, and Taq enzyme.
[0033] In a fourth aspect, the present application provides a method for identifying / assisting in identifying whether Brassica oleracea has the ability to synthesize delphinidin, the method comprising the operation of identifying an Indel molecular marker associated with the ability of Brassica oleracea to synthesize delphinidin.
[0034] According to the fourth aspect of the present application, the method comprises the operation of performing PCR amplification reaction using the primer set for identifying / assisting in identifying the Indel molecular marker associated with the ability of Brassica oleracea to synthesize delphinidin provided in the second aspect of the present application, and / or the kit for identifying / assisting in identifying the ability of Brassica oleracea to synthesize delphinidin provided in the third aspect of the present application, with the genomic DNA of Brassica oleracea as the template, and then detecting and analyzing the PCR amplification product.
[0035] As a preferred implementation, the operation of detecting and analyzing the PCR amplification product can comprise the operation of subjecting the PCR amplification product to electrophoresis (e.g., agarose gel electrophoresis, polyacrylamide gel electrophoresis) to obtain an electrophoresis band, and then detecting and analyzing the electrophoresis band; the detection and analysis can be comparison with a DNA marker to determine the size of the electrophoresis band, or sequencing the PCR amplification product.
[0036] As a preferred implementation, the reaction system (20 μL) of the PCR amplification reaction comprises: Brassica oleracea genomic DNA (100 ng / µL) 1 µL, 2×M5 HiPer Taq HiFi PCR mix (containing Mg 2+ , enzyme, dNTP) 10 μL, forward primer and reverse primer (10 µM) 2 µL each, and ddH2O 5µL.
[0037] As a preferred implementation, the PCR amplification program is: 95℃ pre-denaturation for 3 minutes; 94℃ denaturation for 25 seconds, 58℃ annealing for 25 seconds, 72℃ extension for 25 seconds, for a total of 35 cycles; 72℃ extension for 10 minutes; and 4℃ preservation.
[0038] As a preferred implementation, the operation of detecting and analyzing the PCR amplification product comprises:
[0039] If the PCR amplification product only has a fragment of 212 bp as shown in sequence 1 (SEQ ID NO: 1), then the Brassica oleracea is Brassica oleracea having the ability to synthesize delphinidin;
[0040] If the PCR amplification product only has a fragment of 169 bp as shown in sequence 2 (SEQ ID NO: 2), then the Brassica oleracea is Brassica oleracea not having the ability to synthesize delphinidin;
[0041] If the PCR amplification product has both the 212 bp fragment shown in Sequence 1 (SEQ ID NO: 1) and the 169 bp fragment shown in Sequence 2 (SEQ ID NO: 2), the broccoli is the one having the delphinidin synthesis ability.
[0042] In a fifth aspect, the present application provides the use of the Indel molecular marker related to the delphinidin synthesis ability in broccoli provided in the first aspect, and / or the primer set for identifying / assisting in identifying the Indel molecular marker related to the delphinidin synthesis ability in broccoli provided in the second aspect, and / or the kit for identifying / assisting in identifying the delphinidin synthesis ability in broccoli provided in the third aspect, and / or the method for identifying / assisting in identifying whether the broccoli has the delphinidin synthesis ability provided in the fourth aspect, in identifying / assisting in identifying whether the broccoli has the delphinidin synthesis ability.
[0043] In a sixth aspect, the present application provides the use of the Indel molecular marker related to the delphinidin synthesis ability in broccoli provided in the first aspect, and / or the primer set for identifying / assisting in identifying the Indel molecular marker related to the delphinidin synthesis ability in broccoli provided in the second aspect, and / or the kit for identifying / assisting in identifying the delphinidin synthesis ability in broccoli provided in the third aspect, and / or the method for identifying / assisting in identifying whether the broccoli has the delphinidin synthesis ability provided in the fourth aspect, in broccoli breeding / assisting in broccoli breeding.
[0044] In the following examples, various reagents, materials, etc. used are, unless otherwise specified, products available from commercial channels; and various tests, detection methods used in the following examples are, unless otherwise specified, conventional tests, detection methods in the art, which can be obtained from textbooks, reference books or academic journals.
[0045] The broccoli materials G767, B767, B83, B101, B112, B419, B429, B973, B1060, B1066, B1034, B1037 used in the following examples are stored in Beijing Crop Germplasm Repository (Vegetables), and anyone can freely obtain the relevant materials from the place for the purpose of realizing the purpose of the present application within the effective period of the patent right from the filing date of the present application. The contact address is: Vegetable Institute of Beijing Academy of Agriculture and Forestry Sciences, West Suburb Banjing, Haidian District, Beijing, P. R. China, Post Code: 100097, Contact: Zhang Quan, Contact Number: 010-81127222. Example 1
[0046] This example is used to illustrate the development and acquisition of the Indel molecular marker related to the delphinidin synthesis ability in broccoli.
[0047] 1、The green flower ball broccoli material G767 without delphinidin accumulation and the purple flower ball broccoli material B767 with high delphinidin accumulation used in the embodiment are high-generation sister lines with similar genetic backgrounds.
[0048] 2、The F2 segregation population is constructed by crossing the G767 and B767 materials, and through investigation of flower ball color and determination of delphinidin content in flower ball, it is found that the purple flower ball and the green flower ball show a segregation ratio of 3:1.
[0049] 3、The candidate interval is narrowed down to a 57 kb interval by BSA sequencing and KASP genotype detection. Figure 1 ).
[0050] Figure 1 A shows the BSA (Bulk Segregant Analysis) positioning result of the positioning population constructed by crossing the material with delphinidin synthesis ability and the material without delphinidin synthesis ability, and it can be seen that there is a major QTL on chromosome 9, indicating that the gene controlling delphinidin synthesis is located in the segment.
[0051] Figure 1 B shows an enlarged view of the BSA positioning result of the position of chromosome 9 in A. Figure 1
[0052] Figure 1 C shows the result of fine positioning of the candidate gene using the segregation population, and the positioning result shows that the target gene is located between the C6 marker and the C11 marker; wherein P represents the material with delphinidin synthesis ability (the material with a "high" delphinidin performance is determined), and G represents the material without delphinidin synthesis ability (the material with a "zero" delphinidin phenotype is determined).
[0053] Further, by using the parental resequencing data, the parent differences in the interval are screened, and it is found that there is a 43 bp sequence difference, which causes the premature termination of the encoded protein. Figure 2 C9-IF (SEQ ID NO: 3) and C9-IR (SEQ ID NO: 4) are used as specific primers to amplify the F2 generation population of the cross of G767 and B767.
[0054] Figure 2 A shows the difference in nucleotide composition of the delphinidin encoding protein in the material with delphinidin synthesis ability and the material without delphinidin synthesis ability of the BoC1 gene positioned; wherein BoC1 G represents the material without delphinidin synthesis ability, and BoC1 B The BoC1 gene in the material with delphinidin synthesis ability and the material without delphinidin synthesis ability is shown in B. It is found that the difference between the two is that the protein coding sequence of the BoC1 gene in the material with delphinidin synthesis ability is 43 bp longer than that of the material without delphinidin synthesis ability.
[0055] Figure 2 B shows the protein sequence of the BoC1 gene in the material with delphinidin synthesis ability and the material without delphinidin synthesis ability. The BoC1 protein in the material with delphinidin synthesis ability can translate 511 amino acids, but in the material without delphinidin synthesis ability, due to the lack of 43 bp protein coding sequence, the protein terminates prematurely and can only translate 280 amino acids.
[0056] 4, the obtained amplified fragments are separated by electrophoresis on a 4% agarose gel at 200V, and the band type of each sample is observed and analyzed, and the results are shown in Figure 3
[0057] Figure 3 In the table, P represents the material with delphinidin synthesis ability (the material with high delphinidin content), G represents the material without delphinidin synthesis ability (the material with zero delphinidin phenotype), and H represents the hybrid material with delphinidin synthesis ability (the material with higher delphinidin content than G and lower delphinidin content than P).
[0058] As shown in Figure 3 A and Figure 3 The delphinidin content of the sample with band type P in B reaches an average of 122.45 μg / g, the delphinidin content of the sample with band type G is an average of 0 μg / g, and the delphinidin content of the sample with band type H reaches an average of 42.95 μg / g. The determination method of the above-mentioned delphinidin content refers to the article Integrated metabolomic and transcriptomic analysis of the anthocyanin regulatory networks in Salvia miltiorrhiza Bge. Flowers, BMC Plant Biology, 2020, 20: 349.
[0059] As shown in Figure 3 The identification results of the PCR amplification reaction product are as follows: the material with which the primer C9-IF and C9-IR amplifies a 212 bp homozygous fragment has the ability to synthesize delphinidin (type P), the material with which the primer C9-IF and C9-IR amplifies a 169 bp homozygous fragment does not have the ability to synthesize delphinidin (type G), and the material with which the primer C9-IF and C9-IR amplifies a 212 bp and 169 bp heterozygous fragment also has the ability to synthesize delphinidin (type H).
[0060] Figure 3 The PCR amplification results of the different materials are consistent with and correspond to the measurement results of the delphinidin content, that is, only the 212 bp fragment can be amplified to synthesize delphinidin, only the 169 bp fragment can be amplified to synthesize delphinidin, and the material with which the primer C9-IF and C9-IR amplifies a 212 bp and 169 bp heterozygous fragment also has the ability to synthesize delphinidin but less than the material with which the primer C9-IF and C9-IR amplifies a 212 bp fragment.
[0061] 5. In the F2 population material, the measurement results (phenotype determination) of the delphinidin content are completely consistent with the PCR amplification molecular identification results. It is proved that the specific primer can accurately identify the delphinidin synthesis ability of broccoli and the identification results are completely consistent with the phenotype. The identification method is simple in procedure and wide in application range. Example 2
[0062] This example is used to illustrate the application of the Indel molecular marker related to the delphinidin synthesis ability of broccoli in identifying whether broccoli has the function of synthesizing delphinidin.
[0063] S1, extracting genomic DNA: Selecting broccoli germplasm materials B83, B101, B112, B419, B429, B973, B1060, B1066, B1034, and B1037 with different flower ball colors. Selecting broccoli seedling leaves, and using a DNA kit (TIANGEN Company) to extract the genomic DNA of each.
[0064] S2, PCR amplification reaction: Taking the genomic DNA extracted in S1 above as a template, using the forward primer (SEQ ID NO: 3) and the reverse primer (SEQ ID NO: 4) as specific primers, respectively, to perform PCR amplification reaction, and obtaining the respective PCR amplification product.
[0065] The reaction system (20 μL) of the PCR amplification reaction includes: broccoli genomic DNA (100 ng / µL) 1 µL, 2×M5 HiPer Taq HiFi PCR mix (containing Mg 2+ , enzyme, dNTP) 10 μL, forward primer and reverse primer (10 µM) 2 µL each, and ddH2O 5 µL.
[0066] The PCR amplification procedure is as follows: pre-denaturation at 95℃ for 3 minutes; denaturation at 94℃ for 25 seconds, annealing at 58℃ for 25 seconds, elongation at 72℃ for 25 seconds, for a total of 35 cycles; elongation at 72℃ for 10 minutes; and preservation at 4℃.
[0067] S3, PCR amplification product detection: each of the above PCR amplification products is subjected to electrophoretic separation by 4% agarose gel at a voltage of 200 V, and the band type of each sample is observed and recorded Figure 4 B).
[0068] From Figure 4 B, it can be seen that germplasm materials B973, B1060, B1066, B1034 and B1037 can all amplify a 212 bp fragment, and germplasm materials B83, B101, B112, B419 and B429 can only amplify a 169 bp fragment and cannot amplify a 212 bp fragment. From Figure 4 B, it can be seen that the length of the fragments after electrophoresis of the blue flower cabbage materials with delphinidin synthesis ability and the blue flower cabbage materials without delphinidin synthesis ability is obviously different, and the naked eye can directly and accurately judge.
[0069] The content of delphinidin in each germplasm material is detected by the method in Example 1, and the results are shown in Figure 4 A, wherein the germplasm materials B83, B101, B112, B419 and B429 cannot detect the content of delphinidin, that is, these germplasm materials do not have the ability to synthesize delphinidin; the content of delphinidin in the germplasm materials B973, B1060, B1066, B1034 and B1037 all reaches 100 μg / g or more, and all have the ability to synthesize delphinidin.
[0070] From Figure 4 It can be seen that the detection results of the content of delphinidin in the above blue flower cabbage germplasm materials are completely consistent with the PCR amplification molecular identification results, which indicates that the identification results of the Indel molecular marker provided by the present application are completely consistent with the actual phenotype, and the accuracy of identifying the presence or absence of delphinidin synthesis function in the blue flower cabbage by the Indel molecular marker provided by the present application is high.
[0071] As can be seen from the above, by using the Indel molecular marker provided by the present application to detect the blue flower cabbage germplasm material or field breeding material, specific single plants with the ability to synthesize delphinidin can be quickly screened at the seedling stage, thereby reducing the workload of field planting and breeding, and improving the breeding progress and accuracy of high-quality characteristic blue flower cabbage.
[0072] The above merely provides the preferred embodiments of the present application, and is not used to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the principles and technical scope of the present application should be included in the protection scope of the present application.
Claims
1. An Indel molecular marker related to the ability of synthesizing delphinidin in Brassica oleracea, wherein the Indel molecular marker has a size of 212 bp and a nucleotide sequence as shown in SEQ ID NO: 1, and wherein the Indel molecular marker has a size of 169 bp and a nucleotide sequence as shown in SEQ ID NO:
2.
2. A primer set for identifying / assisting in identifying the Indel molecular marker related to the ability of synthesizing delphinidin in Brassica oleracea, wherein the primer set comprises a forward primer as shown in SEQ ID NO: 3 and a reverse primer as shown in SEQ ID NO: 4: forward primer: 5'-TTACAAGGCGTCGCTGGTA-3'; reverse primer: 5'-CGAACCAATAGCAAGGCT-3'.
3. A kit for identifying / assisting in identifying the ability of synthesizing delphinidin in Brassica oleracea, wherein the kit comprises the primer set according to claim 3.
4. The kit for identifying / assisting in identifying the ability of synthesizing delphinidin in Brassica oleracea according to claim 3, wherein the kit further comprises at least one of a PCR amplification buffer, dNTPs, and Taq enzyme.
5. A method for identifying / assisting in identifying whether Brassica oleracea has the ability of synthesizing delphinidin, wherein the method comprises the operation of identifying the Indel molecular marker related to the ability of synthesizing delphinidin in Brassica oleracea according to claim 1.
6. The method for identifying / assisting in identifying whether Brassica oleracea has the ability of synthesizing delphinidin according to claim 5, wherein the method comprises the operation of performing a PCR amplification reaction using the primer set for identifying / assisting in identifying the Indel molecular marker related to the ability of synthesizing delphinidin in Brassica oleracea according to claim 2 and / or the kit for identifying / assisting in identifying the ability of synthesizing delphinidin in Brassica oleracea according to claim 3, with genomic DNA of Brassica oleracea as a template, and then detecting and analyzing a PCR amplification product.
7. The method for identifying / assisting in identifying whether Brassica oleracea has the ability of synthesizing delphinidin according to claim 6, wherein the operation of detecting and analyzing the PCR amplification product comprises: if the PCR amplification product only has a 212 bp fragment as shown in SEQ ID NO: 1, then the Brassica oleracea is Brassica oleracea having the ability of synthesizing delphinidin; if the PCR amplification product only has a 169 bp fragment as shown in SEQ ID NO: 2, then the Brassica oleracea is Brassica oleracea not having the ability of synthesizing delphinidin; and if the PCR amplification product has both a 212 bp fragment as shown in SEQ ID NO: 1 and a 169 bp fragment as shown in SEQ ID NO: 2, then the Brassica oleracea is Brassica oleracea having the ability of synthesizing delphinidin.
8. The method for identifying / assisting in identifying whether Brassica oleracea has the ability of synthesizing delphinidin according to claim 6 or 7, wherein the method further comprises the operation of: The reaction system of the PCR amplification reaction is: 1 μL of broccoli genomic DNA with a concentration of 100 ng / μL, 10 μL of 2×M5HiPer Taq HiFi PCR mix, 2 μL of 10 μM forward primer and reverse primer, and 5 μL of ddH2O; The PCR amplification program is: 95°C pre-denaturation for 3 minutes; 94°C denaturation for 25 seconds, 58°C annealing for 25 seconds, 72°C extension for 25 seconds, a total of 35 cycles; 72°C extension for 10 minutes; 4°C storage.
9. The Indel molecular marker related to the ability of synthesizing delphinidin in the broccoli of claim 1, and / or the primer set for identifying / assisting in identifying the Indel molecular marker related to the ability of synthesizing delphinidin in the broccoli of claim 2, and / or the kit for identifying / assisting in identifying the ability of synthesizing delphinidin in the broccoli of claim 3 or 4, and / or the method for identifying / assisting in identifying whether the broccoli has the ability of synthesizing delphinidin according to any one of claims 5-8, in the application of identifying / assisting in identifying whether the broccoli has the ability of synthesizing delphinidin.
10. The Indel molecular marker related to the ability of synthesizing delphinidin in the broccoli of claim 1, and / or the primer set for identifying / assisting in identifying the Indel molecular marker related to the ability of synthesizing delphinidin in the broccoli of claim 2, and / or the kit for identifying / assisting in identifying the ability of synthesizing delphinidin in the broccoli of claim 3 or 4, and / or the method for identifying / assisting in identifying whether the broccoli has the ability of synthesizing delphinidin according to any one of claims 5-8, in the application of the broccoli breeding / assisting in breeding.