Molecular markers for identification of camellia sect. retuse species and application thereof

By using next-generation sequencing technology to screen out DNA fragments unique to Camellia multipetalata and designing molecular markers, the problem of identifying Camellia multipetalata in the seedling and non-flowering stages has been solved, realizing an efficient and accurate identification method suitable for high-throughput detection of Camellia multipetalata.

CN120989285BActive Publication Date: 2026-05-01FOSHAN INST OF FORESTRY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511238639.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-01
Publication Date
2026-05-01
Estimated Expiration
2045-09-01

AI Technical Summary

Technical Problem

Existing technologies make it difficult to accurately identify Camellia multipetala (Camellia acetabula) during the seedling and non-flowering stages, especially when distinguishing it from the closely related Camellia nitidissima. Conventional molecular markers and sequencing technologies suffer from problems such as low throughput, high cost, and susceptibility to false positives or false negatives.

Method used

Three DNA fragments unique to Camellia multipetala were screened using next-generation sequencing technology, and corresponding molecular markers were designed. High-throughput sequencing and alignment technologies were used to identify Camellia multipetala, and software such as Geneious was used for sample comparison to ensure the accuracy of identification.

Benefits of technology

It achieves high-throughput, low-cost, and accurate identification of multi-petaled camellias, can detect mixed samples, avoids primer design errors, and improves identification efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989285B_ABST
    Figure CN120989285B_ABST
Patent Text Reader

Abstract

The application discloses a kind of molecular markers for Camellia genus Camellia reticulata group plant identification, which is composed of 3 Camellia reticulata specific DNA sequences.The application also provides a Camellia reticulata identification method based on the molecular markers, and the operation process is as follows: total DNA extraction is carried out on the sample to be tested, then high-throughput sequencing is carried out, the sequencing reads obtained are compared with the molecular markers, and if the sequencing reads can completely cover the molecular markers, it can be determined that the sample to be tested belongs to Camellia reticulata.
Need to check novelty before this filing date? Find Prior Art

Description

Molecular markers for species identification in the Camellia section of the genus Camellia and their applications Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the screening and application of molecular markers in Camellia chrysantha. Background Technology

[0002] Camellia multipetalata (Camellia apetelotii) is a rare species in the Camellia genus, possessing ornamental, medicinal, and scientific research value. However, its identification faces multiple challenges—not only is it difficult to distinguish from the closely related Camellia nitidissima, but it also presents significant difficulties in identifying other common plants in the Camellia genus, especially in the Camellia section, particularly during the seedling and pre-flowering stages.

[0003] From the perspective of close species differentiation, the Flora of China once considered *C. petelotii* and *C. nitidissima* as the same species. Although new evidence now supports that they are different species, they are closely related in evolution, with highly similar nuclear and chloroplast genes. Conventional molecular markers (such as ITS2, matK, and rbcL) show very little or no difference between the two, resulting in low identification accuracy. Morphologically, both are evergreen shrubs with elliptical, serrated leaves and yellow flowers. Key traits (leaf length and width, flower diameter) overlap, and environmental factors can cause variations in leaf color and flower size, further blurring the boundary.

[0004] Compared to other plants in the Camellia genus, the identification difficulties of C. petelotii are concentrated in the seedling and pre-flowering stages. Most Camellia seedlings are highly similar in morphology, differing only in the density of fine leaf veins, making them difficult to distinguish for non-experts; moreover, C. petelotii takes 5-8 years to enter the flowering stage, and lacks specific floral characteristics in the pre-flowering stage, making it impossible to distinguish them by morphology.

[0005] Traditional molecular identification methods have shortcomings. PCR electrophoresis amplifies specific DNA fragments and uses electrophoresis to separate them, detecting the presence or absence of the target fragment to identify species. However, this technique has many limitations. For example, it requires extremely precise primer design; improper primer design can easily lead to false positives or false negatives. Furthermore, its throughput is low, allowing only a limited number of samples to be tested per experiment, making it unsuitable for large-scale sample testing. First-generation sequencing primarily targets specific gene regions for sequencing analysis. While it can provide more accurate identification information to some extent, it also faces problems of low throughput and high cost. The sequencing process is cumbersome, requiring significant manpower, resources, and time, and its detection efficiency is poor for mixed or low-content samples, easily leading to missed detections.

[0006] Therefore, developing molecular markers specific to Camellia multipetala, especially developing unique sequences of C. petelotii that do not exist in other closely related species, and constructing a molecular identification system that can identify Camellia multipetala, is the key to solving the identification problem in the seedling and pre-flowering stages, ensuring the conservation of C. petelotii resources and industrial application, and is also the core research and development goal of this patent. Summary of the Invention

[0007] To address the challenges in identifying multi-petaled camellias, this invention employs next-generation sequencing technology to successfully obtain three DNA fragments unique to multi-petaled camellias. Analysis and verification revealed that these three DNA fragments do not exhibit high homology with any currently published genomic sequences, making them highly suitable as reference sequences for multi-petaled camellia identification. Based on this, this invention further utilizes sequencing data to design a reliable method for identifying multi-petaled camellias. The specific technical solution employed in this invention is as follows:

[0008] In one aspect, the present invention provides a molecular marker for identifying or assisting in the identification of Camellia multipetala, the nucleic acid sequence of which is shown in SEQ ID NO.1 and / or SEQ ID NO.2 and / or SEQ ID NO.3.

[0009] In another aspect, another object of the present invention is to provide the application of the above-mentioned molecular markers in the identification or auxiliary identification of Camellia multipetala.

[0010] In another aspect, the present invention provides a method for identifying or assisting in the identification of multi-petaled camellias, characterized by comprising the following steps:

[0011] 1) Collect the tissue to be tested and use it as the test sample;

[0012] 2) Extract total DNA from the sample to be tested;

[0013] 3) Perform next-generation high-throughput sequencing on the total DNA of each sample to be tested to obtain sequencing reads;

[0014] 4) Assemble the sequencing data and align the assembled contigs with the aforementioned molecular markers;

[0015] 5) Determine whether the sample to be tested is Camellia multipetala based on the comparison results; if the assembled contigs contain a contig that is completely consistent with the molecular marker sequence, then the species of the sample to be tested is determined to be Camellia multipetala.

[0016] In another aspect, the present invention also provides another method for identifying or assisting in the identification of multi-petaled camellia, characterized by comprising the following steps:

[0017] 1) Collect the tissue to be tested as the sample;

[0018] 2) Extract total DNA from the sample to be tested;

[0019] 3) Perform next-generation high-throughput sequencing on the total DNA of each sample to be tested to obtain sequencing reads;

[0020] 4) Using Geneious software with default parameters, align the above sequencing reads to the DNA molecular markers described in this application;

[0021] 5) Based on the coverage of sequencing reads on the DNA molecular marker, determine whether the sample to be tested contains Camellia multipetalum; if the sequencing reads can completely cover the molecular marker and can generate a consistent sequence that is completely consistent with the DNA molecular marker, then it is determined that the species of the sample to be tested contains Camellia multipetalum.

[0022] In one embodiment, in step 4), sequencing reads from multiple samples can be mixed and grouped.

[0023] In one embodiment, if the sequencing reads of multiple samples were mixed and grouped in step 4), the method further includes step 6): re-dividing the samples identified as containing Camellia multipetalus into two groups, mixing the sequencing reads of each group, and repeating the operation of step 5) above until a single sample containing Camellia multipetalus is accurately identified.

[0024] In one embodiment, the high-throughput sequencing mentioned in step 2) can be either second-generation sequencing technology or third-generation sequencing technology.

[0025] In one embodiment, when performing reads comparison in step 3), any version of the software Geneious, Bowtie, Tophat, Minimap, or HISAT can be used.

[0026] In one embodiment, SEQ ID NO.1, SEQ ID NO.2, or SEQ ID NO.3 can be used alone for the identification of multi-petaled camellia.

[0027] In one embodiment, two or three of SEQ ID NO.1, SEQ ID NO.2, or SEQ ID NO.3 may be used in combination to improve the accuracy of identification of Camellia multipetal.

[0028] The present invention has the following beneficial effects:

[0029] First, this invention has for the first time screened and obtained three DNA fragments unique to the Camellia multipetala genome. Professional analysis showed that these three DNA fragments do not exhibit high homology with any other publicly available genome sequences, thus possessing excellent conditions for serving as reference sequences for the identification of Camellia multipetala.

[0030] Secondly, the identification method provided by this invention can detect mixed samples. For example, total DNA can be extracted directly from samples containing multiple plant tissues, and the DNA information of the samples can be obtained through high-throughput sequencing. The sequencing results can then be compared with the reference sequence provided by this invention to accurately identify whether the sample contains Camellia multipetala.

[0031] Third, this identification method directly utilizes high-throughput sequencing technology, enabling high-throughput detection. The entire detection process requires no primer design, effectively avoiding various problems that may arise during primer design. It is simple, fast, and has high detection sensitivity.

[0032] Fourth, this invention also provides three species-specific molecular markers. In actual identification, one molecular marker can be used alone or multiple molecular markers can be used in combination. When used in combination, the accuracy of identification of Camellia multipetala can be further improved. Attached Figure Description

[0033] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0034] Figure 1 shows the alignment results of the molecular marker SEQ ID NO.1 of Camellia multipetalus in the NCBI nr / nt database.

[0035] Figure 2 shows the alignment results of the molecular marker SEQ ID NO.2 of Camellia multipetalus in the NCBI nr / nt database.

[0036] Figure 3 shows the alignment results of the molecular marker SEQ ID NO.3 of Camellia multipetalus in the NCBI nr / nt database.

[0037] Figure 4 shows the alignment results of sequencing reads containing sample 1 in Table 1 with the molecular marker SEQ ID NO.1 of Camellia multiflora.

[0038] Figure 5 shows the alignment results of sequencing reads containing sample 2 in Table 1 with the molecular marker SEQ ID NO.1 of Camellia multiflora.

[0039] Figure 6 shows the alignment results of sequencing reads containing sample No. 3 in Table 1 with the molecular marker SEQ ID NO. 1 of Camellia multiflora.

[0040] Figure 7 shows the alignment results of sequencing reads containing sample 1 in Table 1 with the molecular marker SEQ ID NO.2 of Camellia multiflora.

[0041] Figure 8 shows the alignment results of sequencing reads containing sample 2 in Table 1 with the molecular marker SEQ ID NO.2 of Camellia multiflora.

[0042] Figure 9 shows the alignment results of sequencing reads containing sample No. 3 in Table 1 with the molecular marker SEQ ID NO. 2 of Camellia multiflora.

[0043] Figure 10 shows the alignment results of sequencing reads containing sample 1 in Table 1 with the molecular marker SEQ ID NO.3 of Camellia multiflora.

[0044] Figure 11 shows the alignment results of sequencing reads containing sample No. 2 in Table 1 with the molecular marker SEQ ID NO. 3 of Camellia multiflora.

[0045] Figure 12 shows the alignment results of sequencing reads containing sample No. 3 in Table 1 with the molecular marker SEQ ID NO. 3 of Camellia multiflora. Detailed Implementation

[0046] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the embodiments described in this specification are only for explaining the invention and are not intended to limit the invention. Parameters, proportions, etc., in the embodiments can be adjusted according to actual circumstances without substantially affecting the final result.

[0047] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0048] Example 1: Molecular markers for multi-petaled camellia

[0049] This invention successfully identified a molecular marker standard sequence for the detection of multi-petaled camellia using a series of techniques, including high-throughput sequencing, sequence assembly, and multi-species sequence comparison analysis. The specific sequence is as follows:

[0050] SEQ ID NO.1:

[0051] 5'- AATTATTTAATTGTCTCTGAGTATTTTAGGACTTTGCCTACGCCAAGAAAATTTTACGGGTAGAATAGTTATGTTGCGATTTCTTTTTAATCAGGAGTGCTACATAAACAATTAATTTCTACTAATATTTTATCACTTAATTTAATCGATGAAATTGACAGATCCATATCATTTACGAAACGAAACAAATTTATCTTCTCGTTATCTCATTTAATTAAGGGTAAATGTTACTTGACTCCCTTATGATTTGATTCATATATAAATCAACTCACTGTCATTTTAAAATAACCATATAACTCCATGTAATTTATAAACTAAAA TGCACAACTAATTTTTTCCTCTAACATAACATAATGTGAGAGCCATTTACCAATGCAGAAAGTAAATTTTGCTTTAAGATAAAAATGATGCTGGCACAACTTTAAATTTATATAGAATGCAATTCTTTTTTTCTTTTTCTTTTTGCCTTCTCACTAGTTTCTCTGCCCCTTTCCTCCCTAGCTAGCCATCAACATCTGCTATACTTAACATAAAAACATCACAATAATGACCATATGAATAAATAGTCTTGCTTTTGCTTTGTTGCTCATATCATTCAGCATGTATTAAATGAACTTGTGGGGACATATTTCGTAATGAC -3'(SEQ ID NO:1);

[0052] SEQ ID NO.2:

[0053] 5'- TAGTGTTTAATAACATCTTAAATGTATCTAAAAAGTAAAATATTTTTAGAAATATTCAAGATGATATTAATAAATACCATATTCCATAAGATCATGGATATTCCATAATAACTATTTAATATCATGAATATCCATAAGATTAATAAATACCATATTAAACCATAAGATCATGGATAAATTTCATCTTAAAAATACCATATTTTACTTTTTCATATTTTTATGGTATAATAAATATCCATGGTATTTATTTTTATGGTATAATAAATGTATCTTAACTATAATATGGTATAATAAATA CCATATTATACCATATTAAACCATATTAATCTTATTGAATATCCATGAATATCCATGATCTTAAAAATATTATCACTTAAAATTAATTATATTATGGTATTAAAATTTCATCTTAAAAATTTAATATCATGAATTGTCAACCATAGTGTTTAATAACTATTTTTTAGATACATTATCACTCCATTAATAAATTTAATTGAAACCATATTCCATAAGATTAATAAATACCATACATTTAAATACTATAAAAAATACTATAACTTTTTTTAAATATTAATTATAATTATATCATGGATAA -3'(SEQ ID NO:2);

[0054] SEQ ID NO.3:

[0055] CAGTAGTCATTTAATTGTATTTATGAATCTTCTCAATTTTTAATTGTATTAATATGATGGCTCATTCTTTTTCCCTCTTACCTTCATATGGACCTTTAGTTCAATTGTAATTTTGTTGTGTGCATTGAATTGCTTTAGATGATTTTGAACTATTTATTGAATAATGTCGAGCATTCTTTACAATTTAGATCTTACTATATTATTGGTTTAAGT TTTAGATGCCACTCGACAAAGGTATATAGATAGAAATGGGAGTCACAAAATGTTCAAGAGAAAGATACAAACTCATGGATTTAACTTGCTTTAGGATTGTAATTTGCTAACTGAAATTTCGAAGGCAATTAATTCTCTATTCATTTAATTTTCTTTCATTGGCAAGATGTACTAATACCAAGAATGTATAACTCATAATGTACAATAATT(SEQ ID NO:3).

[0056] The molecular markers identified in this invention were submitted to the NCBI database for online BLAST alignment analysis. During the alignment process, the nr / nt database was selected, without limiting the species range, and the "Highly similar sequences (megablast)" parameter was chosen. As shown in Figures 1 to 3, the alignment results indicate that no homologous sequences of the molecular markers described in this invention have been found in the NCBI nr / nt database.

[0057] To further verify the species specificity of the above molecular markers, this invention also directly compared the genome sequencing reads of different Camellia species with the above molecular marker sequences (using minimap2 software with default parameters), and counted the number of reads that could be aligned to the molecular markers. The statistical results are shown in Table 1 below:

[0058] Table 1. Statistical analysis of the alignment results of sequencing reads and molecular markers for different camellia species.

[0059]

[0060] Example 2: Identification Method of Multi-Petaled Camellia

[0061] 1) Collect the tissue to be tested as the test sample;

[0062] 2) Extract total DNA from the sample to be tested;

[0063] 3) Perform next-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads;

[0064] 4) Assemble the sequencing data and align the assembled contigs with the aforementioned molecular markers;

[0065] 5) Determine whether the sample is Camellia multipetala based on the comparison results; if the assembled contigs contain a contig consistent with the molecular marker sequence, the species of the sample to be tested is determined to be Camellia multipetala, otherwise the opposite result is obtained.

[0066] The test results showed that samples 1-3 contained the molecular marker sequence of this application, while other camellia samples did not contain the molecular marker sequence of this application, indicating that the method of this invention can accurately identify multi-petaled camellia.

[0067] Example 3: Method 2 for the identification of multi-petaled camellia

[0068] 1) Collect the tissue to be tested as the sample;

[0069] 2) Extract total DNA from the sample to be tested;

[0070] 3) Perform next-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads (>30× depth);

[0071] 4) Using the default parameters of Geneious software, align the above sequencing reads to the DNA molecular markers described in this application;

[0072] 5) Determine whether the sample contains Camellia multipetalum based on the coverage of sequencing reads on the DNA molecular marker; if the molecular marker is completely covered and a sequence completely consistent with the DNA molecular marker is generated, it is determined that the species of the sample to be tested contains Camellia multipetalum.

[0073] 6) If multiple sample sequencing reads are mixed and grouped in step 4), then step 6) further includes dividing the samples containing Camellia multipetalus into two groups, mixing the sequencing reads separately, and repeating step 5) until Camellia multipetalus of individual samples is identified.

[0074] The detection results are shown in Figures 4-12, where Figures 4-12 show samples containing Camellia multipetalata. The figures show that the sequencing reads completely cover the reference sequences (i.e., the molecular markers SEQ ID NO.1 and SEQ ID NO.2 described in this application), and generate identical sequences (colors represent different bases: A for red, C for blue, G for yellow, and T for green). Sequencing reads from samples 4-22 in Table 1 show no alignment results for SEQ ID NO.1-SEQ ID NO.3 (therefore, no alignment results can be shown), indicating that SEQ ID NO.1-SEQ ID NO.3 have extremely high specificity in the Camellia multipetalata genome. The method of this invention can accurately identify Camellia multipetalata.

[0075] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to the above embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A molecular marker for identifying or assisting in the identification of multi-petaled camellia, characterized in that, The molecular marker contains at least one sequence from SEQ ID NO.1 or SEQ ID NO.

2.

2. A method for identifying or assisting in the identification of multi-petaled camellia, characterized in that, The method includes the following steps: 1) selecting the tissue to be tested as the sample to be tested; 2) extracting total DNA from the sample to be tested; 3) performing high-throughput sequencing on the extracted total DNA to obtain sequencing reads; 4) assembling the sequencing data and comparing the assembled contigs with the molecular marker described in claim 1; 5) determining whether the sample to be tested is Camellia multipetalus based on the comparison results; if the assembled contigs contain a contig that is completely consistent with the sequence of the molecular marker, then the species of the sample to be tested is determined to be Camellia multipetalus.

3. A method for identifying or assisting in the identification of multi-petaled camellia, characterized in that, The method includes the following steps: 1) collecting tissue to be tested as the sample to be tested; 2) extracting total DNA from the sample to be tested; 3) performing second-generation high-throughput sequencing on the total DNA of each sample to be tested to obtain sequencing reads; 4) aligning the obtained sequencing reads to the molecular marker described in claim 1; 5) determining whether the sample to be tested contains Camellia multipetalum based on the coverage of the sequencing reads on the molecular marker; if the sequencing reads can completely cover the molecular marker and can generate a consistent sequence that is completely consistent with the DNA molecular marker, then it is determined that the species of the sample to be tested contains Camellia multipetalum.

4. The method for identifying or assisting in the identification of multi-petaled camellias according to claim 3, characterized in that, In step 4), the sequencing reads of multiple samples are mixed and grouped. The method further includes step 6): the samples that have been identified as containing Camellia multipetalus are divided into two groups, the sequencing reads of each group are mixed, and the operation of step 5) above is repeated until a single sample containing Camellia multipetalus is accurately identified.

5. The method for identifying or assisting in the identification of multi-petaled camellias according to any one of claims 2 to 4, characterized in that, For the high-throughput sequencing mentioned in step 3), either second-generation sequencing technology or third-generation sequencing technology should be used.

6. The method for identifying or assisting in the identification of multi-petaled camellias according to any one of claims 3 to 4, characterized in that, When performing reads comparison in step 4), use any one of the following software: Geneious, Bowtie, Tophat, or HISAT.

7. The application of the molecular marker as a reference sequence in a method for identifying or assisting in the identification of Camellia multipetala.

Citation Information

Patent Citations

  • SNP molecular marker used for identifying camellia nitidissima and application thereof

    CN104293776A

  • Pericarpium medicaginis U6 promoter and application thereof

    CN117603974A