Alkali-resistant xylanase mutant and application thereof

Abstract

The invention provides an alkali-resistant xylanase mutant and application thereof. The alkali-resistant xylanase mutant takes xylanase as a parent enzyme, the amino acid sequence of the xylanase is shown as SEQ ID NO.1, and the alkali-resistant xylanase mutant generates the following mutations relative to the parent enzyme: the 27th site, the 121st site, the 194th site, the 27th site and the 111th site of the parent enzyme are mutated into the 27th site, the 121st site, the 194th site, the 27th site and the 111th site of the parent enzyme, and the 27th site, the 121st site, the 194th amino acids of any one of the 27th site and the 194th site are mutated. Amino acid mutation sites of the five types of xylanase are found in total, the alkali stability and the high-temperature stability of the five types of xylanase mutants are obviously improved compared with those of wild type xylanase, and the specific enzyme activity is higher than that of the wild type xylanase. According to the five types of xylanase mutants, glutamic acid and aspartic acid with negative charges are replaced by lysine with positive charges on the surface, so that the protonation degree under the alkaline condition is improved, the hydration layer of xylanase under the alkaline condition is increased, the catalytic reaction is enhanced, and the activity of the xylanase under the alkaline condition is enhanced.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and enzyme engineering technology, specifically relating to an alkali-resistant xylanase mutant and its applications. Background Technology

[0002] Xylan is a naturally occurring hemicellulose polysaccharide, second only to cellulose in abundance, widely distributed in plant cell walls, and possesses excellent renewability and resource availability. However, due to its complex structure and high degree of polymerization, natural xylan is difficult to utilize directly. Xylanases are enzyme systems that specifically degrade xylan. Xylanases effectively cleave the β-1,4-glycosidic bonds in the xylan backbone, gradually degrading the complex polyxylan into oligosaccharides or xylose monomers with lower degrees of polymerization. In the industrial sector, this degradation process not only contributes to the efficient utilization of biomass resources and increases the added value of agricultural and forestry waste, but also plays a crucial role in various industries such as bioenergy, papermaking, feed, and food. Simultaneously, the degradation products, such as xylooligosaccharides and xylose, also have high commercial value and can be used as functional oligosaccharides, microbial fermentation substrates, and prebiotics, further expanding the utilization pathways and market prospects of xylan resources.

[0003] In many industrial applications, such as paper and textiles, operations often require exposure to high temperatures and alkaline environments, making alkali-resistant xylanases crucial. For instance, in the paper industry, pulp processing typically necessitates alkaline conditions, and most xylanases exhibit poor stability under alkaline conditions. The lack of alkali-resistant xylanases complicates the application of enzyme preparations in this process. Developing heat- and alkali-resistant xylanases is essential for improving industrial production efficiency and reducing production costs.

[0004] However, the production of alkali-resistant xylanases still faces several challenges. Screening and modifying xylanases with alkali and heat resistance requires complex technologies and substantial equipment investment. Furthermore, even if alkali-resistant xylanases can be synthesized artificially, the high production cost limits their industrial application. In addition, xylanases may face challenges from xylanase inhibitors in grains during practical applications, further increasing the complexity of their use. Therefore, how to efficiently and cost-effectively produce alkali-resistant xylanases is a pressing issue for current industrial applications. Summary of the Invention

[0005] This invention provides an alkali-resistant xylanase mutant and its application. The mutant exhibits good stability under high temperature and high alkalinity conditions, meaning it is both alkali-resistant and heat-resistant, thus enabling its large-scale application in industrial production.

[0006] This invention provides an alkali-resistant xylanase mutant, wherein the alkali-resistant xylanase mutant uses xylanase with the amino acid sequence shown in SEQ ID NO. 1 as the parent enzyme, and the alkali-resistant xylanase mutant produces the following mutations relative to the parent enzyme: mutating any one of the following amino acid sites: positions 27, 121, 194, 27 and 111, and positions 27 and 194 of the parent enzyme.

[0007] Furthermore, the parent enzyme was mutated in any of the following ways (a)-(e): (a) Mutate the glutamic acid at position 27 of the amino acid sequence of the parent enzyme to lysine to obtain the mutant enzyme E27K; (b) Mutate the 121st position of the amino acid sequence of the parent enzyme to lysine to obtain the mutant enzyme D121K; (c) Mutate the glutamic acid at position 194 of the parent enzyme to lysine to obtain the mutant enzyme E194K; (d) Mutate the glutamic acid at position 27 of the parent enzyme to lysine and the glutamic acid at position 111 to lysine to obtain the mutant enzyme E27K / E111K. (e) Mutate the 27th glutamic acid of the parent enzyme to lysine and the 194th glutamic acid to lysine to obtain the mutant enzyme E27K / E194K.

[0008] Further, the amino acid sequence of the mutant enzyme E27K is shown in SEQ ID NO. 4, the amino acid sequence of the mutant enzyme D121K is shown in SEQ ID NO. 5, the amino acid sequence of the mutant enzyme E194K is shown in SEQ ID NO. 6, the amino acid sequence of the mutant enzyme E27K / E111K is shown in SEQ ID NO. 7, and the amino acid sequence of the mutant enzyme E27K / E194K is shown in SEQ ID NO. 8.

[0009] A mutant gene encoding mutant enzyme E27K, mutant enzyme D121K, mutant enzyme E194K, mutant enzyme E27K / E111K, or mutant enzyme E27K / E194K.

[0010] Further, the nucleotide sequence encoding the mutant enzyme E27K is shown in SEQ ID NO. 9, the nucleotide sequence encoding the mutant enzyme D121K is shown in SEQ ID NO. 10, the nucleotide sequence encoding the mutant enzyme E194K is shown in SEQ ID NO. 11, the nucleotide sequence encoding the mutant enzyme E27K / E111K is shown in SEQ ID NO. 12, and the nucleotide sequence encoding the mutant enzyme E27K / E194K is shown in SEQ ID NO. 13.

[0011] A recombinant expression vector carrying a mutant gene.

[0012] Furthermore, the recombinant expression vector is any one of the following series: pET series, Duet series, pGEX series, pHY300 series, pHY300PLK series, pPIC3K series, and pPIC9K series.

[0013] A microbial cell that carries a mutant gene.

[0014] Furthermore, the microbial cells are prokaryotic cells or eukaryotic cells, the prokaryotic cells are Gram-negative bacteria or Gram-positive bacteria, and the eukaryotic cells are yeast.

[0015] Alkali-resistant xylanase mutants, mutant genes, recombinant expression vectors, or applications of microbial cells in the decomposition of xylan.

[0016] Compared with the prior art, the beneficial effects of the present invention include: The present invention provides an alkali-resistant xylanase mutant, which uses the xylanase with the amino acid sequence shown in SEQ ID NO. 1 as the parent enzyme. The alkali-resistant xylanase mutant undergoes the following mutations relative to the parent enzyme: mutations are made at any one of the following sites: positions 27, 121, 194, 27, and 111, and positions 27 and 194 of the parent enzyme. The present invention has discovered five types of amino acid mutation sites for xylanases. The alkali stability and high-temperature stability of the five types of xylanase mutants are significantly improved compared with wild-type xylanases, and the specific enzyme activity is higher than that of wild-type xylanases. The five types of xylanase mutants of the present invention, after replacing negatively charged glutamic acid and aspartic acid with positively charged lysine, have increased protonation under alkaline conditions, increased the hydration layer of xylanase under alkaline conditions, and enhanced the catalytic reaction of substrates in the active pocket layer, thereby enhancing the activity of xylanase under alkaline conditions. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0018] Figure 1 The surface melting temperatures Tm of WT, E27K, D121K, E194K, E27K / E111K and E27K / E194K in this invention are: Figure 2 The temperature half-life and pH half-life of WT, E27K, D121K, E194K, E27K / E111K and E27K / E194K of the present invention; Figure 3 The specific enzyme activities of WT, E27K, D121K, E194K, E27K / E111K, and E27K / E194K in this invention are as follows; Figure 4 The structure of the wild-type xylanase of the present invention; Figure 5 The SDS-PAGE electrophoresis results of the different xylanase mutants of the present invention after cleavage are shown. Detailed Implementation

[0019] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments, etc., used in the embodiments of the present invention are commercially available; unless otherwise specified, all technical means in the embodiments of the present invention are conventional means well known to those skilled in the art.

[0020] Example 1: Various alkali-resistant xylanase mutants This embodiment provides an alkali-resistant xylanase mutant. The alkali-resistant xylanase mutant uses the xylanase with the amino acid sequence shown in SEQ ID NO. 1 as the parent enzyme. The alkali-resistant xylanase mutant undergoes the following mutations relative to the parent enzyme: mutations are made at any one of the following sites: positions 27, 121, 194, 27, and 111, and positions 27 and 194 of the parent enzyme. The structure of the parent enzyme, i.e., the wild-type xylanase, is as follows: Figure 4 As shown.

[0021] This invention involves site-directed mutagenesis of parental enzymes. Site-directed mutagenesis involves the substitution, insertion, or deletion of one or more nucleotides at specific locations in a DNA molecule, thereby altering the gene sequence. Through site-directed mutagenesis, the roles of specific nucleotides or amino acid residues in gene function or protein structure can be studied.

[0022] Perform any of the following mutations on the parent enzyme: (a)-(e) (a) Mutate the glutamic acid at position 27 of the amino acid sequence of the parent enzyme to lysine to obtain the mutant enzyme E27K; (b) Mutate the 121st position of the amino acid sequence of the parent enzyme to lysine to obtain the mutant enzyme D121K; (c) Mutate the glutamic acid at position 194 of the parent enzyme to lysine to obtain the mutant enzyme E194K; (d) Mutate the glutamic acid at position 27 of the parent enzyme to lysine and the glutamic acid at position 111 to lysine to obtain the mutant enzyme E27K / E111K. (e) Mutate the 27th glutamic acid of the parent enzyme to lysine and the 194th glutamic acid to lysine to obtain the mutant enzyme E27K / E194K.

[0023] This embodiment provides five amino acid mutation sites for xylan. The first is to mutate the 27th glutamic acid of the parent enzyme to lysine; the second is to mutate the 121st aspartic acid of the parent enzyme to lysine; the third is to mutate the 194th glutamic acid of the parent enzyme to lysine; the fourth is to mutate the 27th glutamic acid of the parent enzyme to lysine and the 111th glutamic acid of the parent enzyme to lysine; and the fifth is to mutate the 27th glutamic acid of the parent enzyme to lysine and the 194th glutamic acid of the parent enzyme to lysine.

[0024] The five xylanase mutants, by replacing the negatively charged glutamic acid or aspartic acid with positively charged lysine, exhibited increased protonation under alkaline conditions, which increased the hydration layer of xylanase under alkaline conditions and enhanced the substrate catalytic reaction of the active pocket layer, thereby increasing the activity of xylanase under alkaline conditions.

[0025] The amino acid sequence of the mutant enzyme E27K is shown in SEQ ID NO. 4, the amino acid sequence of the mutant enzyme D121K is shown in SEQ ID NO. 5, the amino acid sequence of the mutant enzyme E194K is shown in SEQ ID NO. 6, the amino acid sequence of the mutant enzyme E27K / E111K is shown in SEQ ID NO. 7, and the amino acid sequence of the mutant enzyme E27K / E194K is shown in SEQ ID NO. 8.

[0026] Using mutant primers and a recombinant plasmid containing the wild-type sequence of the xylanase gene (BhS7Xyl) as a template, a recombinant plasmid containing the mutant site was amplified. A plasmid is a small, round, double-stranded DNA molecule typically found in the cytoplasm of bacteria and other microorganisms. Plasmids are capable of autonomous replication and can exist independently of the host cell's chromosome.

[0027] The nucleotide sequences encoding the mutant enzyme E27K are shown in SEQ ID NO. 9, the mutant enzyme D121K are shown in SEQ ID NO. 10, the mutant enzyme E194K are shown in SEQ ID NO. 11, the mutant enzyme E27K / E111K are shown in SEQ ID NO. 12, and the mutant enzyme E27K / E194K are shown in SEQ ID NO. 13. The mutant enzymes E27K, D121K, E194K, E27K / E111K, and E27K / E194K exhibit higher alkali and heat resistance than the wild-type xylanase. The mutant enzyme E27K / E111K represents a xylanase mutant in which both glutamic acid at position 27 and position 111 of the parent enzyme are mutated to lysine. The mutant enzyme E27K / E194K represents a xylanase mutant in which both glutamic acid at position 27 and position 194 of the parent enzyme are mutated to lysine.

[0028] This embodiment provides an alkali-resistant xylanase mutant. The alkali-resistant xylanase mutant uses the xylanase with the amino acid sequence shown in SEQ ID NO. 1 as the parent enzyme. The alkali-resistant xylanase mutant undergoes the following mutations relative to the parent enzyme: mutations at any one of the following sites: positions 27, 121, 194, 27, and 111, and positions 27 and 194. This invention has discovered five types of amino acid mutation sites for xylanases. These five types of xylanase mutants exhibit significantly improved alkaline and high-temperature stability compared to wild-type xylanases, and their specific enzyme activity is also higher. In this invention, the five types of xylanase mutants, by replacing negatively charged glutamic acid and aspartic acid with positively charged lysine, increase the degree of protonation under alkaline conditions, increase the hydration layer of the xylanase under alkaline conditions, and simultaneously enhance the catalytic reaction of the substrate in the active pocket layer, thereby enhancing the activity of xylanase under alkaline conditions.

[0029] Example 2 Xylanase Denaturing SDS-PAGE Analysis Take 20 μL of enzyme solution, add 5 μL of 5× Loading buffer, mix thoroughly, boil in a water bath for 5 min, centrifuge at 12000 rpm for 10 min, and then use for SDS-PAGE analysis. SDS-PAGE uses a 10% Nu PAGE non-gradient precast gel, with the matching 20× electrophoresis buffer as the electrophoresis buffer. After electrophoresis, stain with Coomassie Brilliant Blue R-250 in a microwave oven for 2 min, and then destain in a microwave oven for 2 min with destaining solution. Replace the destaining solution and continue destaining with shaking for 30 min. After changing the destaining solution 3 times, observe and photograph using a gel imaging system. The result shows a clear band around 44.5 kDa, indicating successful mutant expression. Cut the gel according to the size of the target band, and use a DNA gel extraction kit to extract the wild-type xylanase gene and five xylanase mutants.

[0030] Figure 5The images show the SDS-PAGE electrophoresis results of different xylanase mutants after fragmentation. SDS-PAGE electrophoresis was performed using a protein gel. An electric field is applied in a polyacrylamide gel, and proteins are separated based on their molecular weight. The sample loading volume was 20 μL, and M represents the protein molecular weight standard. 1. SDS-PAGE electrophoresis result of the supernatant after disruption of wild-type xylanase (WT) (band size 44.5 kDa); 2. SDS-PAGE electrophoresis result of the precipitate suspension after disruption of wild-type xylanase (WT); 3. SDS-PAGE electrophoresis result of the supernatant after disruption of xylanase mutant E27K (band size 44.5 kDa); 4. SDS-PAGE electrophoresis result of the precipitate suspension after disruption of xylanase mutant E27K; 5. SDS-PAGE electrophoresis result of the supernatant after disruption of xylanase mutant D121K (band size 44.5 kDa); 6. SDS-PAGE electrophoresis result of the precipitate suspension after disruption of xylanase mutant D121K; 7. SDS-PAGE result of xylanase mutant E194. SDS-PAGE electrophoresis results of the supernatant after disruption of xylanase mutant E194K (band size 44.5 kDa); 8 is the SDS-PAGE electrophoresis result of the precipitate suspension after disruption of xylanase mutant E27K / E111K (band size 44.5 kDa); 10 is the SDS-PAGE electrophoresis result of the precipitate suspension after disruption of xylanase mutant E27K / E111K (band size 44.5 kDa); 11 is the SDS-PAGE electrophoresis result of the supernatant after disruption of xylanase mutant E27K / E194K (band size 44.5 kDa); 12 is the SDS-PAGE electrophoresis result of the precipitate suspension after disruption of xylanase mutant E27K / E194K (band size 44.5 kDa). The band size in electrophoresis results refers to the molecular weight or length corresponding to the migration distance of DNA, RNA, or protein molecules in gel electrophoresis. For protein electrophoresis, the unit is kilodaltons (kDa). The smaller the molecular weight of the protein, the faster it migrates and the lower the band position.

[0031] Example 3 Xylanase activity was determined using the DNS method. 200 μL of 1% (w / v) xylan solution (prepared with pH 9.0 Gly-NaOH buffer) was mixed with 200 μL of diluted enzyme solution for the reaction. A reaction system without enzyme was included as a control. The reaction temperature was 70 °C, and the reaction was terminated immediately after 20 min by placing the sample in an ice-water bath for 5 min. For the control, 200 μL of diluted enzyme solution was added, and 600 μL of DNS reagent (185 g•L) was added to each tube. -1 Sodium potassium tartrate, 6.3 g•L -13,5-Dinitrosalicylic acid, 21 g•L -1 NaOH, 5 g•L -1 Crystalline phenol, 5 g•L -1 Sodium sulfite). The reaction mixture was boiled in a water bath for 5 min and then immediately placed on ice to cool. After being diluted a certain factor, the absorbance at 540 nm was measured using an ELISA reader.

[0032] This embodiment uses specific enzyme activity as an indicator of xylanase purity. Specific enzyme activity refers to the number of enzyme activity units per milligram of protein. For the same enzyme, the higher the specific enzyme activity, the stronger the catalytic ability per unit mass of protein, and the higher the enzyme purity. Specific enzyme activity = enzyme activity ÷ protein concentration. The unit of specific enzyme activity is U / mg, the unit of enzyme activity is U / mL, and the protein concentration is mg / mL. 1U is defined as the amount of enzyme that releases 1 micromole of reducing sugar (equivalent to glucose) per minute under specified assay conditions.

[0033] Under optimal reaction conditions, using xylan as a substrate, the specific enzyme activity and kinetic parameters of wild-type xylanase and xylanase mutants were determined, and the enzyme protein concentration was measured using a protein concentration analyzer. For kinetic parameter determination, the substrate concentration gradient of xylan was set to 0-20 mM, and the initial reaction rate was measured at different substrate concentrations. Nonlinear fitting was performed using GraphPadPrism 10.1.2 software to obtain the various kinetic parameters. The specific enzyme activity and kinetic parameters are shown in Table 1. The five xylanase mutants showed improved alkali stability, as well as increased specific enzyme activity, maximum reaction rate, and catalytic efficiency. The Michaelis constants of all five xylanase mutants were smaller than those of the wild-type xylanase.

[0034] Table 1. Comparison of specific enzyme activity and kinetic parameters of wild-type xylanase and its mutants

[0035] V max This indicates the maximum reaction rate, which is the highest rate achieved by the enzyme in catalyzing a reaction at a saturated substrate concentration. At this point, all active sites of the enzyme are occupied by the substrate, and the reaction rate reaches its maximum value.

[0036] K m The Michaelis constant represents the affinity between an enzyme and its substrate. It is the substrate concentration at which the enzyme's reaction rate reaches half of its maximum reaction rate. The smaller the Michaelis constant, the higher the affinity between the enzyme and its substrate.

[0037] k cat / K mThis represents the catalytic efficiency, which is the catalytic constant k. cat and the Mi constant K m The higher the ratio of catalytic efficiency to enzyme catalytic efficiency, the higher the enzyme's catalytic efficiency.

[0038] like Figure 3 As shown, Figure 3 The specific enzyme activities of wild-type xylanase WT, mutant enzyme E27K, mutant enzyme D121K, mutant enzyme E194K, mutant enzyme E27K / E111K, and mutant enzyme E27K / E194K are determined by... Figure 3 It can be seen that the specific enzyme activities of mutant enzymes E27K, D121K, E194K, and E27K / E194K are all above 700 U / mg. The specific enzyme activity of mutant enzyme E27K / E111K is greater than that of wild-type xylanase WT, but less than that of mutant enzyme E27K.

[0039] Example 4 Comparison of base stability before and after mutation (1) Dechaining temperature T m For each enzyme protein sample being analyzed, 20 μL of a 50 μg mL solution was used. -1 The purified protein sample was gently mixed with 5 μL of 100×SSYPRO® orange dye (Sigma; S5692) and flash-chilled at 4 °C for 2 min; using StepOnePlus... TM The real-time quantitative PCR system mixes the sample at 1 °C for 1 min. -1 The rate at which the temperature was heated from 25 °C to 95 °C was measured. T m Value, obtained from 3 parallel experiments T m The average value. For example... Figure 1 As shown in Table 2, compared to the wild type, the xylanase mutants E27K, D121K, E194K, E27K / E111K, and E27K / E194K showed... T m The values ​​increased by 1.4℃, 5.3℃, 1.9℃, 3.3℃, ​​and 3.6℃, ​​respectively. T m This refers to the melting temperature. T m This refers to the temperature at which 50% of double-stranded DNA molecules unwind; the melting temperature. T m It is an important indicator of the stability of nucleic acid molecules. T m The larger the value, the more stable the xylanase mutant.

[0040] Table 2. Wild-type xylanase and mutant xylanase T m value

[0041] (2) Half-life t 1 / 2 Half-life (t) 1 / 2 The inactivation constant k is the time required for an enzyme molecule to reduce its activity to half of its initial activity under specific conditions. It is calculated by measuring the residual enzyme activity after incubation at specific temperatures and pH for different times. d (defined as ln(residual enzyme activity) / warm water bath time t), half-life (t) 1 / 2 The formula for calculating ) is ln is a logarithmic function with the natural constant e as the base. The temperature half-life t is measured at 70°C under neutral conditions (pH 7). 1 / 2 (T), and the half-life measured at 70°C and in a buffer environment with pH=9.0 or pH=10.0 is the pH half-life t. 1 / 2 (pH).

[0042] The protein concentration was 10 μg / ml. -1 The diluted enzyme solution was incubated at 70°C for specific time intervals of 0 min, 30 min, 60 min, 90 min, 120 min, 180 min, and 240 min. Immediately after incubation, the solution was cooled on ice for 5 min. t 1 / 2 Calculation formula k d The inactivation constant is defined as ln[(residual enzyme activity) / incubation time (t)] / temperature half-life. The inactivation constant describes the rate at which an enzyme or other biologically active molecule is inactivated under specific conditions. It reflects the proportion of active molecules inactivated per unit time; a larger inactivation constant indicates a faster rate of enzyme inactivation.

[0043] Depend on Figure 2As shown, the wild-type xylanase has a temperature half-life of only 10.97 min and a pH half-life of only 33.96 min, while the temperature half-lives of the xylanase mutants E27K, D121K, E194K, E27K / E111K, and E27K / E194K are 121.60 min, 39.95 min, 67.80 min, 193.93 min, and 117.08 min, respectively, which are 11.1 times, 3.6 times, 6.2 times, 17.7 times, and 10.7 times that of the wild-type. The thermal stability of each mutant is significantly improved compared to the wild-type. When the temperature increases, the thermal motion of the enzyme molecule intensifies, and non-covalent interactions such as hydrogen bonds and hydrophobic interactions within the molecule are disrupted, making the enzyme's spatial structure prone to change. This structural change may lead to the inactivation of the enzyme's active site, thereby reducing enzyme activity. The pH half-lives of the xylanase mutants E27K, D121K, E194K, E27K / E111K, and E27K / E194K were 67.19 min, 44.62 min, 61.74 min, 45.41 min, and 32.78 min, respectively, which are 2.0 times, 1.3 times, 1.8 times, 1.3 times, and 0.97 times that of the wild type. Enzymes typically have a longer half-life near their optimal pH value because their structure and active site are most stable at this pH. The pH half-life of E27K / E194K is slightly lower than that of the wild-type xylanase. The basic stability of the four mutants, E27K, D121K, E194K, and E27K / E111K, was significantly improved compared to the wild type.

[0044] In summary, replacing negatively charged glutamic acid or aspartic acid with positively charged lysine in the five mutants increased the degree of protonation under alkaline conditions, increased the hydration layer of the enzyme under alkaline conditions, and simultaneously enhanced the substrate catalytic reaction in the active pocket layer, thereby increasing the activity of xylanase under alkaline conditions and improving the tolerance of xylanase to higher temperatures.

[0045] Example 5 Construction of recombinant plasmids This embodiment provides a recombinant expression vector carrying the mutant gene described in Example 1. The recombinant expression vector is any one of the pET series, Duet series, pGEX series, pHY300, pHY300PLK, pPIC3K, and pPIC9K series. The pET series vector is pET-15, pET-19, pET-20, pET-24, pET-28, or pET-32; the Duet series vector is pRSFDuet-1 or pACYCDuet-1; and the pGEX series vector is pGEX-4T-2 or pGEX-6P.

[0046] This embodiment also provides a microbial cell carrying a gene encoding a mutant enzyme. The microbial cell is a recombinant prokaryotic cell or a eukaryotic cell; the eukaryotic cell is yeast, and the prokaryotic cell is a Gram-negative or Gram-positive bacterium. The microbial cell is constructed by transferring a recombinant expression vector carrying the gene encoding the mutant enzyme into a host cell via electroporation or chemical transformation.

[0047] Based on the codon bias of *E. coli*, the xylanase gene sequence SEQ ID NO. 2 from *Bacillushalodurans* S7, publicly available in the NCBI database, was optimized for codons. The optimized nucleotide sequence, as shown in SEQ ID NO. 3, was then chemically synthesized by Sangon Biotech Co., Ltd. Codon optimization involves modifying the natural gene sequence to conform to target codon combinations specific to the host, thereby significantly improving expression levels, reducing host toxicity, or avoiding splicing errors. Bam H I endonuclease and Eco The expression vector pET28a was linearized using the RI restriction enzyme, and the xylanase gene shown in SEQ ID NO. 3 was linearized using the same restriction enzyme. BhS7Xyl The expression vector is subjected to double restriction enzyme digestion. Expression vector linearization refers to the process of cutting circular expression vector DNA into a linear form using restriction enzymes; in this example, the expression vector is a plasmid. Circular plasmids may affect transformation efficiency and gene expression stability during transformation due to their circular structure. Linearized plasmids can better integrate into the host cell's genome, thereby improving the expression efficiency of recombinant proteins. Linearizing plasmids has advantages such as improving transformation efficiency, enhancing gene expression, reducing plasmid replication, and avoiding plasmid recombination.

[0048] The enzyme digestion products were ligated using T4 DNA ligase to obtain a wild-type xylanase recombinant plasmid. The recombinant plasmid was then transformed into... E. coli Plasmids were extracted from positive transformants in JM109 competent cells (plasmid extraction kit purchased from OMEGA) to obtain wild-type cells. BhS7Xyl The recombinant plasmid.

[0049] Using the recombinant plasmid containing wild-type BhS7Xyl as a template, the xylanase gene was mutated and amplified using Prime STAR® MAX DNA Polymerase (purchased from TaKaRa) via two-step PCR or whole-plasmid PCR to obtain the xylanase mutant plasmid. The primers used (primer direction from 5'→3') are shown below: (a) Primers used for the alkali-resistant xylanase mutant: BhS7Xyl Full-length primers: BhS7Xyl _F:ATGATCACCCTGTTCAAAAAACCGTTCGTTGCGGGTCTGGCG(SEQ ID NO. 14), BhS7Xyl _R:GGATCGATGATACGCCAGTACGCCGGTTTAACACGGTAGTTG (SEQ ID NO. 15); E27K mutant primers (containing wild-type xylanase gene) BhS7Xyl (using the recombinant plasmid as a template): E27K_F m TTACCAG AAA CAGTTCGATATCGGTGCTGCTG (SEQ ID NO. 16), E27K_R m CGAACTG TTT CTGGTAACGTTCAGACAGGCTCG (SEQ ID NO. 17); D121K mutant primers (containing the wild-type xylanase gene) BhS7Xyl (using the recombinant plasmid as a template) D121K_F m CGAT AAA AACGGCAACCGTATGGTGGATGAAA (SEQ ID NO. 18); D121K_R m : GGTTGCCGTT TTT ATCGATGAAGAACCATTCCGG (SEQ ID NO. 19); E194K mutant primers (containing wild-type xylanase gene) BhS7Xyl (using the recombinant plasmid as a template) E194K_F m GGCGGT AAA GAAGCGAAACTGTACATCAACGAT (SEQ ID NO. 20); E194K_R m TTCGCTTC TTT ACCGCCGTATTTACGCGCGGT (SEQ ID NO. 21); E27K / E111K mutant primers (using a recombinant plasmid containing the E27K gene as a template): E111K_Fm: CGATAAAAACGGCAACCGTATGGTGGATGAAA (SEQ ID NO. 22); E111K_Rm: GGTTGCCGTTTTTATCGATGAAGAACCATTCCGG (SEQ ID NO. 23); E27K / E194K mutant primers (using a recombinant plasmid containing the E27K gene as a template): E194K_Fm: GGCGGTAAAGAAGCGAAACTGTACATCAACGAT (SEQ ID NO. 24); E194K_Rm: TTCGCTTCTTTACCGCCGTATTTACGCGCGGT (SEQ ID NO. 25); Reverse PCR primers: Reverse F: GGCGTATCATCGATCCGAATTC (SEQ ID NO. 26); Reverse R: TGAACAGGGTGATCATGGATCC (SEQ ID NO. 27); PCR system: 25 μL PrimeSTAR® MAX DNA Polymerase, 22 μL ddH2O, 1 μL recombinant plasmid, 1 μL forward primer, 1 μL reverse primer.

[0050] PCR reaction conditions are shown in Table 3: Table 3 PCR reaction conditions

[0051] The vector fragment of the PCR product was ligated to the xylanase gene fragment using a homologous enzyme, which was purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0052] Example 6 Construction of recombinant bacteria Escherichia coli ( Escherichia coli Preparation of BL21(DE3) competent cells: Following the standard procedure in the CompetentCell Preparation kit (purchased from TaKaRa), preserved *E. coli* were streaked onto LB antibiotic-free plates, and single colonies were picked and transferred to antibiotic-free LB tubes. The cells were incubated overnight at 37 °C and 200 rpm for 8-12 hours. A 2% inoculum was then transferred to a 250 mL Erlenmeyer flask containing 20% ​​LB antibiotic-free medium, and the incubation conditions were as described above. OD... 600After approximately 0.6-0.8 μL, incubate the 250 mL Erlenmeyer flask on ice for 30 min. Aliquot the bacterial suspension into sterile 50 mL centrifuge tubes in 25 mL increments. Centrifuge at 8000 rpm for 5 min at 4 °C, discard the supernatant, and gently resuspend the bacterial suspension by adding 10% solution A (0.05 mol / L CaCl2 solution). Centrifuge again at 6000 rpm for 5 min at 4 °C, discard the supernatant, and gently resuspend the bacterial suspension by adding 10% solution B (0.05 mol / L CaCl2 solution containing 15% glycerol). Aliquot the bacterial suspension into 1.5 mL sterile eptubs in 100 μL increments and store at -80 °C for up to one year. All operations must be performed under aseptic conditions.

[0053] Chemical transformation: [The substance] will melt on the ice E. coli JM109 competent cells were added to a clean bench with approximately 10 μL of enzyme ligation or homologous recombination product; after slow mixing, they were incubated on ice for approximately 30 min. After heat shock in a 42 ℃ metal bath for 90 s, they were incubated on ice for 5 min. 900 μL of LB medium was added, and the cells were cultured at 37 ℃ and 200 rpm for 1 h. The cells were centrifuged at 8000 rpm for 5 min, and the 800 μL supernatant was gently discarded in a clean bench. The cells were resuspended in the remaining culture medium, plated onto antibiotic plates, and incubated overnight at 37 ℃ for 12 h. Colonies were selected for colony PCR verification (primers used were...). BhS7Xyl Full-length primers were then used, and the samples were sent to a sequencing company for sequencing. Plasmids were extracted from the validated positive transformants and transformed into [a specific chemical transformation method] using the method described above. E. coli Colonies that grow on BL21 competent cells and resistant plates are the recombinant expression strains.

[0054] Example 7 Expression and purification of xylanase (1) Expression of wild-type xylanase: The expression of wild-type xylanase was carried out by adding xylanase containing wild-type xylanase. BhS7Xyl The recombinant bacteria were inoculated into 5 mL of a solution containing kanamycin (50 μg / mL). -1 In LB tubes, incubate at 37 °C and 200 rpm for 8–12 h. Transfer the bacterial culture to 400 mL of LB liquid medium (10 g•L) at a 1% inoculum. -1 Tryptone, 5.0 g•L -1 Yeast extract, 10 g•L -1 Add kanamycin to a 2L Erlenmeyer flask containing NaCl, and bring the final concentration to 50 μg / mL. -1 At 37℃ (200 r·min) -1 Under these conditions, culture with shaking for 3-5 hours until OD is reached. 595Approximately 0.6. Add IPTG to a final concentration of 0.4 mmol·L⁻¹. -1 At 16℃ and 200 r·min -1 Cultured under certain conditions for 12 h to induce expression of wild-type recombinant protein.

[0055] (2) Expression of xylanase mutant: Recombinant bacteria containing a recombinant plasmid of xylanase mutant gene were inoculated into 5 mL of a solution containing kanamycin (50 μg•mL). -1 The culture was placed in LB tubes and incubated at 37°C and 200 rpm for 8–12 h. The culture was then transferred at a 1% inoculum to 400 mL of LB liquid medium (10 g / L). -1 Tryptone, 5.0 g•L -1 Yeast extract, 10 g•L -1 Add kanamycin to a 2L Erlenmeyer flask containing NaCl, and bring the final concentration to 50 μg / mL. -1 Incubate at 37℃ and 200 rpm with shaking for 3-5 hours until OD is reached. 595 Approximately 0.6. Add IPTG to a final concentration of 0.4 mmol·L⁻¹. -1 The mutant recombinant protein was induced to express by culturing at 16℃ and 200rpm for 12 h.

[0056] (3) Purification of xylanase mutant: The recombinant bacteria were ultrasonically disrupted using an ultrasonic disruptor at 36% of its maximum output power for 2 seconds followed by a 3-second interval until complete disruption, yielding a whole-cell lysate. The lysate was then centrifuged at 13000 rpm for 30 minutes at 4°C. The supernatant was filtered through a 0.22 μm aqueous filter and the filtrate was collected. The filtrate was purified using an AKTAxpress purification system and a 5 mL HisTrapHP purification column. Elution was performed using a buffer containing 1 M imidazole (20 mM Tris-HCl, 150 mM NaCl) at a flow rate of 1 mL / min. -1 Elution was performed at a flow rate of [value missing]. The purified fraction was then verified by 10% (w / v) sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the purest fraction was desalted using an Amicon® Ultra 30kDa ultrafiltration tube with a 20 mM phosphate buffer solution containing 7.16 g / L Na₂HPO₄·12H₂O. -1 NaH2PO4·2H2O 3.12 g·L -1The pH value is 7.4.

[0057] It is understood that the above embodiments only illustrate preferred embodiments of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can freely combine the above technical features without departing from the concept of the present invention, and can also make several modifications and improvements, all of which fall within the protection scope of the present invention. Therefore, all equivalent transformations and modifications made with respect to the scope of the claims of the present invention should fall within the scope of the claims of the present invention.

Claims

1. A mutant of alkali-resistant xylanase, characterized in that, The alkali-resistant xylanase mutant uses xylanase with the amino acid sequence shown in SEQ ID NO. 1 as the parent enzyme. The alkali-resistant xylanase mutant produces the following mutations relative to the parent enzyme: mutating any one of the following amino acid sites: positions 27, 121, 194, 27 and 111, and positions 27 and 194 of the parent enzyme.

2. The alkali-resistant xylanase mutant according to claim 1, characterized in that, Perform any of the following mutations on the parent enzyme: (a)-(e) (a) Mutate the glutamic acid at position 27 of the parent enzyme to lysine to obtain the mutant enzyme E27K; (b) Mutate the 121st position of the amino acid sequence of the parent enzyme to lysine to obtain the mutant enzyme D121K; (c) Mutate the glutamic acid at position 194 of the amino acid sequence of the parent enzyme to lysine to obtain the mutant enzyme E194K; (d) Mutate the glutamic acid at position 27 of the parent enzyme to lysine and the glutamic acid at position 111 to lysine to obtain the mutant enzyme E27K / E111K. (e) Mutate the 27th glutamic acid of the parent enzyme to lysine and the 194th glutamic acid to lysine to obtain the mutant enzyme E27K / E194K.

3. The alkali-resistant xylanase mutant according to claim 2, characterized in that, The amino acid sequence of the mutant enzyme E27K is shown in SEQ ID NO. 4, the amino acid sequence of the mutant enzyme D121K is shown in SEQ ID NO. 5, the amino acid sequence of the mutant enzyme E194K is shown in SEQ ID NO. 6, the amino acid sequence of the mutant enzyme E27K / E111K is shown in SEQ ID NO. 7, and the amino acid sequence of the mutant enzyme E27K / E194K is shown in SEQ ID NO.

8.

4. A mutant gene, characterized in that, The mutant gene encodes the mutant enzyme E27K, mutant enzyme D121K, mutant enzyme E194K, mutant enzyme E27K / E111K or mutant enzyme E27K / E194K as described in any one of claims 2-3.

5. The mutant gene according to claim 4, characterized in that, The nucleotide sequence encoding the mutant enzyme E27K is shown in SEQ ID NO. 9, the nucleotide sequence encoding the mutant enzyme D121K is shown in SEQ ID NO. 10, the nucleotide sequence encoding the mutant enzyme E194K is shown in SEQ ID NO. 11, the nucleotide sequence encoding the mutant enzyme E27K / E111K is shown in SEQ ID NO. 12, and the nucleotide sequence encoding the mutant enzyme E27K / E194K is shown in SEQ ID NO.

13.

6. A recombinant expression vector, characterized in that, The recombinant expression vector carries the mutant gene as described in any one of claims 4-5.

7. The recombinant expression vector according to claim 6, characterized in that, The recombinant expression vector is any one of the following series: pET, Duet, pGEX, pHY300, pHY300PLK, pPIC3K, and pPIC9K.

8. A microbial cell, characterized in that, The microbial cell carries the mutant gene as described in any one of claims 4-5.

9. The microbial cell according to claim 8, characterized in that, The microbial cells are prokaryotic or eukaryotic cells, the prokaryotic cells are Gram-negative or Gram-positive bacteria, and the eukaryotic cells are yeast.

10. The use of the alkali-resistant xylanase mutant according to any one of claims 1-3, or the mutant gene according to any one of claims 4-5, or the recombinant expression vector according to any one of claims 6-7, or the microbial cell according to any one of claims 8-9 in the decomposition of xylan.

Images