Application of hsacirc0069443 in preparation of medicine for treating early pregnancy loss

Abstract

The invention provides application of hsacirc0069443 in preparation of a medicine for treating early pregnancy loss, and belongs to the technical field of molecular biology. The invention finds that the hsacirc0069443 is an important circRNA (Ribonucleic Acid) which causes the loss of early pregnancy. The hsacirc0069443 is down-regulated in a patient with early pregnancy loss, and the hsacirc0069443 is knocked down to inhibit proliferation, migration and invasion of trophoblast cells. The research finds that hsacirc0069443 can be secreted from trophoblast cells in an exosome form, migration and invasion of endometrial interstitial cells are promoted, and the endometrial gland epithelial cell EMT process is promoted by the exosome secreted by the trophoblast cells. The invention provides a new target for early pregnancy loss treatment.

Description

Technical Field

[0001] This invention belongs to the field of molecular biotechnology, and in particular relates to the application of hsa_circ_0069443 in the preparation of drugs for treating early pregnancy loss. Background Technology

[0002] Fertility issues have always been a focus of attention worldwide, and early pregnancy loss accounts for approximately 80% of all pregnancy losses. This not only affects women's physical and mental health but also has a significant impact on society and families. The American College of Obstetricians and Gynecologists (ACOG) defines early pregnancy loss as an intrauterine pregnancy at 12+6 / 7 weeks gestation without an embryo or signs of fetal viability, including an empty gestational sac or no fetal heartbeat. The causes of early pregnancy loss are complex, mainly including genetic factors, physiological factors, environmental factors, and immune factors. Among genetic factors, chromosomal abnormalities (including chromosomal abnormalities in the parents and embryo) account for approximately 50% of early embryonic losses. Embryonic chromosomal abnormalities are the primary cause of early pregnancy loss.

[0003] Non-coding RNAs (ncRNAs) play important biological functions at the RNA level, regulating vital life activities through their involvement in chromosome remodeling, gene transcription, and post-transcriptional modifications. ncRNAs include circular RNAs (circRNAs), long non-coding RNAs (lncRNAs), microRNAs (miRNAs), small nuclear RNAs (snRNAs), small nucleolar RNAs (snoRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), and PIWI-interacting RNAs (piRNAs). circRNAs are formed through backsplicing, where the 3' end of an exon is linked to its own 5' end or an upstream exon via a 3',5'-phosphodiester bond, forming a closed structure with a backsplicing site. This structure makes it more stable and has a longer half-life. With improvements in high-throughput RNA sequencing and computational methods, the vast majority of circRNAs have been identified. Currently, research on circRNAs in the field of miscarriage is relatively limited. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide the use of hsa_circ_0069443 in the preparation of a medicament for treating early pregnancy loss.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] Application of hsa_circ_0069443 in the preparation of drugs for treating early pregnancy loss.

[0007] Preferably, the nucleotide sequence of hsa_circ_0069443 is shown in SEQ ID NO.1.

[0008] Preferably, the hsa_circ_0069443 promotes the proliferation, migration, and invasion of trophoblast cells.

[0009] Preferably, hsa_circ_0069443 inhibits the expression of ALKBH5 and promotes the expression of FN1.

[0010] Preferably, hsa_circ_0069443 increases the total RNA m6A methylation level in trophoblast cells.

[0011] Preferably, the hsa_circ_0069443 improves the stability of FN1 mRNA.

[0012] Another object of the present invention is to provide the use of hsa_circ_0069443 in the preparation of reagents for diagnosing early pregnancy loss.

[0013] Another object of the present invention is to provide a chorionic trophoblast exosome containing hsa_circ_0069443.

[0014] Another object of the present invention is to provide the use of the aforementioned chorionic trophoblast exosomes in the preparation of a medicament for treating early pregnancy loss.

[0015] Preferably, the chorionic trophoblast exosomes promote endometrial-mesenchymal transition and chorionic trophoblast migration.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] This invention provides the application of hsa_circ_0069443 in the preparation of drugs for treating early pregnancy loss. This invention is the first to discover that hsa_circ_0069443 is an important circRNA leading to early pregnancy loss. Downregulation of hsa_circ_0069443 in patients with early pregnancy loss, and knockdown of hsa_circ_0069443 inhibits the proliferation, migration, and invasion of trophoblast cells. Overexpression of hsa_circ_0069443 can rescue FN1 depletion and promote the biological activity of HTR-8 cells.

[0018] This invention has found that hsa_circ_0069443 can be secreted from trophoblast cells in the form of exosomes, promoting the migration and invasion of endometrial stromal cells, and that the exosomes secreted by trophoblast cells promote the EMT process of endometrial glandular epithelial cells.

[0019] This invention reveals for the first time the role of the hsa_circ_0069443 / ALKBH5 / FN1 axis in early pregnancy loss, providing a new target for the treatment of early pregnancy loss. Attached Figure Description

[0020] Figure 1 The differential expression of circRNAs between patients with early pregnancy loss and those with early pregnancy is shown in the following figures: A is a high-throughput RNA sequencing heatmap, with red indicating high expression and green indicating low expression; B shows the differential expression of circRNAs between patients with early pregnancy loss and those with normal pregnancy; C shows the expression level of hsa_circ_0069443 in patients with early pregnancy loss and those with normal early pregnancy (HCS); and D shows the differences in age, gestational age, and body mass index between 175 patients with early pregnancy loss and 134 patients with early pregnancy loss.

[0021] Figure 2 The effects of hsa_circ_0069443 on the proliferation, migration, and invasion abilities of trophoblast cells are shown in Figure A, where A represents the effect of hsa_circ_0069443 on trophoblast cell proliferation; and B represents the effect of HTR. 8 / SVneo cell scratch assay, 40x magnification, scale bar = 100μm; C is JEG-3 cell scratch assay, 40x magnification, scale bar = 100μm; D is the effect of hsa_circ_0069443 on cell migration, 100x magnification, scale bar = 200μm; E is the effect of hsa_circ_0069443 on cell invasion, 100x magnification, scale bar = 200μm; Si-Circ0069443 is hsa_circ_0069443 knockdown, Si-NC is negative control (blank plasmid), OE-Circ0069443 is hsa_circ_0069443 overexpression, EV is cells transfected with empty vector;

[0022] Figure 3 The expression of hsa_circ_0069443 in different cell types of human chorionic villi and its expression in different exosomes are shown in the following: A shows the presence of hsa_circ_0069443 in CTB, STB, and EVT; B shows the qRT-PCR results of exosomes derived from chorionic villi tissues lost in early pregnancy and normal pregnancy; C shows the strong red fluorescence observed after transfection of Cy3-siRNA into chorionic villi explants.

[0023] Figure 4The images show the growth of trophoblast cells in villous tissue explant culture; A shows the effect of hsa_circ_0069443 knockout on cell migration, scale bar = 100 μm; B shows the effect of hsa_circ_0069443 overexpression on cell migration, scale bar = 100 μm; C shows cell migration in patients with early pregnancy loss and those with normal early pregnancy, scale bar = 100 μm; D shows the effect of hsa_circ_0069443 knockout on cell proliferation; E shows the effect of hsa_circ_0069443 overexpression on cell proliferation; F shows the effect of hsa_circ_0069443 on EVT cell migration and invasion, 40x magnification, scale bar = 100 μm; G shows the effect of hsa_circ_0069443 on CTB cell migration and invasion, 40x magnification, scale bar = 100 μm.

[0024] Figure 5 The interaction between hsa_circ_0069443 and ALKBH5 is shown in Figure 1. A represents the ALKBH5 binding site and score determined using RBPSuite; B represents the immunoblotting analysis after RNA pull-down assay; C represents the expression level of hsa_circ_0069443 in the ALKBH5 antibody-precipitated complex; and D represents the HTR... ALKBH5 protein expression in 8 / SVneo cells; E: ALKBH5 protein expression in JEG-3 cells; F: ALKBH5 protein expression in explant villous tissue; G: Effect of ALKBH5 knockdown on trophoblast cell proliferation; H: Effect of hsa_circ_0069443+ ALKBH5 knockdown on cell proliferation; I: Effect of hsa_circ_0069443+ ALKBH5 knockdown on FN1; J: Effect of hsa_circ_0069443+ ALKBH5 knockdown on cell migration, 40x magnification, scale bar = 100 μm; K: Effect of hsa_circ_0069443+ ALKBH5 knockdown on cell invasion, 40x magnification, scale bar = 100 μm.

[0025] Figure 6The relationship between hsa_circ_0069443 and ALKBH5 and FN1 mRNA is shown in the following figures: A represents the pairing of hsa_circ_0069443 and FN1 mRNA sequences; B represents the results of the RIP experiment; C represents the results of the RNA pull-down experiment; D represents the effect of hsa_circ_0069443 on FN1 protein expression levels; E represents the effect of hsa_circ_0069443 on cell proliferation; F represents the effect of hsa_circ_0069443 on cell migration and cell invasion (40x magnification, scale bar = 100 μm); G represents the effect of FN1 knockdown + ALKBH5 knockdown on cell proliferation; H represents the protein expression of FN1 and ALKBH5.

[0026] Figure 7 The effects of hsa_circ_0069443 on m6A levels in total RNA of trophoblast cells are shown in the following diagrams: A represents the effect of hsa_circ_0069443 on total m6A levels; B represents the dot blot results in HTR 8 / SVneo cells; C represents the dot blot results in JEG-3 cells; D represents the effect of ALKBH5+ knockdown on hsa_circ_0069443 on methylation levels; E represents the effect of hsa_circ_0069443 on m6A levels of FN1 mRNA; and F represents the effect of hsa_circ_0069443 on FN1 mRNA stability.

[0027] Figure 8 The effects of exosomes derived from trophoblast cells are illustrated below. A shows the degradation of proteins in exosome components by proteinase K; B shows the results of exosome qRT-PCR; C shows the results of exosome electron microscopy (40x magnification, scale bar = 100 μm); D shows exosome nanoparticle tracking analysis (NTA); E shows extracellular protein markers in exosomes; F shows the effect of exosomes containing hsa_circ_0069443 on cell migration ability (40x magnification, scale bar = 100 μm); G shows the effect of exosomes containing hsa_circ_0069443 on cell migration and invasion ability (100x magnification, scale bar = 200 μm); H shows the concentrations of hsa_circ_0069443 and FN1 in the ALKBH5 antibody-precipitated complex. mRNA levels; I represents the effect of exosomes on the levels of ALKBH5 and FN1 proteins in hESC; J represents the effect of exosomes containing hsa_circ_0069443 on the levels of MMP2 and E-cadherin proteins in EEC.

[0028] Figure 9 The results of simple tandem duplicate (STR) identification for organoids;

[0029] Figure 10The effects of hsa_circ_0069443 on trophoblast organoids are shown in Figures B, where B represents the results of hematoxylin-eosin (HE) staining of organoids at 200x magnification and scale bar = 100 μm; C represents the expression of hsa_circ_0069443 in organoid tissues; and D and E represent the effects of hsa_circ_0069443 on organoid activity, where D represents the electron microscopy findings of organoids at 40x magnification and scale bar = 100 μm. Detailed Implementation

[0030] This invention provides the application of hsa_circ_0069443 in the preparation of a medicament for treating early pregnancy loss. Early pregnancy loss is the main stage of all pregnancy loss, and insufficient proliferation and invasion of trophoblast cells are the main causes of pregnancy loss. The interaction between the uterus and the embryo is also crucial for successful pregnancy. This invention is the first to discover that hsa_circ_0069443 is downregulated in patients with early pregnancy loss.

[0031] In the present invention, the nucleotide sequence of hsa_circ_0069443 is as shown in SEQ ID NO.1: GACTTCCAATAGTAGTCAGACATTATCATCCTGTCATACTATGGAGCCATGTACATCAGATGAATTTTTCCAAGCCCTTAATCATGCCGAGCAAACATTTAAAAAAATGGAAAACTATTTGAGACATAAACAGTTGTGTGATGTAATTTTAGTCGCTGGTGATCGCAGAATTCCAGCTCACAGATTGGTGCTCTCCTCTGTCTCAGACTATTTTGCTGCCATGTTTACTAATGATGTCAGAGAGGCAAGACAAGAAGAAATAAAAATGGAAGGTGTAGAACCAAATTCGTTGTGGTCCTTGATCCAGTATGCTTATACAGGCCGCCTTGAATTAAAAGAAGATAATATTGAGTGCCTGTTATCTACAGCTTGCCTTCTTCAGCTTTCACAGGTTGTAGAAGCATGCTGTAAGTTTTTAATGAAACAGCTTCATCCATCCAACTGTCTTGGAATTCGTTCTTTTGCTGATGCCCAAGGTTGTACAGATTTGCATAAAGTGGCTCACAATTATACTATGGAGCATTTCATGGAAGTAATCAGAAACCAGGAATTTGTATTATTACCAGCCAGCGAAATTGCAAAGCTCTTGGCTAGTGATGACATGAACATTCCTAATGAGGAGACAATATTGAATGCACTTCTTACTTGGGTCCGTCATGATTTGGAACAGAGACGGAAAGATCTAAGTAAACTTTTGGCTTATATTAGGCTACCTCTTCTTGCACCACAG(SEQ ID NO.1).

[0032] In this invention, hsa_circ_0069443 promotes the proliferation, migration, and invasion of trophoblast cells. During early placental pregnancy, cytotrophoblasts (CTBs) differentiate into syncytiotrophoblasts (STBs) and extravillous trophoblasts (EVTs). STBs are primarily involved in the exchange of substances and hormone secretion between the mother and fetus; EVTs migrate and invade the decidua and the inner third of the myometrium, anchoring the placenta to the uterine wall and participating in the regulation of maternal-fetal immune tolerance and the remodeling of the uterine spiral arteries. The migration and invasion of EVT cells in the decidua and myometrium are crucial processes from embryo implantation to development. Problems at any step in this process can lead to pregnancy loss. This invention found that knocking down hsa_circ_0069443 inhibits the proliferation, migration, and invasion of trophoblast cells.

[0033] In this invention, hsa_circ_0069443 inhibits ALKBH5 expression and promotes FN1 expression. The demethylase ALKBH5 can bind to both hsa_circ_0069443 and FN1 mRNA. The expression of hsa_circ_0069443 is positively correlated with FN1 and negatively correlated with ALKBH5.

[0034] In this invention, hsa_circ_0069443 increases the total RNA m6A methylation level in trophoblast cells. ALKBH5 is an m6A demethylase belonging to the AlkB subfamily of the Fe(II) / 2-oxoglutarate (2OG) dioxygenase superfamily. N6-methyladenosine (m6A) is the most common internal modification in mammalian mRNA. M6A modification can regulate mRNA stability, alternative splicing, transport, and translation, thereby affecting various biological processes. hsa_circ_0069443 is linked to ALKBH5, affecting the overall m6A methylation level in the trophoblast. Knocking out hsa_circ_0069443 decreases the overall methylation level, while overexpression of hsa_circ_0069443 increases the overall methylation level.

[0035] In this invention, hsa_circ_0069443 enhances the stability of FN1 mRNA. hsa_circ_0069443 regulates the stability and expression of FN1 in trophoblast cells via an m6A methylation-dependent mechanism, thereby participating in the occurrence of early pregnancy loss.

[0036] This invention also provides the application of hsa_circ_0069443 in the preparation of reagents for diagnosing early pregnancy loss.

[0037] The present invention also provides a chorionic trophoblast exosome containing hsa_circ_0069443.

[0038] The present invention also provides the use of the aforementioned chorionic trophoblast exosomes in the preparation of a medicament for treating early pregnancy loss.

[0039] In this invention, the chorionic trophoblast exosomes promote endometrial-mesenchymal transition and promote chorionic trophoblast migration.

[0040] The results shown in this invention are representative of three independent experiments, n=3. Data are expressed as mean ± standard error (SEM). ns indicates P≥0.05; * indicates P<0.05; ** indicates P<0.01; *** indicates P<0.001; ***** indicates P<0.0001.

[0041] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0042] Example 1

[0043] 1. hsa_circ_0069443 expression is downregulated in patients with early pregnancy loss.

[0044] 1.1 High-throughput sequencing

[0045] RNA high-throughput sequencing was performed on 4 patients with early pregnancy loss and 4 patients with normal early pregnancy. Differentially expressed circular RNA was defined as p-value <0.05 and |log2-fold change| >1. This invention employed microarray hybridization technology for sequencing, and microarray hybridization and data collection were performed by Ribobio (Guangzhou, China).

[0046] Based on the sequencing results, 95 upregulated circular RNAs and 43 downregulated circular RNAs were identified. Figure 1 (A and B in the text).

[0047] 1.2 Real-time quantitative PCR

[0048] qRT-PCR was performed using a Quantstudio 3 real-time quantitative PCR instrument (Thermo Fisher Scientific, Waltham, MA, USA) with the qPCR Green Master mix (Yeasen Biotech). The Ct value comparison method was used for statistical analysis of the PCR results. (The last sentence appears to be incomplete and requires further context.) -ΔΔCtThe relative RNA expression was calculated and normalized to the internal reference gene U6 mRNA (human). The primer sequences for real-time quantitative PCR are shown in Table 1.

[0049] Table 1 Primer sequences for real-time quantitative PCR

[0050]

[0051] Based on high-throughput chorionic villus sequencing results from 4 pairs of patients with early pregnancy loss and healthy early pregnancy controls, the expression level of hsa_circ_0069443 in chorionic villus tissue samples from 175 patients with early pregnancy loss and 134 patients with early pregnancy loss was still significantly higher than that in the control group. Figure 1 (C) There were no statistically significant differences in age, gestational age, and body mass index among the 175 patients with early pregnancy and the 134 patients with early pregnancy loss. Figure 1 (D in the middle).

[0052] 2. hsa_circ_0069443 promotes the proliferation, migration, and invasion of trophoblast cells.

[0053] 2.1 Isolation and Culture of Primary Trophoblast Cells

[0054] Early pregnancy chorionic villus tissue collected from the abortion room was placed in a 35 mm culture dish on ice. The chorionic villus tissue was gently scraped off with a blade, and the chorionic membrane was discarded. Then, 100 mg of chorionic villus tissue was minced and transferred to a 15 mL centrifuge tube. The remaining villus at the bottom of the culture dish was rinsed with PBS buffer and transferred to the centrifuge tube as well. The centrifuge tube was centrifuged at 4 °C and 500 g for 5 min, the supernatant was discarded, and the chorionic villus tissue was collected. The chorionic villus tissue was resuspended in 200 μL of digestion solution (DNFU tissue dissociation kit, 11300602) and transferred to a 15 mL centrifuge tube. The centrifuge tube was sealed with a membrane and incubated in a 37 °C water bath for 30 min. After incubation, an equal volume of DMEM / F12++ (containing 1% penicillin-streptomycin and 10% FBS) medium supplemented with 20% fetal bovine serum (FBS; FSP100; Shanghai Ecosei Biotechnology, Shanghai, China) was added to the centrifuge tube to terminate digestion. Filter the mixture in the centrifuge tube through a 100 μm cell filter to remove debris. Transfer the remaining tissue after filtration to a new 15 mL centrifuge tube and add 10 times the volume of digestion solution. Seal the centrifuge tube again with a membrane and incubate at 37 °C for 10 min. After digestion, wash the cells and filter through a 100 μm cell filter. Discard the supernatant by centrifuging at 4 °C and 500 g for 5 min. Resuspend the pellet in 4 mL of 1× erythrocyte lysis buffer (Solepro, R1010), place on ice for 5 min, and then terminate lysis by adding PBS buffer containing 2% FBS at a 1:1 volume ratio. After cell counting, collect the pellet by centrifuging at 4 °C and 500 g for 5 min and resuspend it in 0.1 mL of culture medium (100 μL). The cells were then transferred to 5 mL flow cytometry tubes and mixed with 10 μL of FcRblocker (100 μL / mL, 18520, Stemcell, Canada), followed by the addition of CD49f antibody (5 μL / 10 mL). 6 Cells). After incubating at room temperature for 15 min, add 10 μL Selection Cocktail (100 μL / mV, EasySep). TM PE Positive Selection Kit II, 17684 (Stemcell, Canada), and incubate at room temperature for another 15 min. Vortex the mixture for 30 s to ensure complete dispersion. Then, add 5 μL of magnetic beads (50 μL / mL, EasySep) to the mixture. TMPE Positive Selection Kit II (17684, Stemcell, Canada) was used. After thorough mixing, the mixture was incubated at room temperature for 5 min. Next, 2 mL of PBS buffer containing 2% FBS was added and thoroughly mixed with a pipette. The (uncapped) centrifuge tube was placed on a magnet and incubated at room temperature for 10 min. The centrifuge tube was removed from the magnet, and the supernatant was discarded by repeatedly inverting the magnet and the centrifuge tube. This step was repeated three times. The cells were resuspended in DMEM containing 2% FBS, counted, and then seeded into 35 mm culture dishes at a seeding density of 5 × 10⁶ cells / mL. 5 Cells / dish

[0055] 2.2 CCK8 Detection

[0056] Cell proliferation was assessed using the Cell Counting Kit 8 (CCK-8) assay (Dojindo, Japan). Treated cells (3000 cells / well) were seeded into 96-well plates. CCK-8 solution was added to each well at 0, 24, 48, and 72 hours or 0, 12, 24, 48, and 60 hours. Optical density (OD) values ​​were measured at 450 nm using a microplate reader (ELX808, Agilent BioTek, Santa Clara, CA, USA). The average absorbance of three wells under each condition was recorded and calculated.

[0057] 2.3 Cell transfection

[0058] Transient transfection was performed using Liposome 3000 (Invitrogen, Thermo Fisher Scientific). Knockdown of circ0069443, ALKBH5, and FN1 was performed using small interfering RNA (siRNA) (siRNA sequences are shown in Table 1). Overexpression of circ0069443 was performed using pCE-RB-Mam-EGFP-has_circ_0069443. All raw materials and the empty vector (pCE-RB-Mam-EGFP-empty vector) plasmid were purchased from Ribobio (Guangzhou, China). HTR 8 / SVneo and JEG-3 cells were transfected and purchased from Wuhan Pronosun Biotechnology Co., Ltd.

[0059] The transfection procedure is as follows: one day before transfection, the cells are seeded into a suitable culture plate so that the cells reach a confluence of 60%-80% at the time of transfection.

[0060] Transfection plasmid: Dilute 5 μL of Lipofectamine 3000 transfection reagent with 125 μL of serum-free Opti-MEM medium (Gibco) (Solution A); add 1 μg of hsa_circ_0069443 overexpression plasmid and 3 μL of liposome 3000 to 125 μL of serum-free medium (Solution B), mix well, and incubate at room temperature for 5 min. Then mix Solutions A and B at a 1:1 volume ratio and incubate at room temperature for 15 min.

[0061] Transfection with siRNA: Dilute 5 μL of lipofectamine 3000 transfection reagent with 100 μL of serum-free culture medium (solution A); add 5 μL of siRNA hsa_circ_0069443 to 100 μL of serum-free culture medium (solution B) to a final siRNA concentration of 50 nM. Mix solutions A and B separately and incubate at room temperature for 5 min. Then mix solutions A and B at a 1:1 volume ratio and incubate at room temperature for 15 min. The siRNA sequence is shown in Table 2.

[0062] Total RNA or protein was extracted 48 hours after transfection for subsequent experiments.

[0063] Table 2 siRNA sequences

[0064] name Sequence (5'→3') has_circ0069443siRNA CACCACAGGACTTCCAATA(SEQ ID NO.2) ALKBH5siRNA GATCGCCTGTCAGGAAACA(SEQ ID NO.3) FN1siRNA GGAAAACACTATCAGATAA(SEQ ID NO.4)

[0065] Small interfering RNA (siRNA) and overexpression plasmids were transfected into HTR 8 / SVneo and JEG-3 cells. Based on cell counting kit 8 (CCK-8) proliferation assays, knockdown of hsa_circ_0069443 significantly reduced cell proliferation, while overexpression of hsa_circ_0069443 promoted trophoblast cell proliferation. Figure 2 (A)

[0066] 2.4 Scratch Test

[0067] After transfection, cells were seeded into six-well plates and cultured in an incubator at 37°C and 5% CO2. Experiments were conducted when the cells reached 90%-100% confluence. 200 μL of a yellow pipette tip was used to scratch the cells, followed by washing away floating cells with PBS. FBS-free medium was added for further culture. Microscopic images were taken at 0 h, 24 h, and 48 h post-scraping. If too many dead cells were observed before photographing, the cells could be washed once with PBS, being careful to be gentle.

[0068] Scratch assays showed that overexpression of hsa_circ_0069443 enhanced cell migration, while knockdown of hsa_circ_0069443 inhibited migration. Figure 2 (B and C in the text).

[0069] 2.5 Transwell migration and invasion experiments

[0070] Cell migration and invasion were measured in vitro using the matrix gel cell migration assay and invasion system.

[0071] Migration assay: For cell migration assays, HTR 8 / SVneo cells transfected using the method described in "2.2 Cell Transfection" were suspended in serum-free 1640 medium (PM150110; Procell Life) (60,000 cells / 200 μL). 100 μL of the cell suspension was placed in a Transwell chamber (8-μm pore size; Falcon, Corning Inc., Corning, NY, USA). Then, 600 μL of 1640 medium (PM150110; Procell Life) containing 20% ​​FBS was placed in the lower chamber. After incubation at 37°C for 48 hours, cells that had not migrated through the cell membrane were removed from the upper chamber using a cotton swab. The bottom of the chamber was fixed with 4% formaldehyde and stained with 1% crystal violet solution. Three different fields of view were randomly selected under a 100× magnification optical microscope, and the number of cells in each image was counted.

[0072] Invasion Assay: Compared to the migration assay described above, Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) was pre-coated onto the filter membrane of each insert (Matrigel: serum-free 1640 medium 1:8), and incubated at 37°C for 4 hours before use. HTR 8 / SVneo cells transfected with different strains were suspended in serum-free 1640 medium (60,000 cells / 200 μL), and 100 μL of the cell suspension was placed in a Transwell chamber (8-μm pore size; Falcon, Corning Inc., Corning, NY, USA). Then, 600 μL of 1640 medium (PM150110; Procell Life) containing 20% ​​FBS was placed in the lower chamber. After incubation at 37°C for 48 hours, unpenetrated cells and Matrigel in the upper chamber were removed using cotton swabs. The bottom of the chamber was fixed with 4% formaldehyde and stained with 1% crystal violet solution. Three different fields of view were randomly selected under an optical microscope at 100× magnification, and the number of cells in each image was counted.

[0073] The significance of hsa_circ_0069443 in cell migration was investigated using Transwell assays. Figure 2 (D, E in the text). For example... Figure 2As shown in D, compared with the control group (Si-NC group or EV group), overexpression of hsa_circ_0069443 increased cell migration, while knockdown of hsa_circ_0069443 reduced cell migration. Figure 2 As shown in Figure E, the Transwell invasion assay showed that overexpression of hsa_circ_0069443 increased cell invasion compared to the empty vector (EV) group, while knockdown of hsa_circ_0069443 reduced cell invasion.

[0074] 2.6 Explant Culture

[0075] Small tissue sections (2-3 mm) were obtained from the tips of human placental villi during early pregnancy (6-12 weeks). The villi were gently held with forceps and spread evenly in 12-well Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) culture dishes. 100 μL of DMEM / F12 medium containing 10% fetal bovine serum was added to each well for incubation. After anchoring (approximately 24 hours), 100 nM of has_circ0069443 siRNA with a red tag, 100 nM of si-NC control (Ruibo Biotechnology, Guangzhou, China), 200 nM of the overexpression plasmid pCE-RB-Mam-EGFP-has_circ_0069443, and 200 nM of the empty vector control were added to the wells. The transfection complex was prepared according to the Lipofectamine 3000 transfection reagent instructions, and the transfection procedure was the same as in "2.3 Cell Transfection".

[0076] Using the method described in "2.1 Isolation and Culture of Primary Trophoblast Cells", primary trophoblast cells were obtained from healthy patients with early pregnancy and patients who had lost their early pregnancy.

[0077] Using an explant culture model based on early pregnancy villi, primary trophoblast cells isolated from healthy early pregnancy patients and patients with early pregnancy loss were used as experimental subjects. Germination and migration of extracellular trophoblast (EVT) cells from the distal ends of the villi were recorded daily for 3 days. The degree of migration was measured using ImageJ Pro 6.0 software. All explant experiments using cultured villi were repeated three times.

[0078] This invention further confirms the effect of hsa_circ_0069443 on trophoblast cell migration based on an explant culture model of early pregnancy chorionic villi, in order to better simulate the differentiation process of trophoblast cells in early placental development. After 48 hours of culture, spindle-shaped trophoblast cells can be observed migrating from the tips of the villi.

[0079] Following the "2.2 Cell Transfection" method, after knocking down or overexpressing hsa_circ_0069443 in explants, strong red fluorescence was observed 24 hours after transfecting Cy3-siRNA (Raybot Biotechnology, Guangzhou, China) into villous explants. Figure 3 The results (C) indicate that Lipofectamine 3000 can effectively transfect exogenous siRNA into villous explants.

[0080] Compared with the control group, Cy3-si-hsa_circ_0069443 reduced the migration distance of villous trophoblast cells in explants, while overexpression of hsa_circ_0069443 increased the migration distance of villous trophoblast cells in explants. Figure 4 (A and B in the text). Compared to chorionic villi in patients with healthy early pregnancy, chorionic villi trophoblast cell migration was relatively poor in patients with early pregnancy loss. Figure 4 (C in the middle).

[0081] Based on the above experimental results, it is inferred that hsa_circ_0069443 can promote the proliferation, migration and invasion of trophoblast cells.

[0082] Early pregnancy chorionic villus tissue was further embedded and fixed, and immunohistochemical analysis was performed. Cytokeratin 7 (CK7) was used as a marker for trophoblast cells, and a green fluorescently labeled probe, hsa_circ_0069443, was used. CK7 staining and fluorescence in situ hybridization were performed on tissue sections. Based on the results of fluorescence in situ hybridization and immunohistochemistry, hsa_circ_0069443 was found to be present in the cytotrophoblast (CTB), syncytiotrophoblast (STB), and extravillous trophoblast (EVT), with higher abundance in the CTB and EVT. Figure 3 (A)

[0083] Using the method described in "2.1 Isolation and Culture of Primary Trophoblast Cells," primary cell trophoblast (CTB) and extravillous trophoblast (EVT) cells were isolated and cultured from the villi of healthy early-pregnancy patients for cell function experiments. siRNA and overexpression plasmids were transfected into CTB and EVT cells. Cell proliferation assays using CCK-8 assays showed that knockdown of hsa_circ_0069443 significantly reduced CTB cell proliferation, while overexpression of hsa_circ_0069443 promoted CTB cell proliferation. Figure 4 (D and E in the text). Furthermore, the role of hsa_circ_0069443 in CTB and EVT cell migration was investigated using Transwell assays. The overexpression group showed increased migration to the basal chamber compared to the control group, while the knockdown group showed decreased cell migration compared to the control group. Figure 4The F and G in the expression (EVT) were observed. Transwell invasion assays showed that in EVT cells, the overexpression group had more cells invading the basement membrane gel compared to the empty vector (EV) group, while the knockdown group had fewer invading cells compared to the control group. Figure 4 (F in the text)

[0084] Example 2

[0085] 1. Synergistic effect of hsa_circ_0069443 and ALKBH5

[0086] 1.1 Pull-down Experiment

[0087] According to the manufacturer (BersinBio, Guangzhou), the BersinBio™ RNA Pull-Down Kit is used according to standard procedures. This involves conjugating biotin-labeled RNA probes with magnetic beads and incubating them with cellular protein extracts. The protein molecules specifically bind to the RNA probes, and after elution, the target RNA probe-protein complex is obtained. RNA or protein is then extracted for qRT-PCR analysis or the binding product is detected using Western blotting.

[0088] 1.2 Immunoprecipitation

[0089] Immunoprecipitation (IP) lysis buffer (NP40, Beyotime, Jiangsu, China) and 1% benzyl sulfonyl fluoride (PMSF; ST506, Beyotime) were used. After centrifugation at 12,000 rpm for 20 minutes, the lysate was mixed with either anti-ALKBH5 (16837-1-AP; 4 μg; Proteintech) or immunoglobulin G (IgG; B900610; 4 μg Proteintech), with the immunoglobulin G group serving as a control. The mixture was then mixed with protein A / G magnetic beads (B23202; 40 μl / tube; Bimake, Houston, TX, USA) at 4°C. The beads were washed three times with IP wash buffer. TRIzol was added for routine RNA extraction, followed by cDNA reverse transcription and qPCR to verify the relative levels of target RNA among the input group, IgG group, and ALKBH5 group.

[0090] 1.3 RNA extraction and cDNA reverse transcription

[0091] Total RNA was isolated from tissues or cells using TRIZOL reagent (RNAex Pro Reagent, AccurateBiotechnology, Hunan, China) according to the manufacturer's instructions. All specimens had an OD260 / OD280 ratio of 1.8–2.0. 5 μg of RNA was added and reverse transcribed using cDNA synthesis reagent (Hifair III 1st Strand cDNA Synthesis SuperMix for qPCR gDNA Digester Plus, Yeasen Biotech, Shanghai, China).

[0092] 1.4 Real-time quantitative PCR

[0093] Same as 1.2 Real-time quantitative PCR in Example 1.

[0094] 1.5 Western Blotting

[0095] Total protein was extracted using RIPA protein lysis buffer (bestbio, Shanghai, China) and analyzed using the BCA assay (TakaraBio, Kusatsu, Japan). Proteins (30 μg) were separated using a 7.5–10% Super-PAGE Bis-Tris gel (EpiZyme, Cambridge, MA, USA). After electrophoresis, the proteins were transferred to a polyvinylidene fluoride membrane (MilliporeSigma, Burlington, MA, USA). The membrane was blocked in rapid blocking buffer (NCM Biotech, Suzhou, China) for 10 minutes and then incubated overnight at 4°C with primary antibodies: rabbit polyclonal antibody ALKBH5 (1:2000; 16837-1-AP; proteintech) and rabbit polyclonal antibody Fibronectin Polyclonal. Antibody (FN1; 1:2000; 15613-1-AP; proteintech), rabbit polyclonal antibody GAPDH (1:20000; AP0063, Bioworld, Irving, TX, USA), rabbit polyclonal antibody Tubulin (1:30000; AP0064, Bioworld, Irving, TX, USA), rabbit polyclonal anti-CD63 (1:500; 25682-1-AP; proteintech), rabbit polyclonal antibody TSG101 (1:10000; 28283-1-AP; proteintec) h), rabbit polyclonal antibody HSP70 (1:10000; 10995-1-AP; proteintech), rabbit polyclonal antibody E-cadherin (1:1000; YT1454; Immunoway), rabbit polyclonal antibody MMP-2 (1:1000; YT2798; Immunoway), then the membrane was incubated with HRP-goat anti-rabbit IgG secondary antibody (AP0063; 1:5000; Bioworld) at room temperature for 2 hours. Solution A and solution B from the ECL chemiluminescence kit were mixed at a 1:1 volume ratio, and the mixture was added dropwise to completely cover the PVDF membrane for imaging (ChampChemi 610, Sage Creation, Beijing, China).

[0096] 1.6 CCK-8 detection

[0097] Same as 2.2CCK-8 detection in Example 1.

[0098] 1.7 Cell Transfection

[0099] Same as cell transfection in Example 1, 2.3.

[0100] 1.8 Transwell Migration and Invasion Tests

[0101] Same as the 2.5 transwell migration and invasion test in Example 1.

[0102] 1.9 Explant Culture

[0103] Same as 2.6 explant culture in Example 1.

[0104] 1.10 Results

[0105] Bioinformatics software (RBPsuite; http: / / www.csbio.sjtu.edu.cn / bioinf / RBPsuite / ) predicts that RNA demethylase (ALKBH5) may be associated with hsa_circ_0069443. Figure 5 (A) in the middle.

[0106] To verify this hypothesis, RNA pull-down assays and RNA immunoprecipitation (RIP) were performed in the HTR 8 / SVneo cell line. The results showed that ALKBH5 could be successfully pulled down by the hsa_circ_0069443 probe, and ALKBH5 specifically binds to hsa_circ_0069443. Figure 5 In the ALKBH5 antibody precipitate complex, the level of hsa_circ_0069443 was higher than that in the IgG group (B), and the level of hsa_circ_0069443 was higher in the ALKBH5 antibody precipitate complex than in the IgG group (B). Figure 5 (C) Western blotting showed that knockdown of has_circ_0069443 in HTR 8 / SVneo and JEG-3 cell lines increased ALKBH5 protein levels compared to the control group, while overexpression of hsa_circ_0069443 resulted in decreased ALKBH5 protein levels (C). Figure 5 (D, E in the text). The same results were obtained in the villous tissue of the explant (…). Figure 5 (F in the text)

[0107] CCK-8 cell proliferation experiments in the HTR 8 / SVneo cell line showed that knockdown of ALKBH5 promoted trophoblast cell proliferation. Figure 5 To further confirm the relationship between the two, a rescue experiment was performed in HTR 8 / SVneo cells. Knockdown of hsa_circ_0069443 reversed the inhibitory effect of ALKBH5 knockdown on cell proliferation, migration, and invasion. Figure 5(H, I, J, K in the above data). The data table hsa_circ_0069443 can directly interact with the ALKBH5 protein, regulate the ALKBH5 protein level, and affect the proliferation, migration, and invasion capabilities of trophoblast cells.

[0108] 2. Relationship between hsa_circ_0069443 and ALKBH5 and FN1 mRNA

[0109] 2.1 Pull-down Experiment

[0110] Same as the pull-down experiment in 1.1 of this embodiment.

[0111] 2.2 RNA Immunoprecipitation Sequencing

[0112] Differential long RNA analyses of ALKBH5 protein versus IgG in the JEG cell line were performed using RIP-seq by Epigenetics (Guangzhou, China). Sequencing was performed using the Illumina high-throughput sequencing platform after quality control by Bioptic Qsep100.

[0113] 2.3 Cell transfection

[0114] Same as cell transfection in Example 1, 2.3.

[0115] 2.4 CCK-8 detection

[0116] Same as 2.2CCK-8 detection in Example 1.

[0117] 2.5 Transwell migration and invasion tests

[0118] Same as the 2.5 transwell migration and invasion test in Example 1.

[0119] 2.6 Explant Culture

[0120] Same as 2.6 explant culture in Example 1.

[0121] 2.7 Results

[0122] ALKBH5 is an m6A demethylase, and m6A is the most common internal modification of mRNA. To elucidate the downstream regulatory mechanism of ALKBH5, RNA immunoprecipitation sequencing (RIP-seq) was performed in the JEG-3 cell line using ALKBH5. Based on the sequencing results, using IP / input ≥2, FPKM (number of fragments per million mapped fragments) ≥1, and p < 0.05 as RIP thresholds, a total of 3304 genes with abnormal expression were identified. The presence of N6-methyladenosine methylation sites in downstream molecules was predicted using the SRAMP website (http: / / www.cuilab.cn / sramp), and hsa_circ_0069443 was screened using BLAST function on NCBI (https: / / www.ncbi.nlm.nih.gov / ). The hsa_circ_0069443 sequence and the FN1 mRNA sequence (encoding fibronectin 1) were found to have multiple complementary base pairs. Figure 6 (A) The association between ALKBH5 and FN1 was confirmed by RIP immunoprecipitation assay. Figure 6 (B in the text), and proved through RNA pull-down experiments that hsa_circ_0069443 is linked to FN1 ( Figure 6 (C in the middle).

[0123] Knockdown of ALKBH5 in the HTR 8 / SVneo cell line increased FN1 protein levels. Knockdown or overexpression of hsa_circ_0069443 also affected FN1 protein levels in the HTR 8 / SVneo cell line, JEG-3 cell line, and villous explants. Figure 6 D). Small interfering RNA (siRNA) plasmids were transfected into HTR 8 / SVneo cells. Based on cell counting kit 8 (CCK-8) proliferation assays, knockdown of hsa_circ_0069443 significantly reduced cell proliferation. Figure 6 (E in the text)

[0124] The role of FN1 in cell migration and invasion was investigated using Transwell assays. Knockdown of hsa_circ_0069443 reduced cell migration and invasion compared to the control group. Figure 6 The F in the text). CCK-8 cell proliferation experiments showed that knocking down FN1 followed by knocking down ALKNH5 could reverse cell proliferation (F). Figure 6 (G, H in). Finally, FN1 was determined to be the target of ALKBH5.

[0125] The above results indicate that ALKBH5 targets FN1 mRNA, and hsa_circ_0069443 may interact with FN1 mRNA through complementary base pairing.

[0126] Example 3

[0127] Example 2 of this invention demonstrates that the relationship between hsa_circ_0069443, ALKBH5 protein, and FN1 mRNA ultimately leads to changes in trophoblast cell function by affecting FN1 expression. This example investigates the effect of hsa_circ_0069443 expression level on the m6A level of total RNA in trophoblast cells.

[0128] 1. Determination of N6-methyladenosine (m6A) content

[0129] The m6A content of RNA was estimated according to the manufacturer's instructions using the EpiQuik m6A RNA Methylation Quantification Kit (P-9005, EpiGentek, Farmingdale, NY, USA). A PC (provided by the kit) was used to prepare six different concentration standard curves. Total RNA was extracted from HTR-8 cell samples under different treatments. RNA samples containing OD260 / OD280 > 1.9 and OD260 / OD230 > 1.7 were selected. Subsequently, 200 ng of RNA from each group of different HTR 8 / SVneo cell samples and a negative control (provided by the kit) was added to specific tubes (provided by the kit). OD values ​​at 450 nm were read using a microplate reader (ELX808, Agilent BioTek) to quantify the m6A content in each sample.

[0130] In the HTR 8 / SVneo cell line, colorimetric assays were used to confirm whether ALKBH5, an m6A demethylase, altered the m6A methylation level of total RNA in trophoblast cells. Knockdown of hsa_circ_0069443 reduced overall m6A levels. Figure 7 (A) in the middle.

[0131] 2. DOTblot Experiment

[0132] Total RNA was extracted with Trizol. 1 μg and 5 μg of total rRNA were heated at 75°C for 5 minutes, then immediately cooled on ice for 1 minute. RNA was dropped onto Amersham Hybond-N+ membranes (0.45 μm, YA1760, Solarbio, Beijing, China) at 1 μg and 5 μg respectively. After drying, the membranes were cross-linked twice using a UV cross-linker, blocked with 5% milk for 30 minutes, and incubated overnight at 4°C with m6A antibody (1:1000; 68055-1-lg; Proteintech). The membranes were washed three times with TBST for 10 minutes each time, incubated with anti-mouse secondary antibody at room temperature for 1 hour, and then washed three more times with TBST. Solution A and solution B from the ECL chemiluminescence kit were mixed at a 1:1 volume ratio and incubated with the membrane for 5 minutes before imaging (ChampChemi 610, Sage Creation, Beijing, China).

[0133] Dotblot experiments were used to further analyze hsa_circ_0069443 in HTR 8 / SVneo and JEG-3 cell lines to compare the effects of knockdown, overexpression, and total m6A levels with the negative control group. The results confirmed that, compared with the negative control group, knockdown of hsa_circ_0069443 downregulated the total m6A level in feeder cells, while overexpression of hsa_circ_0069443 increased the total m6A level. Further knockdown of ALKBH5 under hsa_circ_0069443 knockdown restored methylation levels. Figure 7 (B, C, D in the text).

[0134] 3. Merip-qPCR

[0135] To quantify the level of m6A-modified FN1 mRNA, methylated RNAIP (meRIP) was performed. Total RNA was isolated from treated HTR8 / Svneo cells. 4 μg of m6A antibody (ABE572-I; MilliporeSigma) was incubated overnight at 4°C with protein A / G magnetic beads (B23202; Bimake) in an IP buffer (NP40; Beyotime) containing PMSF and an RNase inhibitor. RNA (100 μg) was incubated with m6A antibody in each buffer. RNA was extracted from the magnetic beads and reverse transcribed into cDNA for further qRT-PCR. Primer sequences for FN1 used in meRIP-qRT-PCR are shown in Table 1.

[0136] To determine the function of m6A-modified FN1 mRNA, the modification site was predicted using the SRAMP online tool, and a Rach m6A sequence was found in the 3'UTR region of FN1. Methylation-associated RNA immunoprecipitation (MeRIP) qRT-PCR showed that, compared with the control group, overexpression of hsa_circ_0069443 induced an increase in the m6A level of FN1 mRNA. Figure 7 (E in the text)

[0137] 4. RNA stability test

[0138] HTR-8 cells were seeded in each well of a 6-well plate. After cell adhesion, HTR 8 / Svneo cells were transfected with si-circ0069443 and negative control (NC) oligonucleotides, respectively. 36-48 h post-transfection, HTR 8 / Svneo cells (S8964; Selleck, Houston, TX, USA) were treated with 5 μg / mL actinomycin D, and cell samples were collected at 0, 3, and 6 h. RNA was extracted and analyzed by qRT-PCR to detect the effect of different treatment factors on RNA stability.

[0139] Further research revealed that knocking down hsa_circ_0069443 reduced FN1 mRNA stability. Figure 7 The expression of hsa_circ_0069443 (F) led to a decrease in FN1 protein levels. The results showed that overexpression of hsa_circ_0069443 upregulated the methylation level of FN1 mRNA, thereby increasing its stability.

[0140] Example 4

[0141] 1. hsa_circ_0069443 is present in trophoblast-derived exosomes and promotes endometrial-mesenchymal transition (EMT) and migration.

[0142] 1.1 Exosome Extraction

[0143] HTR 8 / SVneo cells were cultured for 48 hours in 1640 medium (PM150110; Procell Life) containing 10% exosome-free serum (Vivacell). Exosomes were extracted from the HTR 8 / SVneo cell supernatant using an exosome extraction kit (YEASEN, 41201ES25, Shanghai, China) according to the manufacturer's instructions. Proteins were extracted from the exosomes using the BCA protein assay, and exosome markers were detected by Western blotting. Ultracentrifugation for exosome extraction, electron microscopy, and particle size analysis were performed by Beijing Hesheng Biotechnology Co., Ltd.

[0144] Exosomes were extracted from the supernatant of HTR 8 / SVneo cells using a polyethylene glycol (PEG) kit and high-speed centrifugation. The extracted extracellular vesicles were divided into two fractions. One fraction was subjected to degradation analysis using proteinase K (Beyotime; catalog number ST535) and ribonuclease A (RNase A, Solarbio; catalog number R8021). The other fraction of exosomes was used for qRT-PCR to confirm the presence of hsa_circ_0069443.

[0145] 1.2 Treatment of trophoblast cell-derived exosomes with RNase A and proteinase K

[0146] Exosomes derived from trophoblast cells were first treated with proteinase K (working concentration 100 mg / mL) at 37°C for 30 minutes, and then with RNase A (working concentration 10 mg / mL) at 37°C for 15 minutes. After treatment, proteins extracted from the exosomes were stained with Coomassie blue, and the results confirmed that most of the proteins in the exosome-rich components were degraded by proteinase K. Figure 8 (A) in the middle.

[0147] 1.3 Real-time quantitative PCR

[0148] Same as 1.2 Real-time quantitative PCR in Example 1.

[0149] Controls consist of exosomes that have not undergone degradation treatment;

[0150] Protinase K+RNaseA is exosomes after exosomal proteinase K and RNase A have been degraded.

[0151] qRT-PCR results showed that hsa_circ_0069443 in exosomes could not be degraded by proteinase K and RNase A. Figure 8 B) indicates that hsa_circ_0069443 is effectively protected by the extracellular membrane and its ring structure.

[0152] 1.4 Exosome Identification

[0153] Electron microscopy shows that the vesicles are round or disc-shaped. Figure 8 The C in the text is missing. Nanoparticle tracking analysis (NTA) showed an average size of 81.96 nm. Figure 8 (D in the original text). Western blot analysis confirmed the presence of CD63, tumor susceptibility gene 101 (TSG101), and heat shock protein 70 (HSP70) (extracellular protein markers). Figure 8 (E in the text)

[0154] 1.5 Isolation and Culture of Primary Trophoblast Cells

[0155] Isolation and culture of primary trophoblast cells as described in Example 1, Section 2.1.

[0156] Primary trophoblast cells were isolated and cultured from chorionic villi tissues of nine pairs of patients with early pregnancy loss and normal pregnancy, respectively. Exosomes were extracted and isolated from the cell culture supernatant, followed by RNA extraction and qRT-PCR analysis. The results showed that the expression level of hsa_circ_0069443 in exosomes derived from trophoblast cells of patients with early pregnancy loss was significantly reduced. Figure 3 (B in the middle).

[0157] 1.6 Scratch Test

[0158] Same as the scratch test in Example 1, section 2.4.

[0159] During embryo implantation, the activity of endometrial stromal cells increases and they migrate away from the implantation site, allowing trophoblast cells to invade the endometrial stroma. To further confirm the effect of exosomes on the endometrium, a scratch assay was performed.

[0160] 0% FBS: Exosomes isolated from HTR 8 / SVneo cells were added to normal endometrial stromal cells (hESCs) and scratch assays were performed in the presence of serum-free 1640 medium (PM150110; Procell Life).

[0161] 2% FBS: Exosomes isolated from HTR 8 / SVneo cells were added to normal endometrial stromal cells (hESCs) and a scratch assay was performed with the culture medium containing 2% FBS.

[0162] +Exosomes: Exosomes extracted from HTR 8 / SVneo cells were added to normal endometrial stromal cells (hESCs) and scratch assays were performed in the presence of serum-free medium.

[0163] +Exosomes(OE-Circ0069443): After overexpressing hsa_circ_0069443 in HTR 8 / SVneo cells, exosomes were extracted and added to hESC cells, and scratch assays were performed in the presence of serum-free medium.

[0164] Figure 8 The F in the figure indicates that endometrial cell migration was unchanged in the 0% FBS group. Cell migration ability was reduced in the +Exosomes group compared to the 2% FBS group. The +Exosomes (OE-Circ0069443) results show that exosomes from cells overexpressing hsa_circ_0069443 significantly enhanced cell migration ability.

[0165] 1.7 Transwell migration and invasion experiments

[0166] Same as the 2.5 transwell migration and invasion experiments in Example 1.

[0167] Exo(OE): After overexpressing hsa_circ_0069443 in HTR 8 / SVneo cells, exosomes were extracted and added to hESC cells for transwell migration and invasion experiments.

[0168] Exo: HTR 8 / SVneo cell exosomes were extracted and added to hESCs for transwell migration and invasion experiments.

[0169] Transwell assays showed that the addition of exosomes promoted the migration and invasion of hESC cells. Figure 8 (G in the middle).

[0170] 1.7 RNA Immunoprecipitation Sequencing

[0171] Same as 2.2 RNA immunoprecipitation sequencing in Example 2.

[0172] To determine whether the molecular mechanisms of endometrial stromal cells are consistent with those of trophoblast cells, RIP analysis was performed in hESC cells. The results showed that the levels of hsa_circ_0069443 and FN1 mRNA in the ALKBH5 antibody-precipitated complex were higher than in the IgG group. Figure 8 (H in the original text). Total protein was extracted after hESC cells were co-incubated with HTR 8 / SVneo cell-derived exosomes overexpressing hsa_circ_0069443 for 48 hours. Compared to hESCs alone, the addition of exosomes resulted in changes in ALKBH5 and FN1 protein levels (H in the original text). Figure 8 (I in the middle).

[0173] EMT in endometrial cells during the implantation window can promote the implantation process. Therefore, the effect of exosomes from HTR 8 / SVneo cells overexpressing hsa_circ_0069443 on epithelial-mesenchymal transition (EMT) of endometrial epithelial cells (EECs) was further investigated. After incubating EECs with exosomes from HTR 8 / SVneo cells overexpressing hsa_circ_0069443 for 48 hours, total protein was extracted, and EMT-related proteins were detected by Western blotting (same as 1.5 Western blotting in Example 2). The results showed that after adding exosomes overexpressing hsa_circ_0069443, the level of the epithelial marker E-cadherin in EECs was significantly reduced, while the level of the matrix marker matrix metalloproteinase 2 (MMP2) was significantly upregulated. Figure 8(J in the text). These results indicate that hsa_circ_0069443 is secreted by exosomes and promotes EMT in EECs.

[0174] 2. hsa_circ_0069443 promotes the proliferation of trophoblast organoids.

[0175] 2.1 Trophoblast organoid construction

[0176] Fresh placental villus tissue samples were collected and immediately placed in tissue preservation solution, stored on ice, and transported to the laboratory. At room temperature, the villus tissue was transferred to 50 mL centrifuge tubes containing addDMEM / F12+++ (1% penicillin-streptomycin, 10 mM HEPES, and 2 mM GlutaMAX), and washed on a shaker at low speed for 15 min. The tissue was then transferred to a clean 10 cm dish. The villi were detached from the placenta, and excess tissue was discarded. Blood clots were removed, and the villus fragments were washed twice with addDMEM / F12+++ (1% penicillin-streptomycin, 10 mM HEPES, and 2 mM GlutaMAX). Ten times the tissue volume of preheated trypsin (Woheng Biotechnology, Guangzhou, China) was added, and the tubes were sealed with sealing film and incubated in a 37°C water bath for 5 min. Digestion was terminated by adding DMEM / F12+++ (1% penicillin-streptomycin, 10 mM HEPES, and 2 mM GlutaMAX) medium containing 20% ​​fetal bovine serum (FBS; FSP100; Excell Bio, Shanghai, China) and filtering with sterile gauze. Unfiltered tissue was collected and transferred to a new 50 mL centrifuge tube. 110 times the tissue volume of villous tissue digestion solution was added, and the tube was sealed with sealing film and incubated at 37°C for 5 min. After digestion was complete, digestion was terminated, and the tissue was further digested by pipetting 10 times with a 1 mL pipette tip and then filtered through a 100 μm cell filter. Centrifuge at 400g for 5 min at room temperature, remove the supernatant, and resuspend in 10 mL LDMMEM / F12+++ (1% penicillin-streptomycin, 10 mM HEPES, and 2 mM GlutaMAX). Transfer to a 15 mL centrifuge tube, centrifuge at 400g for 5 min at room temperature, remove the supernatant, and resuspend in 100 μL of feeder plate organoid culture medium (Woheng Biotechnology, Guangzhou, China). Mix the pre-thawed matrix gel (Corning, USA) with the resuspended solution at a 1:1 volume ratio. Remove the 24-well plate that has been placed 2 hours in advance from the 37℃ incubator, add 50 μL of the mixture to each well, incubate at 37℃ for 5 min, and then invert for 20 min to solidify. After solidification, add 500 μL of feeder plate organoid culture medium (Woheng Biotechnology, Guangzhou, China), and incubate in a cell culture incubator. Observe the growth of organoids daily and change the culture medium every 2–3 days.

[0177] 2.2 Organoid overexpression lentivirus transfection

[0178] Aspirate the organoid culture medium from each well, wash twice with PBS, and add 1 mL of organoid passage digestion buffer (TrypLE) to each well. TM Express gibco (USA), disperse the matrix gel (Corning, USA) with a pipette, transfer to a 15 mL centrifuge tube, incubate on a shaker for 15 min, add 10 mL of pre-chilled DMEM / F12+++ (1% penicillin-streptomycin, 10 mM HEPES and 2 mM GlutaMAX) to resuspend, centrifuge at 300 g, 4 °C for 5 min, remove the supernatant, add 10 mL of pre-chilled DMEM / F12 to resuspend, centrifuge at 300 g, 4 °C for 5 min, remove the supernatant, add organoid culture medium to resuspend, adjust the concentration to 10,000 organoids / mL, add lentivirus and resuspension at a volume ratio of 1:5 to the resuspension, incubate at 37 °C for 2 h. Centrifuge at 300g, 4℃ for 5 min, remove supernatant, add appropriate volume of organoid culture medium and matrix gel at a 1:1 volume ratio to resuspend. Remove the 96-well plate that has been placed 2 hours in advance from the 37℃ incubator, add 5 μL of the mixture to each well, incubate at 37℃ for 5 min, then invert for 20 min to solidify. After solidification, add 100 μL of organoid culture medium to the 96-well plate and incubate in a cell culture incubator. Observe organoid growth and fluorescence daily, change the culture medium every 2-3 days, and observe organoid growth and organoid activity.

[0179] 2.3 Results

[0180] To find a better in vivo research model, a trophoblast organoid model was constructed and identified using simple tandem repeats (STRs). Figure 9 Hematoxylin-eosin (HE) staining confirmed the similarity between organoids and primitive tissues. Figure 10 (B in the text). Sanger sequencing (Crognex Biotechnology Co., Ltd., Guangzhou, China) validated the expression of hsa_circ_0069443 in organoid tissues. Figure 10 (C) The hsa_circ_0069443-overexpressing lentivirus was transfected into organoids. Organoid growth and activity were observed every 2-3 days. Significant differences were observed by day 5, with the hsa_circ_0069443-overexpressing group showing increased organoid activity compared to the control group. Figure 10 The D and E in the figure further illustrate the ability of hsa_circ_0069443 to promote the proliferation of trophoblast cells.

[0181] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Application of hsa_circ_0069443 in the preparation of drugs for treating early pregnancy loss.

2. The application according to claim 1, characterized in that, The nucleotide sequence of hsa_circ_0069443 is shown in SEQ ID NO.

1.

3. The application according to claim 1, characterized in that, The hsa_circ_0069443 promotes the proliferation, migration, and invasion of trophoblast cells.

4. The application according to claim 1, characterized in that, The hsa_circ_0069443 inhibits the expression of ALKBH5 and promotes the expression of FN1.

5. The application according to claim 1, characterized in that, The hsa_circ_0069443 increases the total RNA m6A methylation level in trophoblast cells.

6. The application according to claim 1, characterized in that, The hsa_circ_0069443 improves the stability of FN1 mRNA.

7. Application of hsa_circ_0069443 in the preparation of reagents for diagnosing early pregnancy loss.

8. A chorionic trophoblast exosome, characterized in that, The chorionic trophoblast exosomes contain hsa_circ_0069443.

9. The use of the chorionic trophoblast exosomes according to claim 8 in the preparation of a medicament for treating early pregnancy loss.

10. The application according to claim 9, characterized in that, The chorionic trophoblast exosomes promote endometrial-mesenchymal transition and chorionic trophoblast migration.

Images