Genetically engineered bacteria with high production of gallic acid and application thereof

By expressing the exogenous HPD gene and enhancing the shikimic acid pathway in Yersinia lipolytica, a genetically engineered strain that produces high levels of hypoxic acid was constructed. This solved the problems of chemical synthesis pollution and low yield from microbial fermentation, achieving efficient hypoxic acid production and demonstrating industrialization potential.

CN121320123BActive Publication Date: 2026-03-24BEIJING UNIV OF CHEM TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511903384.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-17
Publication Date
2026-03-24
Estimated Expiration
2045-12-17

AI Technical Summary

Technical Problem

Existing chemical synthesis methods for homogentisic acid are highly polluting, while microbial fermentation for homogentisic acid production yields low output, making it difficult to meet industrial needs, and requires the use of strains that meet food safety standards.

Method used

A genetically engineered strain producing high levels of homogentisic acid was constructed by expressing an exogenous HPD gene in Yersinia lipolytica to enhance the shikimic acid pathway and integrating multiple copies of the tHMGR gene to compensate for leucine deficiency, thus forming a stable genetically engineered strain.

Benefits of technology

The yield of hypoxic acid reached 1.76 g/L in shake flask fermentation and 33.71 g/L in fed-batch fermentation in a 2L fermenter, which significantly improved the yield and showed promise for industrial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The application discloses a genetically engineered bacterium with high yield of gallic acid and application thereof, and belongs to the technical field of gene recombination.The genetically engineered bacterium with high yield of gallic acid is prepared from Yarrowia lipolytica ATCC MYA-2613 as a starting strain, and the ku70 gene is knocked out; the gene coding 4-hydroxyphenylpyruvate dioxygenase is expressed; the shikimic acid pathway is strengthened; and three copies of tHMGR and the lysine defect are integrated.In 2L fermenter fed-batch fermentation, the yield of gallic acid is 33.71g / L, which is more than 10 times higher than the highest yield of gallic acid of 2.8g / L of the genetically engineered Yarrowia lipolytica reported at present in 2L fermenter fed-batch fermentation, and the application lays a solid foundation for industrialization of Yarrowia lipolytica for producing gallic acid, and has an industrial application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene recombination technology, and more specifically to a genetically engineered bacterium that produces high levels of homogentisic acid and its applications. Background Technology

[0002] Homogentisic acid (HGA, chemically known as 2,5-dihydroxyphenylacetic acid) is a water-soluble aromatic organic compound commonly used as an intermediate in organic synthesis and a raw material for dyes. HGA is a characteristic metabolite in urine and serum with diagnostic value, and can be used to detect alkaptonuria. Furthermore, HGA is a natural antioxidant with antioxidant capacity comparable to known antioxidants such as α-tocopherol, ascorbic acid, resveratrol, and BHA. HGA can reduce the production of reactive oxygen species, thereby mitigating oxidative damage to cells and exhibiting significant protective effects in vitro. In the presence of oxygen, HGA can auto-oxidize to generate pyomelanin, a brownish-black phenolic polymer with excellent dye properties, and can be used as a colorant and antifouling agent. Pyomelanin, due to its UV absorption capacity and non-cytotoxicity, has the potential for use as a sunscreen ingredient. Furthermore, the homogentisic acid-derived pigment (HDP) derived from HGA has been developed as a biocompatible intracellular marker for photoacoustic imaging of macrophages. The biopolymers generated from HGA possess practical application potential in several high-value fields.

[0003] Most of the hydantoin sold on the market is chemically synthesized. There are four synthetic routes for hydantoin reported in the literature: (1) Using 2,5-dihydroxyacetophenone as the starting material, the target compound is obtained by Willgerodt-Kindler reaction, hydrolysis, and acidification. This method will generate a large amount of sulfur-containing waste residue, which will put great pressure on the environment. (2) Using 2,5-dihydroxyacetophenone as the starting material, 2,5-dihydroxyphenylacetic acid is prepared by Blanc chloromethylation and high-pressure carbonylation. The product obtained by this method has high purity, but the technology and equipment requirements are high. The catalyst used is expensive and easily deactivated and lost. The technology is not yet mature. (3) Using p-dihydroxybenzene as the raw material, 2,5-dihydroxyphenylacetic acid is obtained by FC reaction, ketal rearrangement, and hydrolysis. This method has many problems, with a lot of wastewater that is difficult to recycle and generate a large amount of saline wastewater. (4) The target compound is obtained by Blanc chloromethylation, cyanation, and alkaline hydrolysis using p-dihydroxybenzene as a raw material. This method generates a large amount of saline wastewater. Therefore, a more environmentally friendly and economical production strategy is urgently needed. With the continuous development of synthetic biology, genetic engineering, and metabolic engineering technologies, constructing a genetically engineered bacterium that produces high levels of hypoxic acid is currently the most promising method for producing hypoxic acid.

[0004] In the microbial synthesis of HGA, the precursor of homogentisic acid (HGA) is 4-hydroxyphenylpyruvic acid (4-HPP), which is catalyzed by 4-hydroxyphenylpyruvic acid dioxygenase (HPD) to produce HGA. HPD is a heme iron-independent enzyme that exists as a homotetramer in bacteria and as a homodimer in plants. HPD has been identified in humans, mice, rats, plants, fungi, and prokaryotes. HGA originates from two pathways in microorganisms. One is from the shikimic acid pathway, where 3-deoxy-7-phosphate heptadate synthase (ARO4) catalyzes the condensation of phosphoenolpyruvate (PEP) and erythrose-4-phosphate (E4P) to generate 3-deoxy-2-arabinoheptadate-7-phosphate (DAHP). This intermediate is converted into a branched-chain acid compound by the aromatic metabolic pathway pentafunctional AROM polypeptide ARO1, which is then further catalyzed by ARO7 to generate prephenate. Prephenate is converted into 4-hydroxyphenylpyruvate (4-HPP), and finally catalyzed by HPD enzymes to generate HGA. The other pathway originates from the catabolism of tyrosine. Tyrosine is converted into 4-HPP under the catalysis of ARO8 (Aromatic / aminoadipate aminotransferase 1) and ARO9 (Aromatic amino acid aminotransferase 2), and then catalyzed by HPD enzymes to generate HGA.

[0005] HGA production has been found in various microorganisms, and HGA production can be increased through metabolic engineering strategies. Common methods include introducing exogenous HPD enzymes, overexpressing endogenous HPD enzymes, overexpressing genes in the shikimic acid pathway, and knocking out competing pathways. Hypoxic acid production is highest in the host Yersinia lipolytica, with a maximum HGA production of 2.8 g / L.

[0006] The existing problems are as follows: chemical synthesis of hypoxic acid causes environmental pollution, wastewater treatment is difficult, and product yield is low. Utilizing synthetic biology to produce hypoxic acid through microbial fermentation is a green and environmentally friendly strategy. Since HGA has great application prospects in antioxidants, sunscreens, and intracellular markers, it is necessary to select food-safe strains for production. Currently, the highest yield of hypoxic acid produced by microorganisms is 2.8 g / L in a 2L fermenter with fed-batch fermentation, which is still a long way from industrial application. Therefore, it is necessary to construct a genetically engineered strain that produces high-yield hypoxic acid and meets biosafety standards.

[0007] Therefore, providing a genetically engineered bacterium that produces high levels of hyaluronic acid and its applications is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0008] In view of this, the present invention provides a genetically engineered bacterium that produces high levels of hyaluronic acid and its applications.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] *Yersinia lipolytica* is an unconventional oil-producing yeast with exceptional resilience. It can utilize not only glucose as a carbon source but also various substrates such as waste oils, crude glycerol, and organic acids. Some *Yersinia lipolytica* strains have been approved by the U.S. Food and Drug Administration (FDA) and have achieved Generally Recognized as Safe (GRAS) status, making it a suitable host for the production of food additives, pharmaceuticals, and cosmetics. Furthermore, *Yersinia lipolytica* can naturally synthesize HGA, thus making it a promising host for the production of homogentisic acid.

[0011] This invention modifies Yersinia lipolyticis in three aspects:

[0012] 1) Expression of the exogenous HPD gene (integration of PpHPD at the ku70 site). The HPD gene is PpHPD, a gene encoding 4-hydroxyphenylpyruvate dioxygenase derived from Pseudomonas putida KT2440 and codon-optimized.

[0013] 2) Enhance the shikimic acid pathway. Genes related to the shikimic acid pathway include:

[0014] Overexpression was derived from Yersinia lipophila ( Yarrowia lipolytica The gene ylARO1, which encodes the pentafunctional aromatic amino acid synthesis multienzyme complex, is from ATCC MYA-2613.

[0015] Overexpression was derived from Yersinia lipophila ( Yarrowia lipolytica The gene ylARO2 encoding chorimite synthase in ATCC MYA-2613;

[0016] The expression originates from brewer's yeast ( Saccharomy cerevisiae The gene scARO4, which encodes 3-dehydro-3-deoxyheptonate aldolase (BY4741), has a leucine-lysine mutation at position 229. K229L ;

[0017] The expression originates from Yersinia lipophila ( Yarrowia lipolytica The gene ylARO7 of ATCC MYA-2613 encodes shikimate mutase with a mutation at amino acid position 139 where glycine is replaced by threonine. G139S .

[0018] 3) The gene encoding hydroxymethylglutaryl-CoA (HMG-CoA) reductase, which expresses three copies, is derived from *Yarrowia lipolytica*. Yarrowia lipolytica The ATCC MYA-2613 gene tHMGR, which encodes hydroxymethylglutaryl-CoA reductase and has the first 500 amino acids deleted from the N-terminus, significantly increases purpuric acid production; and it also expresses the gene derived from Yersinia lipolytica. Yarrowia lipolytica The CLIB122 gene encoding leucine synthesis, 3-isopropylmalate dehydrogenase (LEU2), compensates for the leucine synthesis deficiency in genetically engineered strains, allowing them to reduce industrial costs by eliminating the need for additional leucine during fermentation.

[0019] A genetically engineered bacterium that produces high levels of hyaluronate.

[0020] Using Yersinia lipophila ATCC MYA-2613 as the starting strain, the ku70 gene was knocked out.

[0021] Express the gene encoding 4-hydroxyphenylpyruvate dioxygenase;

[0022] Enhance the shikimic acid pathway: express genes encoding a multi-enzyme complex for the synthesis of five functional aromatic amino acids, genes encoding shikimic acid synthase, genes encoding 3-deoxy-D-arabinohepulose-7-phosphate synthase, and genes encoding shikimic acid mutase;

[0023] Integration of three copies of tHMGR and leucine deficiency correction: Two copies of the gene encoding hydroxymethylglutaryl-CoA reductase with the N-terminus 500 amino acids removed were integrated into the intE1 site; one copy of the gene encoding hydroxymethylglutaryl-CoA reductase with the N-terminus 500 amino acids removed and the gene encoding leucine synthesis were integrated into the intD1 site.

[0024] Furthermore, the gene sequence encoding 4-hydroxyphenylpyruvate dioxygenase is shown in SEQ ID NO.1;

[0025] The gene sequence encoding the five-functional aromatic amino acid synthesis multienzyme complex is shown in SEQ ID NO.28;

[0026] The gene sequence encoding shikimate synthase is shown in SEQ ID NO.29;

[0027] The gene sequence encoding 3-deoxy-D-arabinohepenosyl-7-phosphate synthase is shown in SEQ ID NO.30;

[0028] The gene sequence encoding shikimate mutase is shown in SEQ ID NO.31;

[0029] The gene sequence encoding hydroxymethylglutaryl-CoA reductase with the N-terminus 500 amino acids removed is shown in SEQ ID NO. 63;

[0030] The gene sequence encoding leucine synthesis is shown in SEQ ID NO.88, 1191-2327bp.

[0031] Furthermore, the method for constructing a genetically engineered bacterium that produces high levels of hyaluronic acid includes the following steps:

[0032] Using Yersinia lipophila ATCC MYA-2613 as the starting strain, the ku70 gene was knocked out.

[0033] Express the gene encoding 4-hydroxyphenylpyruvate dioxygenase;

[0034] Strengthening the shikimic acid pathway;

[0035] It integrates three copies of tHMGR and fills in the leucine deficiency.

[0036] Furthermore, the application of the genetically engineered bacterium that produces high levels of hypoxic acid in the production of hypoxic acid.

[0037] Furthermore, the application of the genetically engineered bacterium that produces high levels of hypoxic acid in increasing hypoxic acid production.

[0038] Furthermore, a method for producing homogentisic acid involves fermentation using the aforementioned genetically engineered bacteria.

[0039] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a genetically engineered bacterium that produces high levels of hypoxic acid and its applications, which have the following beneficial effects:

[0040] (1) The host Yersinia lipophila selected in this invention is a food-grade microorganism that is non-pathogenic to humans and animals and has a better growth advantage under the same culture conditions.

[0041] (2) The genetically engineered bacteria constructed in this invention are gene-integrated bacteria, which compensate for the leucine deficiency. No amino acids need to be added during the fermentation process, no free plasmids are used, and no antibiotics need to be added. Therefore, it has good stability and robustness.

[0042] (3) The hypoxic acid yield of the genetically engineered *Yersinia lipolytica* strain constructed in this invention was 1.76 g / L during shake-flask fermentation and 33.71 g / L during fed-batch fermentation in a 2L fermenter, which is the highest yield to date. Compared with the currently reported highest yield of 2.8 g / L of hypoxic acid from genetically engineered *Yersinia lipolytica* strains during fed-batch fermentation in a 2L fermenter, this is more than 10 times higher. This invention lays a solid foundation for the industrialization of hypoxic acid production from *Yersinia lipolytica* and has promising prospects for industrial application. Detailed Implementation

[0043] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0044] LB medium: yeast extract 5 g / L, tryptone 10 g / L, NaCl 5 g / L.

[0045] YPD medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L.

[0046] SC medium: Yeast Nitrogen base (YNB) 1.7 g / L, ammonium sulfate (NH4)2SO4 5 g / L, amino acid mixture 1.8 g / L, glucose 20 g / L.

[0047] Composition of the amino acid mixture: Adenine 0.5g, Alanine 2.0g, Argnine 2.0g, Asparagine 2.0g, Aspartic acid 2.0g, Cysteine ​​2.0g, Glutamine 2.0g, Glutamic acid 2.0g, Glycine 2.0g, Histidine 2.0g, Inositol 2.0g, Isoleucine 2.0g, Leucine 4.0g, Lysine 2.0g, Methionine 2.0g, Aminobenzoic acid (… para Aminobenzoic acid 0.2g, phenylalanine 2.0g, proline 2.0g, serine 2.0g, threonine 2.0g, tryptophan 2.0g, tyrosine 2.0g, uracil 2.0g, valine 2.0g.

[0048] SC-URA - Culture medium: Based on SC medium, without the addition of uracil.

[0049] SC-URA - -LEU - Culture medium: Based on SC medium, without the addition of uracil and leucine.

[0050] The above-mentioned culture medium can be supplemented with 18 g / L of agarose to obtain the corresponding solid culture medium.

[0051] The shake-flask fermentation medium used was SC medium, with the glucose concentration adjusted to 40 g / L.

[0052] YPD-5FOA solid medium: YPD solid medium with 0.5 g / L of 5-FOA (5-fluoroorotic acid).

[0053] Shake flask fermentation culture method:

[0054] 1) Streak the SC solid medium plate and incubate at 30°C for 36 hours.

[0055] 2) Seed culture: Add 5 ml of SC liquid culture medium to a 50 ml sterile test tube, scrape the bacterial growth from the plate with a 200 μl yellow pipette tip and mix it into the liquid culture medium. Incubate at 30 °C for 12 h.

[0056] 3) Add 30 ml of SC liquid culture medium to a 100 ml unbaffled shake flask, measure the OD600 of the seed culture, and calculate the inoculation volume in the shake flask. The initial OD600 in the shake flask is 0.1.

[0057] 4) Incubate for 96 hours.

[0058] Test method:

[0059] 1) OD 600 Detection: The fermentation broth was diluted with deionized water and the absorbance was measured using a UV spectrophotometer (600nm) to ensure that the OD value after dilution was within acceptable limits. 600 The range is between 0.2 and 0.8. The measured value multiplied by the dilution factor is the OD.600 .

[0060] 2) Detection of homogentisic acid (HGA): To determine the HGA concentration, the yeast strain was cultured in SC medium, and the supernatant of the fermentation broth was sampled. After centrifugation, 1 mL of the supernatant was collected, mixed with 40 μL of glacial acetic acid, and impurities were removed by passing the mixture through a 0.22 μm aqueous filter membrane using a syringe for HPLC analysis. HGA was detected at 290 nm using an HPLC system (Thermo Fisher Scientific, USA) equipped with a C18-H column (4.6 × 250 mm, 5 µm, Kromasil 100-5-C18(W), Sweden) with a UV / VIS detector. The sample was eluted with 0.01 M KH₂PO₄ solution (A) and methanol (B) at a flow rate of 0.8 mL / min at 40 °C (90% / 10%).

[0061] Yarrowia lipolytica ( Yarrowia lipolytica Po1f, purchased from the American Culture Collection, catalog number ATCCMYA-2613.

[0062] Example 1

[0063] 1) Using Yersinia lipophila ATCC MYA-2613 as the starting strain, the gene PpHPD (as shown in SEQ ID NO.1), which is derived from Pseudomonas putida KT2440 and has undergone codon optimization, was integrated at the ku70 site to obtain strain ATCC MYA-2613ΔKu70::PpHPD-URA, named XHYL01.

[0064] The gene PpHPD, encoding 4-hydroxyphenylpyruvate dioxygenase, derived from Pseudomonas putida KT2440 and codon-optimized, was integrated at the ku70 site using homologous recombination. The specific method is as follows:

[0065] (1) Using the genomic DNA of Yersinia lipophila ATCC MYA-2613 as a template, the ku70-up fragment was amplified using primers ku70-up-F / ku70-up-R (as shown in SEQ ID NO.2) to obtain the ku70-up fragment; the ku70-down fragment was amplified using primers ku70-down-F / ku70-down-R (as shown in SEQ ID NO.3) to obtain the ku70-down fragment; that is, the upstream and downstream homologous arms of the ku70 site were obtained.

[0066] The primer sequences are as follows:

[0067] ku70-up-F:gaatgc ggcgataccaggagacaccttgtag ;SEQ ID NO.4.

[0068] ku70-up-R: gagagtgagtgaattg gttcgtggttcgtgtttcgtgttcgt ;SEQ ID NO.5.

[0069] ku70-down-F: ctacggctac ctgctgcttccaaacgatatgaggatgagt ;SEQ ID NO.6.

[0070] ku70-down-R: cgcgaatgc ccaccactagccactactttcgcc ;SEQ ID NO.7.

[0071] Gene amplification system: Primestar Max (Takara) 25 μL, forward and reverse primers 2 μL each, template 1 μL, ddH2O 20 μL.

[0072] Gene amplification program: 98 ℃ pre-denaturation for 3 minutes; 98 ℃ denaturation for 10 seconds, 57 ℃ annealing for 30 seconds, 72 ℃ extension for 10 s / kb, 35 cycles; 72 ℃ extension for 10 minutes.

[0073] The PCR products were subjected to agarose gel electrophoresis and product recovery to obtain the gene fragments ku70-up and ku70-down.

[0074] (2) The screening marker used for homologous recombination is 3HA-URA-3HA: Using the 3HA-URA-3HA gene sequence synthesized by BGI (as shown in SEQ ID NO.8) as a template, 3HA-URA-3HA was amplified using primers ku70-URA-F / ku70-URA-R to obtain the screening marker 3HA-URA-3HA fragment 1 of the integration plasmid.

[0075] The primer sequences are as follows:

[0076] ku70-URA-F:ggcaaatg gttgtaaaacgacggccagtcgaacc ;SEQ ID NO.9.

[0077] ku70-URA-R:gaagcagcag gtagccgtaggtctcgtactgcttgac ; SEQ ID NO.10.

[0078] (3) The plasmid vector p-Amp synthesized by BGI Genomics was amplified using ku70-VEC-F / ku70-VEC-R (as shown in SEQ ID NO.11) to obtain the p-Amp vector fragment.

[0079] The primer sequences are as follows:

[0080] ku70-VEC-F: ctagtggtgg gcattcgcggccgcatttaaatcc ; SEQ ID NO.12.

[0081] ku70-VEC-R: ctcctggtatcgcc gcattcgcggccgcaaatttaaataaaatg ; SEQ ID NO.13.

[0082] (4) Using the PpHPD gene synthesized by BGI (as shown in SEQ ID NO.1) as a template, the PpHPD gene was amplified using primers HPD-F / HPD-R to obtain the PpHPD gene fragment.

[0083] The primer sequences are as follows:

[0084] HPD-F: gtactaaccgcag gccgacatcttcgagaaccccat ; SEQ ID NO.14.

[0085] HPD-R: tagc ttaatcagtagacagcacgcctcgtc ; SEQ ID NO.15.

[0086] (5) Using the TEFin promoter synthesized by BGI (as shown in SEQ ID NO.16) as a template, the TEFin promoter was amplified using primers TEFin-F / TEFin-R to obtain TEFin promoter fragment 1. It should be noted that when constructing a gene expression cassette using the TEFin promoter, the starting atg in the gene sequence needs to be deleted because the promoter already has the function of initiating gene expression. All plasmids constructed in this invention adopt this strategy, which will not be elaborated further below.

[0087] The primer sequences are as follows:

[0088] TEFin-F1: ccacgaac caattcactcactctcccgactatcc ; SEQ ID NO.17.

[0089] TEFin-R1: tgtcggc ctgcggttagtactgcaaaaagtgctg ; SEQ ID NO.18.

[0090] (6) Using the Lip2 terminator synthesized by BGI (as shown in SEQ ID NO.19) as a template, the Lip2 terminator was amplified using primers Lip2-F1 / Lip2-R1 to obtain Lip2 terminator fragment 1.

[0091] The primer sequences are as follows:

[0092] Lip2-F1: cgtgctgtctactgattaa gctatttatcactctttacaacttctacctcaactatc ;SEQ ID NO.20.

[0093] Lip1-R1:cgtcgttttacaac catttgccattcgtaacgctggtag ; SEQ ID NO.21.

[0094] (7) Add the amplified products to the PCR tube: 1 μL ku70-up fragment, 1 μL ku70-down fragment, 3 μL 3HA-URA-3HA fragment 1, 1 μL p-Amp vector fragment, 2 μL PpHPD gene fragment, 1 μL TEFin promoter fragment 1, 1 μL Lip2 terminator fragment 1 and 10 μL Gibson ligase. The ligation temperature is 50 ℃ and the ligation time is 15 min. The total volume is 20 μL.

[0095] All 20 μl of the Gibson connection's total system were converted to... E.coli Trans10 commercial competent cells (Beijing TransGen Biotech Co., Ltd.) were cultured. The transformation process was strictly performed according to the instructions: after incubation at 37 ℃ for 1 h, the cells were plated onto LB agar plates (containing 100 μg / mL ampicillin), and then incubated at 37 ℃ for another 12 h. 10-20 single colonies were selected for colony PCR amplification and DNA sequencing verification. The primers for colony PCR amplification and DNA sequencing were ku70id-F / hpdid-R and hpdid-F / ku70id-R.

[0096] The primer sequences are as follows:

[0097] ku70id-F: gtacatgaggaagagcacgtcaagc; SEQ ID NO. 22.

[0098] hpdid-R:ccctcgccgttgaattgcatc; SEQ ID NO. 23.

[0099] hpdid-F:gatgcaattcaacggcgaggg; SEQ ID NO. 24.

[0100] ku70id-R: caccaaaccatgatgttgcttggac; SEQ ID NO. 25.

[0101] A single colony was selected and named *Escherichia coli* HEC001, with the plasmid named pAmp-ku70-PpHPD. After amplification, plasmid extraction was performed to obtain the pAmp-ku70-PpHPD plasmid. Using the pAmp-ku70-PpHPD plasmid as a template, and with ku70 linearization-F / R as primers, the linearized integration fragment ku70up-TEFin-PpHPD-Lip2-3HA-URA-3HA-Ku70down was amplified.

[0102] The primer sequences are as follows:

[0103] ku70 linearization-F: ggcgataccaggagacaccttgtag; SEQ ID NO.26.

[0104] ku70 linearization-R: ccaccactagccactactttcgcc; SEQ ID NO.27.

[0105] The linearized integrated fragment ku70up-TEFin-PpHPD-Lip2-3HA-URA-3HA-ku70down was transformed into the strain Yersinia lipophila ATCC MYA-2613 using a chemical transformation method.

[0106] The transformation method for Yersinia lipophila ATCC MYA-2613 is as follows:

[0107] Transformation using the Frozen-EZ Yeast Transformation II Kit:

[0108] Pick bacteria from the plate and transfer them to 10 mL of YPD medium. Incubate overnight until OD. 600 =0.5-0.7 (not too high), each competent cell requires 500µL of bacterial culture. Taking 1mL as an example, prepare two competent cells, the steps are as follows:

[0109] ① Take 1 mL of bacterial culture, centrifuge at 5000 rpm for 3 min, and discard the supernatant (try to remove as much as possible).

[0110] ② Add an equal volume (1 mL) of Buffer S1 and mix well. Centrifuge at 5000 rpm for 3 min and discard the supernatant.

[0111] ③ Add 100µL of Buffer S2 to each 1mL of bacterial culture, mix gently, and dispense into two clean centrifuge tubes (50µL each). The mixture can be used immediately or frozen to -80℃ for later use.

[0112] ④ Add plasmids or linearized DNA fragments to competent cells (the added volume should be less than 5µL, and the amount of DNA added should be about 1µg).

[0113] ⑤ Add 500µL of Buffer S3 to each competent cell and incubate at 30℃ for 1 hour. For plating, coat each competent cell onto two plates, directly coating 250µL onto each plate. The plates used for coating are SC-URA. - .

[0114] The experiment was validated after incubation at 30°C for 36 hours.

[0115] For the gene-integrated strain, several single colonies grown on the above plates should be selected and the PpHPD gene integration should be verified using the verification primers ku70 linearization-F / ku70 linearization-R. If the corresponding band can be amplified, it proves that the integration was successful.

[0116] The verified strain was inoculated into YPD medium and cultured for 12 h. The glycerol tube was then stored to obtain strain ATCC MYA-2613ΔKu70::PpHPD-URA, which was named XHYL01.

[0117] The strain XHYL01 was fermented in SC medium in shake flasks for 96 h, and the HGA was measured. The results are as follows: OD600 was 22.34, and the HGA yield was 3.62 mg / L.

[0118] (8) The strain ATCC MYA-2613ΔKu70::PpHPD-URA was recovered and screened. - :

[0119] Strain XHYL01 was inoculated into YPD medium and cultured for 12 h. After the bacterial culture became turbid, it was spread onto YPD-5FOA solid medium. Since strains containing uracil could not survive on YPD-5FOA solid medium, the colonies that grew on YPD-5FOA solid medium were those of the URA-deficient strain ATCC MYA-2613ΔKu70-PpHPD-URA. - It was named XHYL02.

[0120] 2) Enhance the shikimic acid pathway

[0121] Based on strain XHYL02, the shikimic acid pathway was enhanced. Related genes for the shikimic acid pathway included overexpression of ylARO1 (as shown in SEQ ID NO. 28), a gene encoding a pentafunctional aromatic amino acid synthase complex derived from *Yersinia lipolytica* ATCC MYA-2613; overexpression of ylARO2 (as shown in SEQ ID NO. 29), a gene encoding chorimate synthase derived from *Yersinia lipolytica* ATCC MYA-2613; and overexpression of genes from *Saccharomyces cerevisiae* (…). Saccharomy cerevisiae The gene scARO4, which encodes 3-deoxy-D-arabinoheptonate-7-phosphate synthase and has a leucine-lysine mutation at position 229, is BY4741. K229L (As shown in SEQ ID NO.30) and the gene ylARO7, which expresses the gene encoding shikimate mutase derived from Yersinia lipolytica ATCC MYA-2613, with amino acid position 139 mutated from glycine to threonine. G139S (As shown in SEQ ID NO.31).

[0122] To integrate the above four genes into strain XHYL02, the plasmid pintB1-ylARO1-ylARO2-scARO4 needs to be constructed. K229L -ylARO7 G139S To construct this plasmid, you first need to construct the plasmid pintB1-scARO4. K229L -ylARO7 G139S The corresponding strain was named *Escherichia coli* HEC002; based on *Escherichia coli* HEC002, pintB1-ylARO1-ylARO2-scARO4 was constructed. K229L -ylARO7 G139S The corresponding strain was named Escherichia coli HEC003.

[0123] (1) Construction of strain HEC002

[0124] plasmid pintB1-scARO4 K229L -ylARO7 G139S The carrier skeleton is pintB1-TEFin-scARO4 K229L -xpr2-EXP-ylARO7 G139S -lip2-3HA-URA-3HA.

[0125] The construction method is as follows:

[0126] Using the plasmid backbone p-intB1vec synthesized by BGI Genomics (as shown in SEQ ID NO.32) as a template, which contains the p-Amp-intB1up-intB1down fragment, the plasmid backbone p-intB1vec fragment was obtained by amplification using primers intB1vec-F / R.

[0127] The primer sequences are:

[0128] intB1vec-F:gagacctacggctac gtgaacttcttatgggaagtcaagttgagattgtg ; SEQ ID NO.33.

[0129] intB1vec-R: gagtgagtgaattg acctgctcctgcacctaagttcgt ;SEQ ID NO.34.

[0130] Using the plasmid pAmp-ku70-PpHPD of HEC001 as an amplification template, the TEFin promoter (as shown in SEQ ID NO.16) was amplified using primers TEFin-F2 / TEFin-R2 to obtain TEFin promoter fragment 2.

[0131] The primer sequences are as follows:

[0132] TEFin-F2: aggagcaggt caattcactcactctcccgactatccaacaacg ; SEQ ID NO.35.

[0133] TEFin-R2: ggagattcact ctgcggttagtactgcaaaaagtgctgg ; SEQ ID NO.36.

[0134] Using the genome of ATCC MYA-2613 as an amplification template, the xpr2 terminator (as shown in SEQ ID NO.37) was amplified using primers xpr-F1 / xpr-R1 to obtain xpr2 fragment 1.

[0135] The primer sequences are as follows:

[0136] xpr-F1: caagaaatag gatccaactacggaacttgtgttgatgtctttg ; SEQ ID NO.38.

[0137] xpr-R1: ccaaactc gacacgggcatctcacttgcatatg ; SEQ ID NO.39.

[0138] Using the genome of ATCC MYA-2613 as an amplification template, the EXP promoter (as shown in SEQ ID NO.40) was amplified using primers EXP-F1 / EXP-R1 to obtain EXP promoter fragment 1.

[0139] The primer sequences are as follows:

[0140] EXP-F1: gatgcccgtgtc gagtttggcgcccgttttttcg ; SEQ ID NO.41.

[0141] EXP-R1: ctttagtgaagtccat tgctgtagatatgtcttgtgtgtaaggggg ; SEQ ID NO.42.

[0142] Using the HEC001 plasmid pAmp-ku70-PpHPD as an amplification template, the lip2-3HA-URA-3HA fragment 1 was amplified using primers lip2-F2 / 3HAURA-R2 to obtain the lip2-3HA-URA-3HA fragment 1.

[0143] lip2-F2: gcggttggagtag gctatttatcactctttacaacttctacctcaactatc ;SEQ ID NO.43.

[0144] 3HAURA-R2:gaagttcac gtagccgtaggtctcgtactgcttgac ;SEQ ID NO.44.

[0145] ylARO7 synthesized by BGI G139S Using the gene (as shown in SEQ ID NO.31) as a template, primer ylARO7 was used. G139S -F / ylARO7 G139S -R amplifies ylARO7 G139S Gene, obtain ylARO7 G139S Gene fragments.

[0146] The primer sequences are as follows:

[0147] ylARO7 G139S -F: ctacagca atggacttcactaaagccgacaccgttctg ; SEQ ID NO.45.

[0148] ylARO7 G139S -R:tgataaatagc ctactccaaccgccggagcag ; SEQ ID NO.46.

[0149] scARO4 synthesized by BGI K229L Using the gene (as shown in SEQ ID NO.30) as a template, primer scARO4 was used. K229L-F / scARO4 K229L -R amplifies scARO4 K229L Gene, obtain scARO4 K229L Gene fragments.

[0150] scARO4 K229L -F: ctaaccgcag agtgaatctccaatgttcgctgccaac ;SEQ ID NO.47.

[0151] scARO4 K229L -R:ccgtagttggatc ctatttcttgttaacttctcttctttgtctgacagc ;SEQ ID NO.48.

[0152] The gene amplification system and gene amplification procedure are the same as above.

[0153] Add 1 μL p-intB1vec fragment, 1 μL TEFin promoter fragment 2, 1 μL xpr2 fragment 1, 1 μL EXP promoter fragment 1, 2 μL lip2-3HA-URA-3HA fragment 1, and 2 μL scARO4 to a PCR tube. K229L Gene fragment, 2 μLylARO7 G139S Gene fragments and 10 μl of Gibson ligase were ligated at 50 ℃ for 15 min, with a total volume of 20 μL. All 20 μl of the Gibson ligation volume was transformed into [a specific enzyme / technology]. E.coli Trans10 commercial competent cells (Beijing TransGen Biotech Co., Ltd.) were cultured. After incubation at 37 ℃ for 1 h, the cells were plated onto LB agar plates (containing 100 μg / mL ampicillin).

[0154] The primers for colony PCR amplification and DNA sequencing were scARO4. K229L -F / ylARO7 G139S -R indicates that a PCR result of a 3399bp band is correct.

[0155] Select a correct single colony and name it *Escherichia coli* HEC002, and name the plasmid pintB1-scARO4. K229L -ylARO7 G139S After propagation and plasmid extraction, pintB1-scARO4 was obtained. K229L -ylARO7 G139S Plasmid.

[0156] (2) Construction of plasmid pintB1-ylARO1-ylARO2-scARO4 K229L -ylARO7 G139S and strain HEC003

[0157] The construction method is as follows:

[0158] Using the HEC002 strain plasmid pintB1-scARO4 K229L -ylARO7 G139S Using the template, amplification was performed using primers intB1-F / R to obtain the plasmid backbone pintB1-scARO4. K229L -ylARO7 G139S Excerpt.

[0159] intB1-F:gaatggcaaatg gagtttggcgcccgttttttcg ;SEQ ID NO.49.

[0160] intB1-R:agtgaattgg acacgggcatctcacttgcatatg ; SEQ ID NO.50.

[0161] Using the HEC002 strain plasmid pintB1-scARO4 K229L -ylARO7 G139S As an amplification template, the TEFin promoter (as shown in SEQ ID NO.16) was amplified using primers TEFin-F3 / TEFin-R3 to obtain TEFin promoter fragment 3.

[0162] The primer sequences are as follows:

[0163] TEFin-F3: atgcccgtgtc caattcactcactctcccgactatccaacaacg ; SEQ ID NO.51.

[0164] TEFin-R3: cctcggcaaa ctgcggttagtactgcaaaaagtgctgg ; SEQ ID NO.52.

[0165] Using HEC002 plasmid pintB1-scARO4 K229L -ylARO7 G139S Using the primers xpr-F2 / EXP-R2 as the amplification template, xpr2-EXP was amplified to obtain xpr2-EXP fragment 1.

[0166] The primer sequences are as follows:

[0167] xpr-F2: tggtaactaa gatccaactacggaacttgtgttgatgtctttgc ; SEQ ID NO.53.

[0168] EXP-R2: ccgaaagtgctcat tgctgtagatatgtcttgtgtgtaagggggt ;SEQ ID NO.54.

[0169] Using the HEC001 plasmid pAmp-ku70-PpHPD as an amplification template, the lip2 terminator (as shown in SEQ ID NO.19) was amplified using primers lip2-F3 / lip2-R3 to obtain lip2 terminator fragment 2.

[0170] lip2-F3:gtcctttttctaa gctatttatcactctttacaacttctacctcaactatc ;SEQ ID NO.55.

[0171] lip2-R3: cgaaaaaacgggcgccaaactc catttgccattcgtaacgctggtag ; SEQ ID NO.56.

[0172] Using the ylARO1 gene synthesized by BGI (as shown in SEQ ID NO.28) as a template, the ylARO1 gene was amplified using primers ylARO1-F / ylARO1-R to obtain the ylARO1 gene fragment.

[0173] The primer sequences are as follows:

[0174] ylARO1-F: ctaaccgcag tttgccgagggtcagatccaaaagg ; SEQ ID NO.57.

[0175] ylARO1-R: tccgtagttggatc ttagttaccaagaacagccttctctccaacct ; SEQ ID NO.58.

[0176] Using the ylARO2 gene synthesized by BGI (as shown in SEQ ID NO.29) as a template, the ylARO2 gene was amplified using primers ylARO2-F / ylARO2-R to obtain the ylARO2 gene fragment.

[0177] ylARO2-F: tctacagca atgagcactttcggcacgct ; SEQ ID NO.59.

[0178] ylARO2-R:gtgataaatagc ttagaaaaaggactttgcgccctttct ; SEQ ID NO.60.

[0179] The gene amplification system and gene amplification procedure are the same as above.

[0180] Add 2 μL of pintB1-scARO4 to the PCR tube K229L -ylARO7 G139SThe following components were used: 1 μL TEFin promoter fragment 3, 2 μL xpr2-EXP fragment 1, 1 μL lip2 terminator fragment 2, 2 μL ylARO1 gene fragment, 2 μL ylARO2 gene fragment, and 10 μL Gibson ligase. The ligation temperature was 50 ℃, and the ligation time was 15 min. The total volume was 20 μL. The transformation method was the same as above. After incubation at 37 ℃ for 1 h, the mixture was plated onto LB agar plates (containing 100 μg / mL ampicillin).

[0181] The primers for colony PCR amplification and DNA sequencing are ylARO2id-F / URAid-R. If a band of 3020 bp is obtained by PCR, it is correct.

[0182] The primer sequences are as follows:

[0183] ylARO2id-F: gagtttggttctggctttgccg; SEQ ID NO. 61.

[0184] URAid-R: taggcgtcaagtgaatgttgcag; SEQ ID NO. 62.

[0185] Select a correct single colony and name it *Escherichia coli* HEC003, and name the plasmid pintB1-ylARO1-ylARO2-scARO4. K229L -ylARO7 G139S After propagation and plasmid extraction, pintB1-ylARO1-ylARO2-scARO4 was obtained. K229L -ylARO7 G139S Plasmid.

[0186] Because NotI restriction sites (GCGGCCGC) are located upstream of intB1up and downstream of intB1down, NotI-HF is used. ® For HEC003 plasmid pintB1-ylARO1-ylARO2-scARO4 K229L -ylARO7 G139S Enzyme digestion, NotI-HF ® Purchased from NEB (New England Biolabs).

[0187] Enzyme digestion system: 44 μL plasmid, 5 μL rCutSmart buffer, 1 μL NotI enzyme, incubated at 37°C for 15 min.

[0188] NotI was used to target the plasmid pintB1-ylARO1-ylARO2-scARO4K229L -ylARO7 G139S Enzyme digestion yielded a large fragment of 15605 bp and a fragment of 2816 bp. The 15605 bp fragment was recovered. The resulting fragment is: intB1up-TEFin-scARO4. K229L -xpr2-TEFin-ylARO1-xpr2-EXP-ylARO2- lip2-EXP-ylARO7 G139S -lip2-3HA-URA-3HA-intB1down.

[0189] Starting with strain XHYL02, the fragment was transformed into XHYL02 to obtain strain ATCC MYA-2613ΔKu70 ::PpHPD-intB1::(ylARO1-ylARO2-scARO4) K229L -ylARO7 G139S )-URA, named XHYL03.

[0190] The conversion method is the same as above.

[0191] The strain XHYL03 was fermented in SC medium for 96 h, and the HGA was measured. The results are as follows: OD600 was 16.78, and the HGA yield was 484.41 mg / L.

[0192] The strain ATCC MYA-2613ΔKu70 ::PpHPD-intB1::(ylARO1-ylARO2-scARO4) was recovered and screened. K229L -ylARO7 G139S )-URA - It was named XHYL04.

[0193] The method for recycling the screening markers is the same as above.

[0194] 3) Integrate the three copies of tHMGR and replenish LEU2.

[0195] (1) Based on strain XHYL04, two copies of tHMGR were integrated into the intE1 site.

[0196] The gene encoding hydroxymethylglutaryl-CoA (HMG-CoA) reductase is derived from Yersinia lipolytica. Yarrowia lipolytica The gene tHMGR (as shown in SEQ ID NO.63) of ATCC MYA-2613 encodes hydroxymethylglutaryl-CoA reductase and has the first 500 amino acids deleted from the N-terminus.

[0197] To integrate the tHMGR gene into strain XHYL04, the plasmid pintE1-tHMGR-tHMGR needs to be constructed, with the vector backbone being pintE1-TEFin-tHMGR-xpr2-EXP-tHMGR-lip2-3HA-URA-3HA.

[0198] The construction method is as follows:

[0199] Using the plasmid p-intE1vec synthesized by BGI Genomics (as shown in SEQ ID NO.64) as the amplification template, the plasmid backbone p-intE1vec was amplified, and the amplification primers were intE1vec-F / R.

[0200] The primer sequences are as follows:

[0201] intE1vec-F:ctacggctac ccgagcgtcgacaagcatacagc ;SEQ ID NO.65.

[0202] intE1vec-R:gtgagtgaattg agcactatcctctgctgcgtc ; SEQ ID NO.66.

[0203] Using the plasmid pintB1-scARO4 of strain HEC002 K229L -ylARO7 G139S Using the TEFin promoter as the amplification template, primers TEFin-F4 / TEFin-R4 were used to amplify the TEFin promoter (as shown in SEQ ID NO.16) to obtain TEFin promoter fragment 4.

[0204] TEFin-F4:gatagtgct caattcactcactctcccgactatcc ; SEQ ID NO.67.

[0205] TEFin-R4: cagactgggt ctgcggttagtactgcaaaaagtgctgg ; SEQ ID NO.68.

[0206] Using HEC002 plasmid pintB1-scARO4 K229L -ylARO7 G139S As the amplification template, xpr2-EXP was amplified using primers xprEXP-F2 / xprEXP-R2 to obtain xpr2-EXP fragment 2.

[0207] xprEXP-F2: acggtcataa gatccaactacggaacttgtgttgatgtctttgc ; SEQ ID NO.69.

[0208] xprEXP-R2: agactgggtcat tgctgtagatatgtcttgtgtgtaaggggg ;SEQ ID NO.70.

[0209] Using HEC002 plasmid pintB1-scARO4 K229L -ylARO7 G139S Using the lip2URA-F2 / lip2URA-R2 primers, the lip2 terminator (as shown in SEQ ID NO.19) and 3HA-URA-3HA (as shown in SEQ ID NO.8) were amplified to obtain lip2-3HA-URA-3HA fragment 2.

[0210] lip2URA-F2:cgaatatttgcatacggtcataa gctatttatcactctttacaacttctacctcaac tatc ;SEQ ID NO.71.

[0211] lip2URA-R2: gacgctcgg gtagccgtaggtctcgtactgcttgac ; SEQ ID NO.72.

[0212] Using the genome of Yersinia lipolyticis ATCC MYA-2613 as a template, the tHMGR gene was amplified using primers tHMGR-F1 / tHMGR-R1 (as shown in SEQ ID NO.63) to obtain tHMGR gene fragment 1.

[0213] tHMGR-F1: ctaaccgcag acccagtctgtgaaggtggttgagaag ; SEQ ID NO.73.

[0214] tHMGR-R1: ccgtagttggatc ttatgaccgtatgcaaatattcgaaccgttttgtaga ;SEQ ID NO.74.

[0215] The tHMGR gene was amplified using tHMGR-F2 / tHMGR-R2 (as shown in SEQ ID NO.63) to obtain tHMGR gene fragment 2.

[0216] tHMGR-F2: ctacagca atgacccagtctgtgaaggtggttgag ;SEQ ID NO.75.

[0217] tHMGR-R2: gc ttatgaccgtatgcaaatattcgaaccgttttgtaga ; SEQ ID NO.76.

[0218] The gene amplification system and gene amplification procedure are the same as above.

[0219] Add 2 μL of plasmid backbone p-intE1vec, 1 μL of TEFin promoter fragment 4, 2 μL of tHMGR gene fragment 1, 1 μL of xpr2-EXP fragment 2, 2 μL of tHMGR gene fragment 2, 2 μL of lip2-3HA-URA-3HA fragment 2 and 10 μL of Gibson ligase to a PCR tube. The ligation temperature is 50 ℃ and the ligation time is 15 min. The total volume is 20 μL. The transformation method is the same as above. After incubation at 37 ℃ for 1 h, the mixture is plated onto LB agar plates (containing 100 μg / mL ampicillin).

[0220] The primers for colony PCR amplification and DNA sequencing are intE1upid-F / xpr2-R. If a band of 2633 bp is obtained by PCR, it is correct.

[0221] The primer sequences are as follows:

[0222] intE1upid-F: cgctgttcacttgcaacagaagg; SEQ ID NO. 77.

[0223] xpr2-R: acctcgtcattgatggacagg; SEQ ID NO. 78.

[0224] Select a correct single colony and name it Escherichia coli HEC004. Name the plasmid pinE1-tHMGR-tHMGR. After propagation, extract the plasmid to obtain the pinE1-tHMGR-tHMGR plasmid.

[0225] Because two NotI restriction sites (GCGGCCGC) are set on the plasmid pinE1-tHMGR-tHMGR of HEC004, NotI-HF is used. ® Plasmid HEC004 was digested with enzymes using the same enzyme digestion system as above.

[0226] The plasmid pinE1-tHMGR-tHMGR of HEC004 was digested with NotI, yielding a large fragment of 8595 bp and a fragment of 2824 bp. The 8595 bp fragment was recovered. The resulting fragment is: intE1up-TEFin-tHMGR-xpr2-EXP-tHMGR-lip2-3HA-URA-3HA-intE1down.

[0227] Starting with strain XHYL04, the linearized integrated fragment was transformed into XHYL04 to obtain strain ATCCMYA-2613ΔKu70::PpHPD-intB1::(ylARO1-ylARO2-scARO4). K229L -ylARO7G139S )- intE1::(tHMGR-tHMGR)-URA, named XHYL05.

[0228] The conversion method is the same as above.

[0229] The strain ATCC MYA-2613ΔKu70::PpHPD-intB1::(ylARO1-ylARO2-scARO4) was recovered and screened to obtain the marker. K229L -ylARO7 G139S )- intE1::(tHMGR-tHMGR)-URA - It was named XHYL06.

[0230] The method for recycling the screening markers is the same as above.

[0231] (2) In order to integrate the third copy of tHMGR and to compensate for the leucine deficiency of the strain, tHMGR and LEU2 were integrated into the intD1 site using strain XHYL06 as the starting strain.

[0232] To integrate the above genes into strain XHYL06, the plasmid pintD1-tHMGR-LEU2 needs to be constructed, with the vector backbone being pintD1-TEFin-tHMGR-lip2-PLEU2-LEU2-xpr2-3HA-URA-3HA.

[0233] The construction method is as follows:

[0234] Using the plasmid p-inD1vec synthesized by BGI Genomics (as shown in SEQ ID NO.79) as the amplification template, the plasmid backbone p-inD1vec was amplified, and the amplification primers were intD1vec-F / R.

[0235] The primer sequences are as follows:

[0236] intD1vec-F:acctacggctac cggttcattctagcacatgtgccatgt ; SEQ ID NO.80.

[0237] intD1vec-R:gtgagtgaattg ccttgtcgagacgctaacagacacatgc ; SEQ ID NO.81.

[0238] Using the HEC004 strain plasmid pinE1-tHMGR-tHMGR as an amplification template, the TEFin-tHMGR fragment was amplified using primers TEFin-F5 / tHMGR-R5.

[0239] The primer sequences are as follows:

[0240] TEFin-F5: ctcgacaagg caattcactcactctcccgactatccaacaac ; SEQ ID NO.82.

[0241] tHMGR-R5: gc ttatgaccgtatgcaaatattcgaaccgttttgtagacg ; SEQ ID NO.83.

[0242] Using the HEC004 plasmid pinE1-tHMGR-tHMGR as an amplification template, the Lip2 terminator (as shown in SEQ ID NO.19) was amplified using primers lip2-F5 / lip2-R5 to obtain lip2 fragment 3.

[0243] The primer sequences are as follows:

[0244] lip2-F5:cgaatatttgcatacggtcataa gctatttatcactctttacaacttctacctcaacta tc ; SEQ ID NO.84.

[0245] lip2-R5: caccatagg catttgccattcgtaacgctggtagacagg ; SEQ ID NO.85.

[0246] Using the HEC004 plasmid pinE1-tHMGR-tHMGR as an amplification template, the 3HA-URA-3HA fragment (as shown in SEQ ID NO.8) was amplified using primers 3HAURA-F2 / 3HAURA-R2 to obtain fragment 2 of 3HA-URA-3HA.

[0247] The primer sequences are as follows:

[0248] 3HAURA-F2: atgcccgtgtc gttgtaaaacgacggccagtcgaacc ; SEQ ID NO.86.

[0249] 3HAURA-R2: tagaatgaaccg gtagccgtaggtctcgtactgcttgac ; SEQ ID NO.87.

[0250] Using the PLEU2-LEU2-xpr2 sequence synthesized by BGI Genomics (as shown in SEQ ID NO.88) as an amplification template, the PLEU2-LEU2-xpr2 fragment was amplified, and the amplification primers were LEU2-F / LEU2-R.

[0251] In SEQ ID NO.88, 1191-2327bp is the sequence of the LEU2 gene.

[0252] The primer sequences are as follows:

[0253] LEU2-F: cgaatggcaaatg cctatggtgcttatctgggcatggacac ; SEQ ID NO.89.

[0254] LEU2-R: cgttttacaac gacacgggcatctcacttgcatatg ; SEQ ID NO.90.

[0255] The gene amplification system and gene amplification procedure are the same as above.

[0256] Add 2 μL of plasmid backbone p-inD1vec fragment, 2 μL of TEFin-tHMGR fragment, 2 μL of lip2 fragment 3, 2 μL of PLEU2-LEU2-xpr2 fragment, 2 μL of 3HA-URA-3HA fragment 2 and 10 μL of Gibson ligase to a PCR tube. The ligation temperature is 50 ℃ and the ligation time is 15 min. The total volume is 20 μL. The transformation method is the same as above. After incubation at 37 ℃ for 1 h, the mixture is plated onto LB agar plates (containing 100 μg / mL ampicillin).

[0257] The primers for colony PCR amplification and DNA sequencing are tHMGRid-F / URAid-R. If a band of 3844bp is obtained by PCR, it is correct.

[0258] The primer sequences are as follows:

[0259] tHMGRid-F: ctgcatcacgctgatgagcaac; SEQ ID NO. 91.

[0260] URAid-R: taggcgtcaagtgaatgttgcag; SEQ ID NO.92.

[0261] Select a correct single colony and name it Escherichia coli HEC005. Name the plasmid PintD1-tHMGR-LEU2. After propagation, extract the plasmid to obtain PintD1-tHMGR-LEU2 plasmid.

[0262] Using plasmid PintD1-tHMGR-LEU2 of strain HEC005 as a template, the linearized integration fragment intD1up-TEFin-tHMGR-lip2-PLEU2-LEU2-xpr2-3HA-URA-3HA-intD1down was amplified using intD1 linearization-F / R primers.

[0263] The primer sequences are as follows:

[0264] intD1 linearization-F: ccggacatgtgttctccgaattactaaatgag; SEQ ID NO.93.

[0265] intD1 linearization-R: gactttgtccatggcacacttgcc; SEQ ID NO.94.

[0266] Starting with strain XHYL06, the linearized integrated fragment was transformed into XHYL06 to obtain strain ATCCMYA-2613ΔKu70::PpHPD-intB1::(ylARO1-ylARO2-scARO4). K229L -ylARO7 G139S )- intE1::(tHMGR-tHMGR)-intD1::(tHMGR-LEU2)-URA, named XHYL07.

[0267] The conversion method is the same as above.

[0268] The urinary saccharide content of strain XHYL07 was determined after fermentation in SC medium for 96 h. The results showed that after 96 h of fermentation, the OD600 of strain XHYL07 was 16.25 and the urinary saccharide content was 1.76 g / L.

[0269] Example 2: Scale-up and optimization of a 2L fermenter

[0270] The gene-integrated strain XHYL07 was scaled up and cultured in a 2L fermenter. The fermentation method is as follows:

[0271] 1) Seed culture:

[0272] (1) Streak the SC solid medium plate and incubate at 30°C for 36 h.

[0273] (2) Add 5 ml of SC liquid culture medium to a 50 ml sterile test tube, scrape the bacterial growth from the plate with a 200 μl yellow pipette tip and mix it into the liquid culture medium, and incubate at 30 °C for 12 h.

[0274] (3) Add 50ml of SC liquid culture medium to a 250ml baffle-free shaker flask, add 1ml of seed culture from a test tube, and incubate for 24h.

[0275] 2) Scale-up culture in a 2L fermenter:

[0276] The initial fermentation volume was 1L, which contained 3.5 g / L Yeast Nitrogen base (YNB), 1.5 g / L yeast extract, 13 g / L ammonium sulfate, and 80 g / L glucose. The OD600 in the fermenter was 0.8 after inoculation with the seed culture.

[0277] During fermentation, the rotation speed was 600 rpm, the aeration rate was 1.5 vvm, and the pH was set to 5.00 (with a 5 mol / L potassium hydroxide feed bottle connected to the alkali feed pump).

[0278] Starting from 0h, glucose concentration was measured every 12h. Feeding was initiated when the initial glucose concentration in the fermentation medium reached 15g / L, maintaining a glucose concentration of 5-15g / L during feeding. 10ml of fermentation broth was transferred to a 15ml centrifuge tube and centrifuged at 12000rpm for 10min. The supernatant was diluted 10-fold for glucose detection. The glucose detection method was as follows: the eluent was 5mM dilute sulfuric acid; the detection equipment was a Thermo Fisher Scientific liquid chromatography system; the column was a BIO-RAD organic acid column; the elution rate was 0.6mL / min; and the column temperature was 60℃.

[0279] Starting from 0h, samples were taken every 12h to determine the concentration of homogentisic acid. 10ml of fermentation broth was transferred to a 15ml centrifuge tube and centrifuged at 12000rpm for 10min. The upper aqueous phase was then diluted 100-fold. 1ml of the diluted supernatant was mixed with 40µL of glacial acetic acid and filtered through a 0.22µm aqueous filter membrane using a syringe to remove impurities before HPLC analysis. HGA was performed using an HPLC system (Thermo Fisher Scientific, USA) equipped with a C18-H column (4.6×250 mm, 5µm, Kromasil 100-5-C18(W), Sweden) with a UV / VIS detector at 290 nm. Samples were eluted with 0.01 M KH₂PO₄ solution (A) and methanol (B) at a flow rate of 0.8mL / min (90% / 10%) at 40°C.

[0280] The formula for the sugar-fed culture medium is: 3.5 g / L Yeast Nitrogen base (YNB), 1.5 g / L yeast extract, 80 g / L ammonium sulfate, and 600 g / L glucose.

[0281] To prepare 1L of saccharified feed medium, weigh 3.5g of Yeast Nitrogen base (YNB) and 1.5g of yeast extract, add deionized water, and bring to a final volume of 200ml. Sterilize each separately. Weigh 80g of ammonium sulfate, add deionized water, and bring to a final volume of 200ml. Sterilize each separately. Weigh 600g of glucose, add deionized water, and bring to a final volume of 600ml. Sterilize each separately. After sterilization, mix the three separately sterilized liquids to obtain 1L of saccharified feed medium.

[0282] The yield of urinary homogentisic acid is shown in Table 1.

[0283] Table 1

[0284]

[0285] The results in Table 1 show that after 240 hours of fermentation, the uric acid yield of strain XHYL07 reached its highest level at 216 hours, with a yield of 33.71 g / L.

[0286] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A genetically engineered bacterium that produces high levels of hyaluronic acid, characterized in that, Using Yersinia lipophila ATCC MYA-2613 as the starting strain, the ku70 gene was knocked out. The gene encoding 4-hydroxyphenylpyruvate dioxygenase was integrated at the ku70 site; Enhance the shikimic acid pathway: express genes encoding a multi-enzyme complex for the synthesis of five functional aromatic amino acids, genes encoding shikimic acid synthase, genes encoding 3-deoxy-D-arabinohepulose-7-phosphate synthase, and genes encoding shikimic acid mutase; Integration of three copies of tHMGR and leucine deficiency correction: Two copies of the gene encoding hydroxymethylglutaryl-CoA reductase with the N-terminus 500 amino acids removed were integrated into the intE1 site; one copy of the gene encoding hydroxymethylglutaryl-CoA reductase with the N-terminus 500 amino acids removed and the gene encoding leucine synthesis were integrated into the intD1 site. The gene sequence encoding 4-hydroxyphenylpyruvate dioxygenase is shown in SEQ ID NO.1; The gene sequence encoding the five-functional aromatic amino acid synthesis multienzyme complex is shown in SEQ ID NO.28; The gene sequence encoding shikimate synthase is shown in SEQ ID NO.29; The gene sequence encoding 3-deoxy-D-arabinohepenosyl-7-phosphate synthase is shown in SEQ ID NO.30; The gene sequence encoding shikimate mutase is shown in SEQ ID NO.31; The gene sequence encoding hydroxymethylglutaryl-CoA reductase with the N-terminus 500 amino acids removed is shown in SEQ ID NO. 63; The gene sequence encoding leucine synthesis is shown in SEQ ID NO.88, 1191-2327bp.

2. The method for constructing a genetically engineered bacterium producing high levels of hyaluronic acid as described in claim 1, characterized in that, Includes the following steps: Using Yersinia lipophila ATCC MYA-2613 as the starting strain, the ku70 gene was knocked out. Express the gene encoding 4-hydroxyphenylpyruvate dioxygenase; Strengthening the shikimic acid pathway; It integrates three copies of tHMGR and fills in the leucine deficiency.

3. The application of the genetically engineered bacterium with high hydantoin production as described in claim 1 in the production of hydantoin.

4. The application of the genetically engineered bacterium for high purine production as described in claim 1 in increasing purine production.

5. A method for producing homogentisic acid, characterized in that, Fermentation is carried out using the genetically engineered bacteria described in claim 1.

Citation Information

Patent Citations

  • Yarrowia lipolytica strain for synthesizing delta-tocotrienol and application of Yarrowia lipolytica strain

    CN119955754A

  • Genetically engineered bacterium for high-yield production of delta-tocotrienols and application of genetically engineered bacterium

    CN120118767A