Cell model based on palmitic acid-induced hepatic lipid toxicity injury and construction method thereof

Abstract

The invention provides a cell model based on palmitic acid induced hepatic lipid toxicity injury and a construction method thereof, and the construction method comprises the following steps: 1, carrying out cell culture, and culturing a HepG2 human liver cancer cell line to a logarithmic phase; 2, performing cell activity determination and palmitic acid (PA) treatment, and performing induction treatment on the HepG2 cells cultured in the step 1 by adopting PA with different concentrations; detecting the survival condition of the HepG2 cells treated by the PA; 3, observing the morphological change of the cells, and observing the morphological change of the HepG2 cells treated by the PA; 4, measuring ATP in the cells, and detecting the ATP content in the HepG2 cells after PA treatment; 5, measuring the ROS level of cell active oxygen, and detecting the ROS level in the HepG2 cell after PA treatment; and 6, carrying out molecular specific gene combination verification, carrying out cell total RNA extraction and real-time fluorescent quantitative PCR, extracting the total RNA of the HepG2 cell after PA treatment, and carrying out RT-PCR detection to complete the construction of the hepatic lipid toxicity injury cell model.

Description

Technical Field

[0001] This invention belongs to the field of cell model construction technology, and relates to a cell model based on palmitic acid-induced liver lipotoxicity injury and its construction method. Background Technology

[0002] Nonalcoholic fatty liver disease (NAFLD) is a metabolic stress-related liver disease closely associated with insulin resistance and genetic susceptibility. Its spectrum ranges from simple hepatocellular steatosis (simple fatty liver) to nonalcoholic steatohepatitis (NASH), which can progress to liver fibrosis, cirrhosis, and even hepatocellular carcinoma. With the global prevalence of obesity and metabolic syndrome, NAFLD has become a major cause of chronic liver disease, with a prevalence exceeding 30% in my country and showing a trend towards affecting younger people, seriously threatening public health. NASH, as a progressive form of NAFLD, is characterized by pathological changes including hepatocellular steatosis, ballooning degeneration, lobular inflammation, and varying degrees of fibrosis. Currently, there remains a significant unmet clinical need for treatment of NASH, and establishing reliable in vitro lipotoxic cell models is crucial for in-depth research into its molecular mechanisms and screening for potential therapeutic drugs.

[0003] To address the aforementioned issues, this invention proposes a cell model that induces hepatic lipotoxic injury by inducing hepatocyte lipotoxicity using palmitic acid, mimicking key pathological features in the liver of NASH patients. This model not only helps elucidate the specific mechanisms of lipotoxicity but can also be used to evaluate the hepatoprotective effects of drugs or natural active ingredients, providing an experimental basis for developing targeted intervention strategies for NASH. Summary of the Invention

[0004] (a) Technical issues

[0005] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a cell model of hepatic lipotoxic injury induced by palmitic acid and its construction method. This method directly induces HepG2 cells with a concentration gradient of palmitic acid, which can highly reproduce lipid accumulation, lipid droplet formation, and hepatocyte ballooning degeneration in clinical NAFLD / NASH in vitro, providing a reliable platform for studying the continuous process from simple steatosis to lipotoxic injury to fibrosis. This model can be used to evaluate the hepatoprotective effects of drugs or natural active ingredients, providing an experimental basis for developing targeted intervention strategies for NASH.

[0006] (II) Technical Solution

[0007] A cell model of hepatic lipogenic injury induced by palmitic acid and its construction method are presented. This method uses the HepG2 cell line with palmitic acid (PA) as an inducer to construct the model. A closed-loop process is systematically constructed, including cell culture, MTT+trypan blue activity assay, morphological observation, ATP+ROS function assay, and RT-PCR gene assay. This forms a three-dimensional validation system from phenotypic activity + morphology to function, ATP+ROS to specific gene combinations at the molecular level.

[0008] The specific gene combination is: BIP(GRP78) + CHOP + CPT2 + ACSL1 + CRAT + ATF4 + ATF6. CRAT (acetyltransferase) + ACSL1 (lipid metabolism initiation) + CPT2 (fatty acid β-oxidation) is the gene combination for mitochondrial oxidative phosphorylation; downregulation of this gene combination directly reflects mitochondrial lipid metabolism disorders. ATF4 (UPR pathway transcription factor) + CHOP (ER stress apoptosis effector molecule) + BIP (ER stress molecular chaperone) + ATF6 (UPR pathway receptor) is the ER stress gene combination. This ER stress gene combination covers the entire process from adaptive response to ER stress to damage and apoptosis; its upregulation directly reflects ER stress activation. This method limits the expression changes of the above seven specific genes to the molecular validation criteria for the hepatotoxicity model, distinguishing it from other models that use random gene detection methods.

[0009] The palmitic acid-induced liver lipotoxicity cell model described above is a concentration-dependent cell model established using the HepG2 human liver cancer cell line as a model vector and palmitic acid (PA) in a concentration gradient as an inducer. The model was successfully established by using a PA concentration gradient (without added OA), which avoids the protective effect of OA on cytotoxicity and more accurately simulates the direct damage mechanism of saturated fatty acids.

[0010] Furthermore, the repeatable parameter range for palmitic acid (PA)-induced hepatic lipotoxicity is defined as follows: PA treatment concentrations of 0 μM (control), 100 μM, 150 μM, 300 μM, 500 μM, and 1000 μM. This gradient covers low concentrations (no obvious damage) to medium concentrations (mild damage) to high concentrations (severe damage). The PA treatment time for HepG2 cells is defined as 24 hours, and 24-hour treatment can stably present concentration-dependent lipotoxicity assessment criteria.

[0011] Furthermore, the criteria for judging lipotoxicity are as follows:

[0012] At the cellular phenotype level: PA reduced the survival rate of HepG2 cells in a concentration-dependent manner, and cell shrinkage, decreased density, and shedding occurred at concentrations ≥150μM.

[0013] At the cellular function level: PA decreased intracellular ATP content in HepG2 cells in a concentration-dependent manner (p < 0.05) and increased intracellular ROS levels in a concentration-dependent manner;

[0014] At the molecular mechanism level: PA concentration-dependent regulation of specific genes: PA downregulates the expression of CRAT, ACSL1, and CPT2 genes in a concentration-dependent manner, while upregulating the expression of ATF4, CHOP, BIP, and ATF6 genes in a concentration-dependent manner.

[0015] This standard clearly links lipotoxicity with mitochondrial damage and ER stress, not only validating the cellular damage phenotype but also revealing the core molecular mechanism of PA-induced hepatic lipotoxicity, making the model both phenotypic and mechanistic.

[0016] Furthermore, the lipotoxicity assessment criteria are implemented using a combined detection method that progresses through a hierarchical progression from cell activity to energy metabolism, oxidative stress, and gene expression. This hierarchical progression is as follows:

[0017] Level 1: Quantitative survival rate of MTT / trypan blue was detected to first confirm that PA can kill cells in a concentration-dependent manner, and then the damage mechanism was further verified.

[0018] Level 2: Detecting dynamic changes in ATP and ROS: Based on changes in survival, pinpointing whether the damage originates from mitochondrial energy impairment or oxidative stress;

[0019] Level 3: Synchronous gene detection: Simultaneous detection of ER stress genes (ATF4 / CHOP / BIP) and oxidative phosphorylation genes (CRAT / CPT2) avoids result bias due to sample differences; moreover, the gene subset prioritizes the detection of ATF4 / CHOP / BIP (ER stress core genes) + CRAT / CPT2 (mitochondrial core genes), while excluding non-core auxiliary genes such as ACSL1 and ATF6.

[0020] Furthermore, the method for constructing a cell model of palmitic acid-induced liver lipotoxicity includes the following steps:

[0021] Step 1: Perform cell culture, culturing the HepG2 human liver cancer cell line to the logarithmic growth phase;

[0022] Step 2: Cell viability assay and palmitic acid (PA) treatment were performed. Different concentrations of PA were used to induce HepG2 cells cultured in step S1; the survival of HepG2 cells after PA treatment was detected.

[0023] Step 3: Observe the morphological changes of HepG2 cells after PA treatment;

[0024] Step 4: Perform cellular ATP assay to detect the ATP content in HepG2 cells after PA treatment;

[0025] Step 5: Measure the level of reactive oxygen species (ROS) in cells to detect the level of reactive oxygen species (ROS) in HepG2 cells after PA treatment;

[0026] Step Six: Molecular Mechanism Validation, including total RNA extraction and real-time quantitative PCR. Total RNA was extracted from PA-treated HepG2 cells, and the expression levels of mitochondrial oxidative phosphorylation-related genes and endoplasmic reticulum (ER) stress-related genes were detected by RT-PCR to complete the construction of a cell model of liver lipotoxicity injury.

[0027] Further, the cell culture in step one includes: HepG2 cells are cultured in DMEM medium containing 10% fetal bovine serum, 0.5% antibiotics and 1% non-essential amino acids in a 37°C, 5% CO2 incubator, and the cell growth status is observed and recorded.

[0028] Further, the cell viability assay in step two includes: accurately counting HepG2 cells and seeding them at a density of 5000–10000 cells / 100µL in a brand new 96-well plate, and culturing at 37°C and 5% CO2 for 24 h. To prevent edge evaporation, only PBS is added to the outer wells. Five replicates are set for each PAuM concentration (0, 100, 150, 300, 500, 1000µM). After 20 h of drug treatment, 10µL of LMTT solution (5mg / mL, prepared in PBS) is added to each well, and incubation continues for 4 h. Then, the supernatant is discarded (handle gently, do not aspirate formazan crystals), and 150µL of pre-chilled DMSO is added to each well. The plates are then shaken on ice in the dark for 10 min until the blue-purple crystals are completely dissolved. The absorbance (OD) is measured at 490 nm using a microplate reader. 490 And, with the 0µM group as the control, the cell viability at each concentration was calculated: Viability (%) = (OD 490 Experimental group / OD 490 (Control group) × 100.

[0029] Furthermore, the observation of cell morphological changes in step three includes: first confirming that the cells to be tested are in the logarithmic growth phase and have good morphology under a microscope, then digesting them with 1% trypsin for 4–5 minutes to obtain a homogeneous single-cell suspension; subsequently, accurately counting the cells using a hemocytometer, calculating the required volume based on "approximately 2500 cells per well," and diluting the cell suspension with culture medium to 2.5 × 10⁻⁶ cells / well. 4The concentration of cells per mL was increased to 100 μL and mixed thoroughly. 100 μL of the diluted cell suspension was added to each well of a 96-well plate, and the cells were gently agitated in a cross-shaped motion to ensure even spreading. The plates were incubated at 37°C for 24 h. The next day, 200 μL of fresh culture medium containing serially varying concentrations of PA was added to each well, and the plates were incubated for another 24 h. Cell morphology was then observed under a standard optical microscope. After drug treatment, the supernatant was carefully aspirated, and a small amount of 0.4% trypan blue diluted in PBS was added to each well. Staining was performed at room temperature for 15 min, followed by two gentle washes with PBS to remove excess dye. Finally, photographs were taken under a standard optical microscope. Five fields of view were randomly selected from each well, and the number of blue-stained dead cells and unstained live cells were counted for subsequent analysis.

[0030] Further, the cellular ATP assay in step four includes: placing adherent HepG2 cells treated with 0, 150, and 300 μM AuM for 24 h in a 6-well plate on ice, aspirating the culture medium, adding 200 μL of pre-chilled lysis buffer to each well, repeatedly pipetting until the cells are completely lysed, collecting the lysis buffer, centrifuging at 12000 rpm for 5 min at 4 °C, and transferring the supernatant to a labeled EP tube for later use; then diluting the 0.5 mM ATP standard to a series of concentrations of 0.01–10 μM using the kit lysis buffer, adding 100 μL of freshly prepared ATP detection working solution (ATP detection reagent: diluent = 1:100, ice bath protected from light) to each well in a black 96-well plate, incubating at room temperature for 3 min to subtract background, then adding 20 μL of supernatant sample or standard of each concentration sequentially, mixing quickly, and reading the RLU value using a chemiluminescence analyzer after 2 s intervals, setting 3 replicates for each concentration, and converting the ATP concentration to a standard curve.

[0031] Further, the detection of total reactive oxygen species (ROS) in step five includes: HepG2 cells treated with 0, 150, and 300 μMPa for 24 h were placed on ice, and after aspirating the culture medium from each of the 6-well plates, 200 μL of pre-chilled lysis buffer was added to each well and the cells were thoroughly lysed by pipetting. The lysis buffer was collected and centrifuged at 4°C and 12,000 rpm for 5 min, and the supernatant was collected for later use. Subsequently, 10 mM MDCCFH-DA was diluted to 10 μM with serum-free culture medium at a ratio of 1:1000 according to the instructions, and a positive control of ROS, Rosup (100 mM), was diluted to 100 μM as a positive control. After discarding the original culture medium, two wells were set up for the negative control (1 mL of serum-free culture medium), two wells for the experimental wells (1 mL of 10 μM MDCCFH-DA), and two wells for the positive control (10 μM MDCCFH-DA + 1 mL of 100 μM Rosup). The cells were incubated at 37°C in the dark for 30 min. After incubation, the culture medium was discarded, and cells were gently pipetted into each well with 1 mL of PBS until they completely detached. The cell suspension was collected into 1.5 mL EP tubes, centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. After washing twice with PBS, the cells were resuspended in 1 mL of PBS to form a single-cell suspension, and clumping was removed. Finally, the DCF fluorescence intensity was detected by flow cytometry at an excitation wavelength of 488 nm and an emission wavelength of 525 nm to quantify the total reactive oxygen species level in the cells of each treatment group.

[0032] Further, step six, which involves total RNA extraction and real-time quantitative PCR, includes: First, total RNA extraction is performed. A pre-prepared 6-well culture plate for RNA extraction is removed from the cell culture room. The culture supernatant is carefully aspirated, and the plate is gently washed 1-2 times with PBS, taking care to avoid aspirating adherent cells. The plate is then transferred to a fume hood and placed on ice. Next, the total RNA extraction reagent is removed from the 4°C freezer and added to each well of the 6-well plate at a dosage of 500 μL. After gentle mixing, the plate is incubated on ice for approximately 10 minutes. Cells are repeatedly pipetted down the plate until they are completely removed from the bottom. The cells are then transferred to new, autoclaved, and dried centrifuge tubes (all pipette tips and centrifuge tubes are treated in the same way). The tubes are capped and shaken vigorously several times. 100 μL of chloroform (equivalent to 1 / 5 of the lysis buffer volume) is added to each tube, and the tubes are shaken vigorously for 15 seconds. The tubes are then incubated at room temperature for 5 minutes. Clear stratification is observed: the lower layer is light purple or pink, and the upper layer is colorless. Then place the centrifuge tubes in a pre-chilled 4°C centrifuge and centrifuge at 12,000 rpm for 15 min (make sure to balance the volume). After centrifugation, the liquid in the tube will form three layers: a colorless aqueous phase on top (the desired RNA solution), a white precipitate in the middle, and a pink oily organic phase at the bottom. Handle under light, carefully aspirating 200 μL of the colorless upper layer into a new centrifuge tube, avoiding contact with the middle and lower layers. Add an equal volume of isopropanol to the resulting liquid, tighten the cap, invert to mix, and centrifuge at 4°C (or room temperature) for 10–15 min. It is recommended to keep all centrifuge tubes facing the same direction during this stage for subsequent operations. After centrifugation, discard the supernatant, retaining only the precipitate. Because the precipitate is difficult to observe, you can carefully aspirate the supernatant using a 1000 μL pipette tip covered with a 20 μL pipette tip under light, being careful not to remove the precipitate. Add 500 μL of DEPC-containing water with 75% ethanol (equal volume to the lysis buffer), gently invert to suspend the precipitate, and centrifuge at 4°C for 3–5 min (keeping the tubes facing the same direction). Remove the supernatant again, aspirating as much as possible. Place the centrifuge tube in a clean bench for a short time to dry, but not for too long to prevent RNA degradation. Finally, add 20–30 μL of LEPC water to the tube and shake thoroughly to completely dissolve the RNA. Once the concentration and purity are confirmed to be acceptable, the tube can be used for subsequent experiments or stored at -80°C for long-term storage.

[0033] Further, step six includes the preparation of the reverse transcription reaction system. The preparation steps of the reverse transcription reaction system are as follows: (1) denaturation and premixing of RNA template, (2) adding 20 μL of 10×HifairⅢSuperBuffer and 1 μL of HifairⅢRTEnzymeMix to the same tube, (3) reverse transcription program, the product is used for qPCR, extension at 55℃ for 15 min.

[0034] Furthermore, the method includes the preparation of a qRT-PCR reaction system, wherein a 20 μL system is prepared. During the preparation process, the enzymes in the kit need to be protected from light and operated on ice. After the system is added, the experiment is performed using a real-time PCR instrument.

[0035] Furthermore, the method includes gene primer sequences. The primer sequences are as follows:

[0036] BIP (GRP78) forward primer sequence: CCTGAAGGGGAACGTCTGAT, reverse primer sequence: CTTTGTTTGCCCACCTCCAA;

[0037] CHOP forward primer sequence: TCTTGACCCTGCTTCTCTGG, reverse primer sequence: GCGTGTGCCACTTTCCTTTCA;

[0038] CPT2 forward primer sequence: AGCCTGAGGAAAGTGGACTC, reverse primer sequence: ACCCCAAGAGTGCTCAAAGT;

[0039] ACSL1 forward primer sequence: GCCCTCGCCCATATGTTTG; reverse primer sequence: CATCCGGTTCAGCAGTCTTG.

[0040] CRAT forward primer sequence: CTGGACATCTACTCTGCCGT, reverse primer sequence: GATCCTTGCCCCTTTCCTCA;

[0041] ATF4 forward primer sequence: ACACTGCTTACGTTGCCATG; reverse primer sequence: CAGACCCACAGAGAACACCT.

[0042] ATF6 forward primer sequence: GCTTCTCTTTGCTGAACTCGG, reverse primer sequence: TGAGGAGGCTGGAGAAAGTG.

[0043] Furthermore, the model can be used to explore key regulatory nodes of hepatic lipotoxicity, such as verifying whether the signaling molecule AMPK improves CRAT by upregulating CRAT, PA-induced ATP decrease, or whether antioxidants alleviate ER stress by inhibiting ROS.

[0044] Furthermore, the model is suitable for screening lipotoxicity protectants (such as polyene phosphatidylcholine, which alleviates damage by regulating p-AMPK), and can protect high-throughput drug screening systems based on the PA-HepG2 model. For example, it can screen candidate compound libraries by detecting whether PA-induced decrease in cell activity, ATP recovery, ROS reduction, and ER stress gene downregulation can be reversed, thereby rapidly screening potential hepatotoxicity protectants.

[0045] Furthermore, the model can be used for toxicity assessment to evaluate the risk of hepatotoxicity of food / chemicals, such as detecting whether a food additive exacerbates PA-induced hepatocellular damage, providing in vitro data support for food safety assessment.

[0046] Furthermore, the molecularly specific gene combination in the model, CRAT / ASCL1 / CPT2 downregulation + ATF4 / CHOP / BIP upregulation, can be applied in diagnosis or drug evaluation.

[0047] (III) Beneficial Effects

[0048] 1. This invention significantly improves the accuracy and repeatability of the model by optimizing the parameters of a single PA inducer, integrating multi-dimensional damage indicators, and locking in the HepG2-specific response.

[0049] 2. This invention uses a three-level progressive verification approach—phenotype, function, and molecule—to break down the phenomenon into its underlying causes, eliminating interference from non-lipotoxic factors and ensuring that the cell damage in the model is indeed caused by PA-induced lipotoxicity, rather than other irrelevant factors.

[0050] 3. Many existing in vitro models suffer from inconsistent results across different laboratories due to unclear inducing agent concentrations and treatment times. This solution, through rigorous parameter design, ensures the operability and reproducibility of the model. Other laboratories operating according to these parameters can obtain consistent model results, meeting the core requirements of reproducibility and verifiability in scientific research. It also lays the foundation for incorporating model standards into industry testing guidelines in the future.

[0051] 4. Existing multi-dimensional detection methods are prone to problems such as too many indicators, cumbersome operation, and high cost. This solution, through a hierarchical design of first-level, second-level, and third-level methods, ensures that necessary detections are not missed and redundant detections are not added, balancing the comprehensiveness of detection with practical economy. It is suitable for in-depth research in large laboratories as well as routine model building in small and medium-sized laboratories, thus lowering the threshold for technology promotion.

[0052] 5. This technical solution is not merely about building a model for the sake of building a model, but rather about providing a multifunctional tool for subsequent research, breaking through the limitations of single-purpose models, and enabling multi-scenario applications such as basic mechanism research, drug screening, and toxicity assessment, thereby enhancing the practical value and translational potential of the technical solution. Attached Figure Description

[0053] Figure 1 This is a method and procedure for constructing an in vitro cell model of palmitic acid-induced liver lipotoxicity provided in this embodiment of the invention.

[0054] Figure 2 This is a schematic diagram illustrating the effect of different concentrations of palmitic acid (PA) on the cell viability of HepG2 cells after 24 hours of treatment, as provided in this embodiment of the invention.

[0055] Figure 3 This is a schematic diagram showing the morphological changes of HepG2 cells treated with different concentrations of palmitic acid after 24 hours under a microscope, as provided in the embodiments of the present invention.

[0056] Figure 4 This is a schematic diagram showing the cell death of HepG2 cells after treatment with different concentrations of palmitic acid (PA) for 24 hours, as provided in the embodiments of the present invention: Trypan blue staining was used to detect cell death in HepG2 cells after treatment with different concentration gradients of PA.

[0057] Figure 5 This is a schematic diagram illustrating the changes in cellular ATP after treatment with different concentrations of palmitic acid provided in this embodiment of the invention: ATP detection kit detects the changes in cellular ATP in HepG2 cells after treatment with different concentration gradients of PA for 24 hours.

[0058] Figure 6 This is a schematic diagram showing the intracellular ROS levels of HepG2 cells after treatment with different concentrations of palmitic acid, as provided in this embodiment of the invention: ROS detection kit detects intracellular ROS levels of HepG2 cells after treatment with different concentration gradients of PA for 24 hours.

[0059] Figure 7 This is a schematic diagram illustrating the comparison of relative expression levels of mitochondrial oxidative phosphorylation and endoplasmic reticulum stress-related gene mRNAs provided in this embodiment of the invention. Detailed Implementation

[0060] The present invention aims to provide a cell model of hepatic lipotoxicity based on palmitic acid and its construction method. The following is a further description of the technical solution of the present invention, but the invention is not limited thereto.

[0061] This invention treats HepG2 cells with different concentrations of PA; assesses cell viability using MTT assay; observes morphological changes in cells after treatment with different concentrations of PA under a microscope; detects cell death using trypan blue staining; detects changes in cellular ATP using an ATP assay kit; detects intracellular ROS levels using a reactive oxygen species (ROS) assay kit; and detects mitochondrial oxidative phosphorylation and ER stress-related gene expression using RT-PCR. A closed-loop process was constructed, encompassing cell culture, MTT + trypan blue activity measurement, morphological observation, ATP + ROS function measurement, and RT-PCR gene detection. This forms a three-dimensional validation system from phenotype: activity + morphology to function, ATP + ROS to specific gene combinations at the molecular level.

[0062] The specific gene combination is: BIP(GRP78) + CHOP + CPT2 + ACSL1 + CRAT + ATF4 + ATF6. CRAT (acetyltransferase) + ACSL1 (lipid metabolism initiation) + CPT2 (fatty acid β-oxidation) is a gene combination for mitochondrial oxidative phosphorylation; downregulation of this gene combination directly reflects mitochondrial lipid metabolism disorders. ATF4 (UPR pathway transcription factor) + CHOP (ER stress apoptosis effector molecule) + BIP (ER stress molecular chaperone) + ATF6 (UPR pathway receptor) is an ER stress gene combination. This ER stress gene combination covers the entire process of ER stress adaptive response, damage, and apoptosis; its upregulation directly reflects ER stress activation. This method limits the expression changes of the above seven specific genes to the molecular validation standard of the liver lipotoxicity model, distinguishing it from other models that randomly select gene detection methods.

[0063] The palmitic acid-induced liver lipotoxicity cell model described above is a concentration-dependent cell model established using the HepG2 human liver cancer cell line as a model vector and palmitic acid (PA) in a concentration gradient as an inducer. The model was successfully established by using a PA concentration gradient (without added OA), which avoids the protective effect of OA on cytotoxicity and more accurately simulates the direct damage mechanism of saturated fatty acids.

[0064] The reproducible parameter range for palmitic acid (PA)-induced hepatic lipotoxicity is defined as follows: PA treatment concentrations of 0 μM (control), 100 μM, 150 μM, 300 μM, 500 μM, and 1000 μM. This gradient covers low concentrations (no significant damage) to medium concentrations (mild damage) to high concentrations (severe damage). The PA treatment time for HepG2 cells is defined as 24 hours, and 24-hour treatment consistently presents concentration-dependent lipotoxicity assessment criteria. The lipotoxicity assessment criteria are as follows:

[0065] At the cellular phenotype level: PA reduced the survival rate of HepG2 cells in a concentration-dependent manner, and cell shrinkage, decreased density, and shedding occurred at concentrations ≥150μM.

[0066] At the cellular function level: PA decreased intracellular ATP content in HepG2 cells in a concentration-dependent manner (p < 0.05) and increased intracellular ROS levels in a concentration-dependent manner;

[0067] At the molecular mechanism level: PA concentration-dependent regulation of specific genes: PA downregulates the expression of CRAT, ACSL1, and CPT2 genes in a concentration-dependent manner, while upregulating the expression of ATF4, CHOP, BIP, and ATF6 genes in a concentration-dependent manner.

[0068] This standard clearly links lipotoxicity with mitochondrial damage and ER stress, not only validating the cellular damage phenotype but also revealing the core molecular mechanism of PA-induced hepatic lipotoxicity, making the model both phenotypically valid and mechanistically relevant. The lipotoxicity assessment criteria are implemented using a progressive hierarchical approach: cellular activity – energy metabolism – oxidative stress – gene expression. This hierarchical progression is as follows:

[0069] Level 1: Quantitative survival rate of MTT / trypan blue was detected to first confirm that PA can kill cells in a concentration-dependent manner, and then the damage mechanism was further verified.

[0070] Level 2: Detecting dynamic changes in ATP and ROS: Based on changes in survival, pinpointing whether the damage originates from mitochondrial energy impairment or oxidative stress;

[0071] Level 3: Synchronous gene detection: Simultaneous detection of ER stress genes (ATF4 / CHOP / BIP) and fatty acid β-oxidation genes (CRAT / CPT2) avoids result bias due to sample differences; moreover, the gene subset prioritizes the detection of ATF4 / CHOP / BIP (ER stress core genes) + CRAT / CPT2 (mitochondrial fatty acid β-oxidation genes), while excluding non-core auxiliary genes such as ACSL1 and ATF6.

[0072] The following is a further detailed description of the cell model of the method of the present invention.

[0073] refer to Figure 1 The method for constructing a cell model of palmitic acid-induced liver lipotoxicity includes the following steps:

[0074] Step 1: Perform cell culture, culturing the HepG2 human liver cancer cell line to the logarithmic growth phase;

[0075] Step 2: Cell viability assay and palmitic acid (PA) treatment were performed. Different concentrations of PA were used to induce HepG2 cells cultured in step S1; the survival of HepG2 cells after PA treatment was detected.

[0076] Step 3: Observe the morphological changes of HepG2 cells after PA treatment;

[0077] Step 4: Perform cellular ATP assay to detect the ATP content in HepG2 cells after PA treatment;

[0078] Step 5: Measure the level of reactive oxygen species (ROS) in cells to detect the level of reactive oxygen species (ROS) in HepG2 cells after PA treatment;

[0079] Step Six: Molecular Mechanism Validation, including total RNA extraction and real-time quantitative PCR. Total RNA was extracted from PA-treated HepG2 cells, and the expression levels of mitochondrial oxidative phosphorylation-related genes and endoplasmic reticulum (ER) stress-related genes were detected by RT-PCR to complete the construction of a cell model of liver lipotoxicity injury.

[0080] The cell culture in step one includes: HepG2 cells are cultured in DMEM medium containing 10% fetal bovine serum, 0.5% antibiotics and 1% non-essential amino acids at 37°C in a 5% CO2 incubator, and the cell growth status is observed and recorded.

[0081] Step two, cell viability assay, includes: Accurately counting HepG2 cells and seeding them at a density of 5000–10000 cells / 100µL in brand new 96-well plates, incubating at 37°C and 5% CO2 for 24 h. To prevent edge evaporation, only PBS was added to the outer wells. Five replicates were set for each PAuM concentration (0, 100, 150, 300, 500, 1000µM). After 20 h of drug treatment, 10µL of LMTT solution (5mg / mL, prepared in PBS) was added to each well, and incubation continued for 4 h. The supernatant was then discarded (handled gently, without aspirating the formazan crystals), and 150µL of pre-chilled DMSO was added to each well. The plates were then incubated on ice in the dark with shaking for 10 min until the blue-purple crystals were completely dissolved. The absorbance (OD) was measured at 490 nm using a microplate reader. 490 And, with the 0µM group as the control, the cell viability at each concentration was calculated: Viability (%) = (OD 490 Experimental group / OD 490 (Control group) × 100.

[0082] Step three, observing cell morphological changes, includes: first confirming that the cells to be tested are in the logarithmic growth phase and have good morphology under the microscope, then digesting them with 1% trypsin for 4–5 minutes to obtain a homogeneous single-cell suspension; subsequently, accurately counting the cells using a hemocytometer, calculating the required volume based on "approximately 2500 cells per well," and diluting the cell suspension with culture medium to 2.5 × 10⁻⁶ cells / well. 4The concentration of cells per mL was increased to 100 μL and mixed thoroughly. 100 μL of the diluted cell suspension was added to each well of a 96-well plate, and the cells were gently agitated in a cross-shaped motion to ensure even spreading. The plates were incubated at 37°C for 24 h. The next day, 200 μL of fresh culture medium containing serially varying concentrations of PA was added to each well, and the plates were incubated for another 24 h. Cell morphology was then observed under a standard optical microscope. After drug treatment, the supernatant was carefully aspirated, and a small amount of 0.4% trypan blue diluted in PBS was added to each well. Staining was performed at room temperature for 15 min, followed by two gentle washes with PBS to remove excess dye. Finally, photographs were taken under a standard optical microscope. Five fields of view were randomly selected from each well, and the number of blue-stained dead cells and unstained live cells were counted for subsequent analysis.

[0083] Step four, the cellular ATP assay, includes: placing adherent HepG2 cells treated with 0, 150, and 300 μM AuM for 24 h in 6-well plates on ice, aspirating the culture medium, adding 200 μL of pre-chilled lysis buffer to each well, repeatedly pipetting until complete cell lysis, collecting the lysis buffer, centrifuging at 12000 rpm for 5 min at 4 °C, and transferring the supernatant to labeled EP tubes for later use; then diluting the 0.5 mM ATP standard to a series of concentrations of 0.01–10 μM using the kit lysis buffer, adding 100 μL of freshly prepared ATP detection working solution (ATP detection reagent: diluent = 1:100, ice bath protected from light) to each well in a black 96-well plate, incubating at room temperature for 3 min to subtract background, then adding 20 μL of supernatant sample or standard of each concentration sequentially, mixing quickly, and reading the RLU value using a chemiluminescence analyzer after 2 s intervals, setting 3 replicates for each concentration, and converting the ATP concentration to a standard curve.

[0084] Step five involves detecting total reactive oxygen species (ROS) in cells. HepG2 cells treated with 0, 150, and 300 μMPa for 24 h were placed on ice. After aspirating the culture medium from each 6-well plate, 200 μL of pre-chilled lysis buffer was added to each well, and the cells were thoroughly lysed by pipetting. The lysis buffer was collected and centrifuged at 12,000 rpm for 5 min at 4 °C, and the supernatant was used. Subsequently, 10 mM MDCCFH-DA was diluted to 10 μM with serum-free culture medium at a ratio of 1:1000, according to the manufacturer's instructions. A positive control, Rosup (100 mM), was diluted to 100 μM as a positive control. After discarding the original culture medium, two wells were set up for a negative control (1 mL serum-free culture medium), two wells for experimental cells (1 mL MDCCFH-DA), and two wells for a positive control (10 μM MDCCFH-DA + 1 mL MRosup (100 μM)). The cells were incubated at 37 °C in the dark for 30 min. After incubation, the culture medium was discarded, and cells were gently pipetted into each well with 1 mL of PBS until they completely detached. The cell suspension was collected into 1.5 mL EP tubes, centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. After washing twice with PBS, the cells were resuspended in 1 mL of PBS to form a single-cell suspension, and clumping was removed. Finally, the DCF fluorescence intensity was detected by flow cytometry at an excitation wavelength of 488 nm and an emission wavelength of 525 nm to quantify the total reactive oxygen species level in the cells of each treatment group.

[0085] Step six, total RNA extraction and real-time quantitative PCR, includes: First, extracting total RNA. Remove the prepared 6-well culture plate from the cell culture room, carefully aspirate the culture supernatant, and gently wash 1-2 times with PBS, taking care to avoid aspirating adherent cells. Then, transfer the culture plate to a fume hood and place it on ice. Next, remove the total RNA extraction reagent from the 4°C freezer and add 500 μL per well to each well of the 6-well plate. Gently mix and incubate on ice for approximately 10 minutes. Use a pipette to repeatedly blow the cells off the bottom of the plate and transfer them to new, autoclaved and dried centrifuge tubes (all pipette tips and tubes are treated similarly). Tightly cap the tubes and shake vigorously several times. Add 100 μL of chloroform to each tube (equivalent to 1 / 5 of the lysis buffer volume), shake vigorously for 15 seconds, and incubate at room temperature for 5 minutes. Clear stratification will be observed: the lower layer will be light purple or pink, and the upper layer will be colorless. Then place the centrifuge tubes in a pre-chilled 4°C centrifuge and centrifuge at 12,000 rpm for 15 min (make sure to balance the volume). After centrifugation, the liquid in the tube will form three layers: a colorless aqueous phase on top (the desired RNA solution), a white precipitate in the middle, and a pink oily organic phase at the bottom. Handle under light, carefully aspirating 200 μL of the colorless upper layer into a new centrifuge tube, avoiding contact with the middle and lower layers. Add an equal volume of isopropanol to the resulting liquid, tighten the cap, invert to mix, and centrifuge at 4°C (or room temperature) for 10–15 min. It is recommended to keep all centrifuge tubes facing the same direction during this stage for subsequent operations. After centrifugation, discard the supernatant, retaining only the precipitate. Because the precipitate is difficult to observe, you can carefully aspirate the supernatant using a 1000 μL pipette tip covered with a 20 μL pipette tip under light, being careful not to remove the precipitate. Add 500 μL of DEPC-containing water with 75% ethanol (equal volume to the lysis buffer), gently invert to suspend the precipitate, and centrifuge at 4°C for 3–5 min (keeping the tubes facing the same direction). Remove the supernatant again, aspirating as much as possible. Place the centrifuge tube in a clean bench for a short time to dry, but not for too long to prevent RNA degradation. Finally, add 20–30 μL of LEPC water to the tube and shake thoroughly to completely dissolve the RNA. Once the concentration and purity are confirmed to be acceptable, the tube can be used for subsequent experiments or stored at -80°C for long-term storage.

[0086] Next, the reverse transcription reaction system is prepared, and the specific steps are as follows:

[0087] (1) RNA template denaturation and premixing: Add the following to an RNase-free centrifuge tube in sequence: Total RNA 500 ng, Random Primers N6, Oligo(dT)18 or gene-specific primer 1 μL, and RNase-free ddH2O to a final volume of 17 μL. The entire process was performed on ice; after addition, gently mix by blowing, and briefly centrifuge to allow the liquid to settle to the bottom. Then, incubate at 65°C for 5 min to denature the RNA, and immediately place on ice for 3 min to block secondary structure and cool the system.

[0088] (2) Add the following to the reverse transcription system to a final volume of 20 μL: 10×HifairⅢSuperBuffer 2 μL, HifairⅢRTEnzymeMix 1 μL, gently mix, and keep on ice.

[0089] The reverse transcription program (products used for qPCR, extension at 55℃ for 15 min) is set as shown in Tables 1-2 below:

[0090] Table 1 Temperature and time settings for reverse transcription program

[0091] The default incubation time is 4℃. Configure the qRT-PCR reaction system.

[0092] Table 2. Preparation of qRT-PCR reaction system

[0093] The experimental setup used was a 20 μL system. The procedure is shown in Table 3. During the setup, it is important to note that the enzymes in the kit require protection from light, so the process must be performed on ice. Avoid touching the bottom of the tubes and do not add the enzymes to the wrong wells. After adding the enzymes, perform the experiment using a real-time PCR instrument.

[0094] Table 3. System Procedure Settings

[0095] The primers used in the reaction system include mitochondrial oxidative phosphorylation genes (CRAT / ACSL1 / CPT2) and ER stress genes (ATF4 / CHOP / BIP / ATF6), as shown in Table 4 below:

[0096] Table 4. Main primer sequences

[0097] To verify that inducing HepG2 cells with a concentration gradient of palmitic acid, unlike conventional induction with a single high concentration of palmitic acid, more closely approximates the physiological progression of lipotoxicity, this invention designed an experiment. The results showed that both MTT and trypan blue assays indicated that palmitic acid concentration-dependently reduced HepG2 cell survival, accompanied by a sharp drop in intracellular ATP and a surge in ROS, suggesting mitochondrial damage. Palmitic acid also downregulated oxidative phosphorylation genes such as CRAT, ASCL1, and CPT2 in a dose-gradient manner, and upregulated endoplasmic reticulum stress proteins such as ATF4, CHOP, BIP, and ATF6, collectively inducing lipotoxic damage. The experimental methods, procedures, and results verification are as follows:

[0098] 1. Materials and Methods

[0099] Materials: Cells: Cell Resource Center, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences; Reagents: Reactive oxygen species detection kit purchased from Nanjing Jiancheng Biotechnology Institute; ATP detection kit purchased from Shanghai Beyotime Biotechnology Co., Ltd.; Total RNA extraction reagent purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; Reverse transcription kit purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.; Real-time fluorescence quantitative PCR kit purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0100] Methods: HepG2 cells were treated with different concentrations of PA, and cell viability was assessed by MTT assay. Cell morphological changes after treatment with different concentrations of PA were observed under a microscope. Cell death was detected by trypan blue staining. Changes in cellular ATP were detected by an ATP assay kit. Intracellular ROS levels were detected by a reactive oxygen species (ROS) assay kit. Mitochondrial oxidative phosphorylation and ER stress-related gene expression were detected by RT-PCR.

[0101] 2 Experimental Procedure

[0102] 2.1 Cell Culture

[0103] HepG2 cells were cultured in DMEM medium containing 10% fetal bovine serum, 0.5% antibiotics, and 1% non-essential amino acids at 37°C in a 5% CO2 incubator. The cell growth status was observed and recorded.

[0104] 2.2 Cell viability assay

[0105] After accurate counting, HepG2 cells were seeded at a density of 5000–10000 cells / 100µL in brand new 96-well plates and incubated at 37°C and 5% CO2 for 24 h. To prevent edge evaporation, only PBS was added to the outer wells. Five replicates were set for each PAuM concentration (0, 100, 150, 300, 500, 1000µM). After 20 h of drug treatment, 10µL of LMTT solution (5mg / mL, prepared in PBS) was added to each well, and incubation continued for 4 h. The supernatant was then discarded (handled gently, without aspirating the formazan crystals), and 150µL of pre-chilled DMSO was added to each well. The plates were then incubated on ice in the dark with shaking for 10 min until the blue-purple crystals were completely dissolved. The absorbance (OD) was measured at 490 nm using a microplate reader. 490 And, with the 0µM group as the control, the cell viability at each concentration was calculated: Viability (%) = (OD 490 Experimental group / OD 490 (Control group) × 100.

[0106] 2.3 Observation of Cell Morphological Changes

[0107] First, confirm that the cells to be tested are in the logarithmic growth phase and have good morphology under a microscope. Then, digest them with 1% trypsin for 4–5 minutes to obtain a homogeneous single-cell suspension. Subsequently, accurately count the cells using a hemocytometer, calculate the required volume based on "approximately 2500 cells per well," and dilute the cell suspension with culture medium to 2.5 × 10⁻⁶ cells / well. 4 The concentration of cells per mL was increased to 100 μL and mixed thoroughly. 100 μL of the diluted cell suspension was added to each well of a 96-well plate, and the cells were gently agitated in a cross-shaped motion to ensure even spreading. The plates were incubated at 37°C for 24 h. The next day, 200 μL of fresh culture medium containing serially varying concentrations of PA was added to each well, and the plates were incubated for another 24 h. Cell morphology was then observed under a standard optical microscope. After drug treatment, the supernatant was carefully aspirated, and a small amount of 0.4% trypan blue diluted in PBS was added to each well. Staining was performed at room temperature for 15 min, followed by two gentle washes with PBS to remove excess dye. Finally, photographs were taken under a standard optical microscope. Five fields of view were randomly selected from each well, and the number of blue-stained dead cells and unstained live cells were counted for subsequent analysis.

[0108] 2.4 Cellular ATP Measurement

[0109] Adherent HepG2 cells treated with 0, 150, and 300 μM AuM for 24 h in 6-well plates were placed on ice. After aspirating the culture medium, 200 μL of pre-chilled lysis buffer was added to each well. The cells were repeatedly pipetted until complete lysis was achieved. The lysis buffer was collected and centrifuged at 12,000 rpm for 5 min at 4 °C. The supernatant was transferred to labeled EP tubes for later use. Subsequently, 0.5 mM ATP standard was diluted to a series of concentrations from 0.01 to 10 μM using the kit lysis buffer. 100 μL of freshly prepared ATP detection working solution (ATP detection reagent: diluent = 1:100, ice bath protected from light) was added to each well of a black 96-well plate. The plate was incubated at room temperature for 3 min to subtract background. Then, 20 μL of supernatant sample or standard of each concentration was added sequentially. The mixture was quickly mixed and the RLU value was read using a chemiluminescence analyzer after 2 s intervals. Three replicates were set for each concentration, and the ATP concentration was calculated using a standard curve.

[0110] 2.5 Detection of total reactive oxygen species in cells

[0111] HepG2 cells treated with 0, 150, and 300 μMPa for 24 h were placed on ice. After aspirating the culture medium from each 6-well plate, 200 μL of pre-chilled lysis buffer was added to each well, and the cells were thoroughly lysed by pipetting. The lysis buffer was collected and centrifuged at 12,000 rpm for 5 min at 4 °C, and the supernatant was used for later use. Subsequently, 10 mM MDFCH-DA was diluted to 10 μM with serum-free culture medium at a ratio of 1:1000 according to the manufacturer's instructions. A positive control of reactive oxygen species, Rosup (100 mM), was diluted to 100 μM as a positive control. After discarding the original culture medium, two wells were set up for the negative control (1 mL of serum-free culture medium), two wells for the experimental (1 mL of 10 μM MDFCH-DA), and two wells for the positive control (10 μM MDFCH-DA + 1 mL of 100 μM Rosup). The cells were incubated at 37 °C in the dark for 30 min. After incubation, the culture medium was discarded, and cells were gently pipetted into each well with 1 mL of PBS until they completely detached. The cell suspension was collected into 1.5 mL EP tubes, centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. After washing twice with PBS, the cells were resuspended in 1 mL of PBS to form a single-cell suspension, and clumping was removed. Finally, the DCF fluorescence intensity was detected by flow cytometry at an excitation wavelength of 488 nm and an emission wavelength of 525 nm to quantify the total reactive oxygen species level in the cells of each treatment group.

[0112] 2.6 Total RNA extraction from cells and real-time quantitative PCR

[0113] First, total RNA was extracted from the cells. A pre-prepared 6-well culture plate for RNA extraction was removed from the cell culture room. The culture supernatant was carefully aspirated, and the plate was gently washed 1-2 times with PBS, taking care to avoid aspirating adherent cells. The plate was then transferred to a fume hood and placed on ice. Next, the total RNA extraction reagent was removed from the 4°C freezer and added to each well at a dose of 500 μL. After gently mixing, the plate was incubated on ice for approximately 10 minutes. Cells were repeatedly pipetted down the plate until completely removed from the bottom. The cells were then transferred to new, autoclaved and dried centrifuge tubes (all pipette tips and tubes were treated similarly). The tubes were capped tightly and shaken vigorously several times. 100 μL of chloroform (equivalent to 1 / 5 of the lysis buffer volume) was added to each tube, and the tubes were shaken vigorously for 15 seconds. The tubes were incubated at room temperature for 5 minutes, after which clear separation was observed: the lower layer was light purple or pink, and the upper layer was colorless. The centrifuge tubes were then placed in a pre-chilled 4°C centrifuge and centrifuged at 12,000 rpm for 15 minutes (ensuring the liquid was balanced). After centrifugation, the liquid in the tube forms three layers: a colorless aqueous phase on top, which is the desired RNA solution; a white precipitate layer in the middle; and a pink, oily organic phase at the bottom. Perform the centrifuge under light, carefully aspirating 200 μL of the colorless upper layer into a new centrifuge tube, avoiding contact with the middle and lower layers. Add an equal volume of isopropanol to the resulting liquid, tighten the cap, invert the tube to mix, and centrifuge at 4°C (or room temperature) for 10–15 min. It is recommended to keep all centrifuge tubes facing the same direction during this stage for subsequent operations. After centrifugation, discard the supernatant, retaining only the precipitate. Since the precipitate is difficult to observe, carefully aspirate the supernatant using a 1000 μL pipette tip covered with a 20 μL pipette tip under light, being careful not to remove the precipitate. Add 500 μL of DEPC-containing water (equal volume to the lysis buffer) containing 75% ethanol, gently invert the tube to suspend the precipitate, and centrifuge at 4°C for 3–5 min (keeping the tube facing the same direction). Discard the supernatant again, aspirating as thoroughly as possible, and then briefly air-dry the centrifuge tube in a clean bench. Do not leave it for too long to prevent RNA degradation. Finally, add 20–30 μL LEPC water to the tube and shake thoroughly to completely dissolve the RNA. After confirming that the concentration and purity are within acceptable limits, it can be used for subsequent experiments or stored long-term in a -80°C freezer. Next, proceed with the reverse transcription procedure. The reverse transcription reaction system is configured as described in steps 1–3 above and as shown in Tables 1–4.

[0114] 3. Results

[0115] 3.1 Results of MTT assay for HepG2 cell viability are as follows Figure 2 As shown, HepG2 cells were treated with different concentrations of PA uM (0, 100, 150, 300, 500, and 1000 μM) for 24 hours, and cell viability was assessed by MTT assay. The results showed that PA uM treatment significantly decreased HepG2 cell viability, indicating significant lipotoxicity against liver cancer cells. Furthermore, the lipotoxicity of PA increased with increasing concentration gradient, meaning that the cytotoxic effect of PA was positively correlated with its dosage.

[0116] 3.2 Observation of morphological changes in HepG2 cells, as follows Figure 3 and Figure 4 As shown: In the control group (0 μM), cells remained morphologically intact and filled the field of view. However, after treatment with 150 μMPA, cells began to shrink and their density decreased; at 300 μMPA, large areas of cells detached and shrank. Cell death was detected by trypan blue staining. Microscopic observation showed that the number of dead cells stained blue gradually increased with increasing PA concentration. This suggests that PA has a significant dose-dependent cytotoxic effect on HepG2 cells.

[0117] 3.3 ATP assay kit for detecting changes in cellular ATP, such as... Figure 5 As shown, intracellular ATP levels decreased significantly with increasing palmitic acid concentration. Compared with the control group, the ATP content in the low-concentration palmitic acid treatment group decreased, and the difference was statistically significant (p<0.05). The ATP content in the high-concentration palmitic acid treatment group was further significantly reduced (p<0.001). The results indicate that palmitic acid can induce mitochondrial energy metabolism disorders in cells in a dose-dependent manner, suggesting that palmitic acid can disrupt the mitochondrial oxidative respiratory chain in liver cancer cells, reduce ATP production, and cause mitochondrial damage.

[0118] 3.4 Reactive Oxygen Species Detection Kit for Cellular Reactive Oxygen Species Levels Figure 6 As shown, flow cytometry results revealed a dose-dependent increase in intracellular ROS levels after palmitic acid treatment. Compared to the control group, the low-concentration treatment group showed a slight increase in ROS fluorescence signal, while the high-concentration treatment group showed a significant right shift in ROS fluorescence signal, indicating significant intracellular ROS accumulation. Therefore, PA can exert cytotoxic effects on liver cancer cells by inducing oxidative stress and ERS pathways.

[0119] 3.5 Expression of genes related to mitochondrial oxidative phosphorylation and endoplasmic reticulum stress-related proteins, as shown in the figure. Figure 7 As shown, RT-PCR results after RNA extraction revealed that PA could inhibit the expression of oxidative phosphorylation-related genes CRAT, ASCL1, and CPT2 at varying concentrations. Furthermore, PA could increase the expression of endoplasmic reticulum stress-related proteins ATF4, CHOP, BIP, and ATF6 at varying concentrations.

[0120] The above experimental results systematically confirmed, from three levels—phenotypic damage, functional abnormality, and molecular mechanism—that palmitic acid (PA) can induce hepatotoxicity in HepG2 cells in a concentration-dependent manner. They also verified that the core mechanism of PA-induced hepatotoxicity is the synergistic effect of mitochondrial dysfunction and endoplasmic reticulum (ER) stress, ultimately confirming the successful construction of the palmitic acid-HepG2 hepatotoxicity cell model. From the above experimental results (3.1-3.5), the following conclusions can be drawn:

[0121] Conclusion 1: The lipotoxicity of PA in HepG2 cells is strictly concentration-dependent. The degree of damage significantly increases with increasing PA concentration. The experimental results all revolve around PA concentration gradients (0, 100, 150, 300, 500, 1000 μM) and exhibit a consistent dose-response relationship, which is a fundamental characteristic of PA-induced lipotoxicity.

[0122] Phenotypic layer: At 0 μM (control), cell viability was normal and morphology was intact; at 150 μM, cell shrinkage and decreased viability began to appear; after 300 μM, cells detached over a large area and the number of dead cells increased dramatically (as shown in results 3.1 and 3.2).

[0123] Functional layer: Low concentrations of PA (e.g., 100-150 μM) resulted in a slight decrease in ATP and a slight increase in ROS (p<0.05); high concentrations of PA (e.g., 300-1000 μM) caused a sharp drop in ATP (p<0.001) and significant accumulation of ROS (fluorescence signal shifted significantly to the right) (as shown in results 3.3 and 3.4).

[0124] Molecular layer: The higher the PA concentration, the more significant the downregulation of mitochondrial oxidative phosphorylation genes (CRAT / ACSL1 / CPT2) and the more significant the upregulation of ER stress genes (ATF4 / CHOP / BIP / ATF6) (as shown in results 3.5).

[0125] This pattern indicates that PA's lipotoxicity is not all-or-nothing, but rather gradually exacerbates cell damage through dose accumulation, providing a quantitative basis for subsequent research on lipotoxicity thresholds, such as 150 μM as the starting point of mild damage, and drug intervention concentrations.

[0126] Conclusion 2: PA-induced lipotoxicity is initially manifested as abnormal cell function, with mitochondrial energy metabolism disorders and oxidative stress being the core early damage.

[0127] Results 3.3 (ATP) and 3.4 (ROS) directly point to PA's disruption of cell core function, and this disruption precedes severe phenotypic damage.

[0128] Mitochondrial energy metabolism disorder: ATP is the cell's energy currency, and its concentration-dependent sharp drop directly proves that PA disrupts mitochondrial function in HepG2 cells. This can be further explained by the downregulation of mitochondrial oxidative phosphorylation genes (CRAT / ACSL1 / CPT2) in 3.5: the enzymes encoded by these genes are key factors in mitochondrial fatty acid oxidation and energy production processes, and their reduced expression leads to abnormal mitochondrial oxidative respiratory chain function, thereby reducing ATP synthesis (as shown in the results of 3.3).

[0129] Endoplasmic reticulum stress activation: ROS is a marker of cellular oxidative damage. Its concentration-dependent surge indicates that PA disrupts the intracellular oxidation-antioxidant balance. High concentrations of ROS will further attack mitochondria, such as damaging mitochondrial DNA and disrupting membrane structure, forming a vicious cycle of increased ROS, mitochondrial damage, decreased ATP, and further increased ROS (as shown in results 3.4).

[0130] The changes in these two functional indicators reveal the core damage pathway of PA lipotoxicity: PA first attacks mitochondria, leading to energy metabolism disorders and setting the stage for subsequent cell death.

[0131] Conclusion 3: PA exacerbates lipotoxicity through the mitochondrial pathway and the ER stress pathway, validating the causal relationship of the damage at the molecular mechanism level. Result 3.5: Gene expression links functional abnormalities with molecular regulation, confirming that PA amplifies lipotoxicity by regulating key pathway genes.

[0132] Inhibition of mitochondrial pathways: CRAT (acetyltransfer), ACSL1 (lipid metabolism initiation), and CPT2 (fatty acid β-oxidation) are key genes in mitochondrial lipid metabolism and energy production. Their downregulation directly leads to mitochondria being unable to use fatty acids for energy, which exacerbates ATP deficiency and causes fatty acid accumulation in cells, further aggravating lipotoxicity.

[0133] ER stress pathway activation: ATF4 (stress transcription factor), CHOP (apoptotic effector molecule), BIP (ER stress molecular chaperone), and ATF6 (ER stress pathway receptor) are the core genes of ER stress. The ER is an important organelle for protein folding and lipid synthesis. PA-induced fatty acid accumulation and ROS elevation can lead to ER dysfunction, thereby activating these genes. Upregulation of BIP is an adaptive response to ER stress, attempting to repair ER function. Upregulation of ATF4, CHOP, and ATF6 indicates that the damage exceeds the adaptive capacity. In particular, CHOP further promotes apoptosis, which corresponds to the increase in dead cells shown in the results in 3.2.

[0134] This result indicates that PA's lipotoxicity does not act through a single pathway, but rather through a synergistic effect of inhibiting mitochondrial function (energy deprivation) and activating ER stress (pro-apoptosis), ultimately leading to cell damage and even death.

[0135] Conclusion 4: All results collectively validate the successful construction of the palmitic acid-HepG2 hepatic lipotoxicity model, which meets the requirements of pathological fit and reproducibility. Combined with the previously established in vitro hepatocellular lipotoxicity model, the above experimental results confirm the model's effectiveness from three dimensions:

[0136] Pathological fit: The PA-induced mitochondrial damage and ER stress in the model are completely consistent with the core pathological mechanism of clinical hepatotoxicity such as non-alcoholic fatty liver disease.

[0137] Consistency of results: The results at the three levels of decreased phenotypic activity, morphological changes, decreased functional ATP, increased ROS, and molecular and gene regulation corroborate each other. For example, upregulation of ER stress genes explains the increase in apoptosis, and downregulation of mitochondrial genes explains the decrease in ATP.

[0138] Experimental reproducibility: All results were concentration-dependent and statistically significant, and subsequent laboratories could obtain consistent results by repeating the experiment with the same PA concentration and treatment time.

[0139] Finally, it should be noted that the above embodiments and implementation methods are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A cell model based on palmitic acid-induced hepatotoxicity injury and a method for constructing the same, characterized in that: The method takes HepG2 human hepatoma cell line as a model carrier, and establishes a concentration-dependent in vitro cell model with concentration gradient palmitic acid (PA) as an inducing agent, including the following steps: Step one: cell culture, culture HepG2 human hepatoma cell line to the logarithmic growth phase; Step two: cell activity determination and palmitic acid (PA) treatment, different concentrations of PA are used to induce and treat the HepG2 cells cultured in step S1; the survival of HepG2 cells after PA treatment is detected; the concentration gradient palmitic acid (PA) induced liver lipid toxicity has a repeatable parameter range, the PA treatment concentration is limited to 0 μM, 100 μM, 150 μM, 300 μM, 500 μM, 1000 μM, and the time for PA treatment of HepG2 cells is limited to 24 hours; Step three: cell morphological change observation, observe the morphological changes of HepG2 cells after PA treatment; Step four: cell ATP determination, detect the ATP content in HepG2 cells after PA treatment; Step five: cell reactive oxygen species (ROS) level determination, detect the reactive oxygen species (ROS) level in HepG2 cells after PA treatment; Step six: molecular specific gene combination verification: total RNA extraction and real-time fluorescent quantitative PCR, extract the total RNA of HepG2 cells after PA treatment, detect the expression levels of mitochondrial oxidative phosphorylation related genes and endoplasmic reticulum (ER) stress related genes by RT-PCR, and complete the construction of liver lipid toxicity damage cell model; the molecular specific gene combination is: BIP+CHOP+CPT2+ACSL1+CRAT+ATF4+ATF6; the CRAT+ACSL1+CPT2 is a mitochondrial oxidative phosphorylation gene combination, and the ATF4+CHOP+BIP+ATF6 is an ER stress gene combination.

2. A cell model based on palmitic acid-induced hepatotoxic injury and a method for constructing the same according to claim 1, wherein: the cell model is a hepatocyte cell model. The reverse transcription reaction system configuration in step six includes the following steps: 6.1) RNA template denaturation and premixing, 6.2) reverse transcription system completion to 20 μL in the same tube: 10×HifairⅢSuperBuffer 2 μL, HifairⅢRTEnzymeMix 1 μL, 6.3) reverse transcription program, the product is used for qPCR, 55℃ extension for 15 min, the reverse transcription program includes qRT-PCR reaction system configuration, the configured system is 20 μL, the enzyme in the kit needs to be protected from light and operated on ice, and after adding the system, a fluorescent quantitative PCR instrument is used for experiment.

3. The cell model of hepatic lipotoxic injury induced by palmitic acid and its construction method as described in claim 1, characterized in that: The liver lipid toxicity is judged as follows: Cell phenotype level: PA reduces the survival rate of HepG2 cells in a concentration-dependent manner, and when the concentration is ≥150 μM, cell contraction, density reduction and shedding occur; Cell function level: PA reduces the ATP content in HepG2 cells in a concentration-dependent manner p<0.05, and increases the intracellular ROS level in a concentration-dependent manner. Molecular mechanism level: PA concentration-dependent regulation of specific genes: PA down-regulates the expression of CRAT, ACSL1, CPT2 genes in a concentration-dependent manner, while up-regulates the expression of ATF4, CHOP, BIP, ATF6 genes in a concentration-dependent manner; The lipotoxicity judgment criteria are executed in a hierarchical progression of cell activity-energy metabolism-oxidative stress-gene expression for joint detection.

4. A cell model based on palmitate-induced hepatotoxicity injury and a method for constructing the same according to claim 3, wherein: The hierarchical progression is as follows: First level: Detect MTT / trypan blue quantitative survival rate, first confirm that PA can kill cells in a concentration-dependent manner, and then further verify the damage mechanism; Second level: Detect ATP and ROS dynamic changes: on the basis of survival changes, locate whether the damage source is mitochondrial energy disorder or oxidative stress; Third level: Synchronous detection of genes: synchronous detection of ER stress genes: ATF4 / CHOP / BIP and oxidative phosphorylation genes: CRAT / CPT2, to avoid result deviation caused by sample differences; and the gene subset preferentially detects ER stress core genes: ATF4 / CHOP / BIP + mitochondrial core genes: CRAT / CPT2, and eliminates non-core auxiliary genes ACSL1 and ATF6.

5. The cell model of hepatic lipotoxic injury induced by palmitic acid and its construction method as described in claim 1, characterized in that: The cell culture in step one includes: HepG2 cells are cultured in a 37°C, 5% CO2 incubator using DMEM medium containing 10% fetal bovine serum, 0.5% antibiotics, and 1% non-essential amino acids.

6. The cell model of hepatic lipotoxic injury induced by palmitic acid and its construction method as described in claim 1, characterized in that: The cell activity determination in step two includes: after accurate counting of HepG2 cells, 5000-10000 cells / 100µL are inoculated in a 96-well plate at a density of 5000-10000 cells / 100µL, and 37°C, 5% CO2 culture is performed for 24h; to prevent edge evaporation, only PBS is added to each well in the outer circle.

7. A cell model based on palmitate-induced hepatotoxicity injury and a method for constructing the same according to claim 1, wherein: the cell model is a hepatocyte cell model. The cell morphology change observation in step three includes: confirming that the cells to be tested are in logarithmic growth phase, and the morphology under the microscope is good, then digesting with 1% trypsin for 4-5 min to obtain a uniform single cell suspension; then accurately counting with a hemocytometer, calculating the required volume according to about 2500 cells per well, diluting the cell suspension to 2.5×10 4 6 / mL with culture solution and mixing thoroughly; adding 100 μL of the diluted cell suspension to each well of a 96-well plate, gently shaking in a cross direction to evenly spread the cells, and culturing at 37°C for 24 h; the next day, adding 200 μL of fresh culture medium containing a series of concentrations of PA to each well, continuing to culture for 24 h, and then observing the cell morphology change under a general optical microscope. After the drug treatment is completed, carefully aspirating the supernatant, adding a small amount of 0.4% trypan blue diluted with PBS to each well, staining at room temperature for 15 min, and then washing twice with PBS to remove excess dye.

8. The cell model of hepatic lipotoxic injury induced by palmitic acid and its construction method as described in claim 1, characterized in that: The cell ATP determination in step four includes: the adherent HepG2 cells treated with 0, 150, and 300μMPAuM for 24h in the 6-well plate are placed on ice, and after the culture medium is aspirated, 200μL of pre-cooled lysis solution is added to each well, and the cells are repeatedly blown to be completely lysed; the lysate is collected and centrifuged at 4°C, 12000rpm for 5min, and the supernatant is transferred to a labeled EP tube for standby; then 0.5mM ATP standard is diluted to a series of concentrations of 0.01-10μM with the reagent kit lysis solution, and 100μL of freshly prepared ATP detection working solution is added to each well of a black 96-well plate, which is incubated at room temperature for 3min to subtract the background, and then 20μL of supernatant sample or each concentration of standard is added, mixed quickly, and after 2s, the RLU value is read with a chemiluminescence instrument, and 3 replicate wells are set for each concentration, and the ATP concentration is converted with a standard curve.

9. The cell model of hepatic lipotoxic injury induced by palmitic acid and its construction method as described in claim 1, characterized in that: The total reactive oxygen species detection in the step five includes: placing the HepG2 cells treated with 0, 150, 300 μM PA for 24 hours respectively on the ice surface, and after the culture medium in the 6-well plate is absorbed respectively, 200 μL of pre-cooled lysis solution is added to each well to fully blow the cells to be lysed; the lysis solution is collected and centrifuged at 12000 rpm for 5 minutes at 4°C, and the supernatant is taken for standby; then 10 mM DCFH-DA is diluted to 10 μM with serum-free medium at a ratio of 1:1000, and the active oxygen positive control Rosu is diluted to 100 μM as a positive control; after the original culture medium is discarded, the negative control hole, the experimental hole and the positive control hole are set, each 2 holes, and incubated at 37°C for 30 minutes in the dark; after incubation, the liquid is discarded, 1 mL of PBS is used to gently blow the cells to completely fall off, the cell suspension is collected into a 1.5 mL EP tube, and centrifuged at 1000 rpm for 5 minutes to discard the supernatant; after washing twice with PBS, the cell suspension is resuspended with 1 mL of PBS to remove the clumps; finally, the DCF fluorescence intensity is detected by flow cytometry with 488 nm excitation and 525 nm emission wavelength, and the total active oxygen level in each treatment group is quantified.

10. The cell model of hepatic lipotoxic injury induced by palmitic acid and its construction method as described in claim 1, characterized in that: The total RNA extraction and real-time fluorescent quantitative PCR in the step six include: first, the total RNA extraction is performed, the 6-hole culture plate prepared in advance for extracting RNA is taken out from the cell culture room, the culture supernatant is absorbed, and PBS is gently washed for 1-2 times; then the culture plate is transferred to the fume hood and placed on the ice, the total RNA extraction reagent is taken out from the 4°C refrigerator, and 500 μL of the reagent is added to the 6-hole plate, which is shaken and mixed on the ice for about 10 minutes; the cells are completely blown off from the bottom of the plate and transferred to a new centrifuge tube which is previously autoclaved and dried, and the tube cap is tightly closed and shaken several times; 100 μL of chloroform is added to each tube, and it is shaken vigorously for 15 seconds and left at room temperature until the lower layer is light purple or pink and the upper layer is colorless. Then the centrifuge tube is placed in a pre-cooled 4°C centrifuge and centrifuged at 12000 rpm for 15 minutes; after centrifugation, the liquid in the tube forms three layers: the upper layer is the required RNA solution, the middle layer is a white precipitate, and the lower layer is a pink organic phase; under light, 200 μL of the upper colorless liquid is taken to a new centrifuge tube, avoiding touching the middle and lower layers; equal volume of isopropanol is added to the obtained liquid, the tube cap is tightly closed, and it is mixed and inverted; after centrifugation for 10-15 minutes, the supernatant is removed and only the precipitate is retained; under light, 1000 μL of gun head is used to suck the supernatant with a 20 μL gun head, without sucking the precipitate, 500 μL of DEPC water containing 75% ethanol is added, the precipitate is suspended by gently inverting, and centrifuged at 4°C for 3-5 minutes; the supernatant is removed again, and the centrifuge tube is placed on the clean bench for short time blowing; finally, 20-30 μL of DEPC water is added to the tube, and the RNA is fully dissolved by shaking.

Images