Application of GhGDSL102 gene in regulation and control of oil content of plant

By regulating the expression of the GhGDSL102 gene, the unknown mechanism of cotton oil accumulation was solved, and the effective regulation of cottonseed oil and fatty acid composition was achieved, significantly increasing or decreasing the oil content and fatty acid content of cotton and Arabidopsis thaliana.

CN121362787APending Publication Date: 2026-01-20INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511914889.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-01-03
Filing Date
2025-12-18
Publication Date
2026-01-20

AI Technical Summary

Technical Problem

The mechanism by which cotton GDSL family genes regulate oil accumulation has not been thoroughly studied in the current technology. The biochemical process and metabolic regulation mechanism of cottonseed oil synthesis need further research, and the genetic improvement of cottonseed oil content has not yet been effectively solved.

Method used

The oil content and fatty acid composition of plants can be regulated by overexpressing or silencing the GhGDSL102 gene. Overexpression of the GhGDSL102 gene reduces the oleic acid C18:1 content, silencing or knocking out the GhGDSL102 gene increases the oleic acid C18:1 content, and inhibiting the expression of the GhGDSL102 gene to regulate the oil content of plants.

Benefits of technology

Overexpression of the GhGDSL102 gene in Arabidopsis thaliana significantly reduced seed oil content and oleic acid C18:1 content, while silencing the GhGDSL102 gene in cotton significantly increased cottonseed oil content and oleic acid C18:1 content, demonstrating that GhGDSL102 is a gene that negatively regulates cottonseed oil content.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121362787A_ABST
    Figure CN121362787A_ABST
Patent Text Reader

Abstract

The invention discloses application of a GhGDSL102 gene in regulating and controlling the oil content of a plant, and belongs to the technical field of gene engineering. The GhGDSL102 gene is over-expressed in arabidopsis thaliana, the oil content of arabidopsis thaliana seeds is obviously reduced by 13.67%, and oleic acid C18: 1 is obviously reduced by 7.7%. After the GhGDSL102 gene is silenced, the oil content and oleic acid content of the cotton seeds are obviously increased by 9.99% and 7.57%. Meanwhile, three transgenic positive strains are obtained through overexpression of cotton, it is found through measurement of the oil content of cotton seeds that the oil content of the three overexpression strains is remarkably reduced by 11.70%, 9.14% and 19.25% respectively compared with that of a control group, and the oleic acid content is reduced by 5.54%, 7.09% and 6.29% respectively; the cottonseed oil content of the obtained homozygous edited strain is remarkably improved by 19.4%, and the GhGDSL102 is proved to be a gene for negatively regulating the cottonseed oil content.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to... GhGDSL102 Application of genes in regulating plant oil content. Background Technology

[0002] cotton( Gossypium spp Cotton is not only an important economic crop in my country, but also the most important natural fiber raw material and a significant source of vegetable oil. Historically, basic research on cotton genetics has primarily focused on cotton fiber quality and yield, with relatively little research on the basic metabolism of cottonseed oil synthesis. Although research on genes related to cottonseed oil synthesis has increased in recent years, further research is needed on the biochemical processes and metabolic regulatory mechanisms of oil synthesis. Therefore, genetic improvement of cottonseed oil content has become an urgent problem to be solved in my country's cotton production.

[0003] GDSL Type I lipase genes play important roles in plant growth, development, anther and pollen development, and responses to biotic and abiotic stresses. However, currently, cotton... GDSL The mechanism by which family genes regulate oil accumulation has not been thoroughly studied. Summary of the Invention

[0004] The purpose of this invention is to provide GhGDSL102 The application of genes in regulating plant oil content aims to address the problems existing in the aforementioned technologies.

[0005] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of this invention, GhGDSL102 Application of genes in regulating plant oil content.

[0006] The second technical solution of this invention is a method for regulating the oil content of plants, through overexpression... GhGDSL102 Genes that reduce the oil content of plants, either by silencing or knocking them out. GhGDSL102 Genes that increase the oil content of plants.

[0007] The third technical solution of the present invention GhGDSL102 Application of genes in altering plant fatty acid composition, overexpression GhGDSL102 Genes that reduce oleic acid C18:1 content, either silenced or knocked out. GhGDSL102 Genes that increase oleic acid C18:1 content.

[0008] The fourth technical solution of this invention is a method for regulating the fatty acid composition of plants, through overexpression. GhGDSL102 Genes that reduce oleic acid C18:1 content, either silenced or knocked out. GhGDSL102 Genes that increase oleic acid C18:1 content.

[0009] The fifth technical solution of the present application is to inhibit the expression of the gene in increasing the oil content of a plant. GhGDSL102 The fifth technical solution of the present application is to inhibit the expression of the gene in increasing the oil content of a plant.

[0010] The sixth technical solution of the present application is to inhibit the expression of the gene in increasing the oleic acid C18:1 content of a plant. GhGDSL102 The sixth technical solution of the present application is to inhibit the expression of the gene in increasing the oleic acid C18:1 content of a plant.

[0011] Based on the above technical solutions, the present application has the following technical effects: The present application overexpresses the gene in Arabidopsis thaliana, and it is found that the oil content of Arabidopsis thaliana seeds is significantly reduced by 13.67%, and the oleic acid C18:1 is significantly reduced by 7.7%. After silencing the gene in cotton, the oil content and oleic acid of cotton seeds are significantly increased by 9.99% and 7.57%, respectively. GhGDSL102 At the same time, three transgenic positive lines are obtained by overexpressing cotton, and it is found that the oil content of the three overexpression lines is significantly reduced by 11.70%, 9.14% and 19.25% compared with the control, and the oleic acid content is reduced by 5.54%, 7.09% and 6.29%, respectively; the oil content of the homozygous edited strain is significantly increased by 19.4%, which proves that the gene is a negative regulator of cotton seed oil content. GhGDSL102 GhGDSL102 The accompanying drawings are described below. The accompanying drawings are described below.

[0012] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings needed in the embodiments will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present application, and other accompanying drawings can be obtained by those skilled in the art without creative labor.

[0013] Figure 1 GhGDSL102 Amplification results.

[0014] Figure 2 GhGDSL102 Vector map used for overexpression of Arabidopsis thaliana.

[0015] Figure 3 In the above-mentioned technical solutions, a. Arabidopsis thaliana seedlings are sprayed with glufosinate herbicide for screening; b. GhGDSL102 PCR detection of positive seedlings of overexpressed Arabidopsis thaliana; c. GhGDSL102 qPCR detection of positive seedlings of overexpressed Arabidopsis thaliana (P <0.01).

[0016] Figure 4 Changes in oil content and fatty acid composition of WT and overexpressed genetically transformed Arabidopsis thaliana seeds, wherein a. GhGDSL102 ​​​a. Changes in oil content in T3 generation seeds of overexpressing plants and wild-type plants; b. Fatty acid composition analysis.

[0017] Figure 5 Virus-induced GhGDSL102 Phenotypic analysis of silent plants. This includes: a. Growth phenotypes of cotton plants in the PDS-positive control and experimental groups; b. VIGS- GhGDSL102 plant GhGDSL102 Gene expression levels in leaves; c.VIGS- GhGDSL102 Oil content in plant leaves; d. VIGS- GhGDSL102 Fatty acid components in plant leaves; e.VIGS- GhGDSL102 Oil content in cottonseed plants; f. VIGS- GhGDSL102 Fatty acid components (P) in cottonseed plants <0.01).

[0018] Figure 6 for GhGDSL102 T0 generation knockout lines. This includes: a. Identification of the T0 generation Cas9 protein; b. Cloning of the T0 generation edited fragment; c. Sequencing results of the edited site in the T0 generation cotton knockout lines.

[0019] Figure 7 for GhGDSL102 T1 generation gene knockout strain editing type.

[0020] Figure 8 for GhGDSL102 T2 knockout gene editing type.

[0021] Figure 9 The map shows the overexpression vector in cotton.

[0022] Figure 10 for GhGDSL102 Identification of cotton with overexpressed genes. Among them, a. GhGDSL102 a. PCR detection of cotton overexpression positive lines; b. In cotton overexpression positive lines GhGDSL102 Gene expression level (P) <0.01).

[0023] Figure 11 for GhGDSL102 Phenotypic analysis of cotton plants overexpressing the gene. Specifically, a. changes in oil content in the overexpression lines; b. changes in fatty acid content (P0.05) in the overexpression cotton. <0.05, P <0.01). Detailed Implementation

[0024] The following detailed description of various exemplary embodiments of the application will not be considered limiting of the application, but rather a description of certain aspects, features, and embodiments of the application.

[0025] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Additionally, for a range of values of a parameter, unless otherwise stated, each intervening value of the parameter is also specifically included within the scope of the present application. The intervening values of the parameter are combined with a stated value of the parameter in range form. These are only exemplary of the various values that can be used, and others will suggest themselves to those skilled in the art upon a reading of the disclosure. Also, various "combinations" can be included, where specific

[0026] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the content of the present specification will control.

[0027] Various modifications and changes can be made to the specific embodiments of the application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The specification and examples given should be considered exemplary only, and should not be used to limit the scope or spirit of the application.

[0028] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0029] The technical solutions described in the present application are conventional solutions in the art, and the reagents or raw materials used are commercially available or have been disclosed, unless otherwise specified.

[0030] The embodiments of the present application provide GhGDSL102 application of the gene in regulating oil content of a plant.

[0031] In some specific embodiments, the plant comprises cotton and Arabidopsis.

[0032] The embodiments of the present application also provide a method for regulating oil content of a plant, overexpressing GhGDSL102 a gene, reducing oil content of a plant, silencing or knocking out GhGDSL102 a gene, and increasing oil content of a plant.

[0033] In some specific implementations, the plants include cotton and Arabidopsis thaliana.

[0034] In some specific implementation schemes, overexpression GhGDSL102 Genes that reduce the oil content of plant seeds, either by silencing or knocking them out. GhGDSL102 Genes that increase the oil content of plant seeds.

[0035] The embodiments of the present invention also provide GhGDSL102 Application of genes in altering plant fatty acid composition, overexpression GhGDSL102 Genes that reduce oleic acid C18:1 content, either silenced or knocked out. GhGDSL102 Genes that increase oleic acid C18:1 content.

[0036] This invention also provides a method for regulating the fatty acid composition of plants, through overexpression. GhGDSL102 Genes that reduce oleic acid C18:1 content, either silenced or knocked out. GhGDSL102 Genes that increase oleic acid C18:1 content.

[0037] Embodiments of the present invention also provide suppression GhGDSL102 Application of gene expression in increasing plant oil content.

[0038] Embodiments of the present invention also provide suppression GhGDSL102 Application of gene expression in increasing the content of oleic acid C18:1 in plants.

[0039] The cotton materials used in this invention are 'Upland Cotton TM-1', 'Zhongmian Institute 24' and 'Bai Mian No. 1', as well as Arabidopsis thaliana of the Colombian type (Col-0). All of these plant materials and germplasm resources are from laboratory reserves.

[0040] Example 1 1 GhGDSL102 Cloning of genes RNA from ovules and fibers of upland cotton TM-1 material at various stages (0, 5, 10, 15, 20, 25, and 30 DPA) was reverse transcribed into cDNA and mixed separately. Using this mixture as a template, and with the aid of the TM-1 reference genome... GhGDSL102 Gene sequence information was used to design a suitable Tm sequence using SnapGene software and the Primer3 website. Specificity was then verified using CottonMD, resulting in the specific primers GhGDSL102-F (SEQ ID NO.1: ATGGACACCCAAAGCTTTC) and GhGDSL102-R (SEQ ID NO.2: TCAGTCAATAAATTGCTTGAGAGT). Using these specific primers, a reaction system was established under low-temperature conditions to achieve… GhGDSL102 Effective amplification of the full-length CDS of the gene.

[0041] The amplification system consisted of: 2×Phanta Max Master Mix 25 μL, Primer F / R (10 μm) 2 μL, cDNA 1.5 μL, and ddH2O 19.5 μL.

[0042] The amplification program was as follows: 95℃ for 3 min; 95℃ for 15 s, 56℃ for 15 s, 72℃ for 40 s, 35 cycles; 72℃ for 5 min; and stored at 4℃.

[0043] After amplification, the bands were confirmed by 1.2% agarose gel electrophoresis (U=115 V, I=125 mA, 24 min). The gel was then recovered, and the GhGDSL102 gene fragment was extracted from the gel.

[0044] The results showed that the amplification was specific, and the target band of 1074 bp was recovered from the gel. Figure 1 The sequencing results of the amplified fragments were compared with the reference genome, and the results showed... GhGDSL102 The similarity to the reference sequence is 100%.

[0045] 2 GhGDSL102 Construction and transformation of overexpression vectors into Agrobacterium The obtained target gene was obtained using BP and LR reactions. GhGDSL102 The expression was ligated into the overexpression vector pEarleyGate 101, and then Arabidopsis thaliana was obtained by infecting it with the flower dip method. GhGDSL102 For overexpression of the gene in Arabidopsis thaliana, the aforementioned DNA fragment was first ligated into the Gateway entry vector. The recovered DNA fragment was then ligated into the pDONR Zeo vector via a BP reaction. The ligation product was then transformed into competent E. coli Trans 5α cells.

[0046] Single clones were selected for bacterial culture identification and then sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Correctly sequenced positive bacterial cultures were selected for plasmid extraction via shaking. 100 μL of the correctly sequenced bacterial culture was added to 5 mL of LB broth containing the corresponding antibiotic and incubated overnight at 37°C and 180 rpm. Plasmid extraction was performed using the EasyPure® PlasmidMiniPrep Kit from Beijing TransGen Biotech Co., Ltd. The correctly sequenced... GhGDSL102 -ZEO introductory vector is linked to pEarleyGate 101 vector via LR reaction.

[0047] The product after ligation with the vector was transformed into competent *E. coli* Trans 5α cells. Single clones were selected for bacterial culture identification. Correctly identified positive bacterial cultures containing the target gene were then subjected to shake culture extraction. GhGDSL102-101 plasmid and transform GV3101 Agrobacterium.

[0048] 3 GhGDSL102 Arabidopsis thaliana genetic transformation (1) Select wild-type Arabidopsis thaliana (Col-0) in full bloom, and remove the formed pods on the plants before transformation. This step helps to improve the probability of obtaining positive plants after transformation.

[0049] (2) Inoculate Agrobacterium containing the GhGDSL102 -101 plasmid into 50 mL of LB liquid medium containing Kan and Rif, and incubate in a conical flask at 28°C, 210 rpm for one night.

[0050] (3) Add the prepared transformation medium (Table 1), and adjust the OD 600 value to 0.8-1, and let the resuspended bacteria stand in the dark for about 3-4 h.

[0051] Table 1 Transformation medium formula

[0052] (4) Gently immerse the inflorescence of each Arabidopsis thaliana into the transformation medium for 60 s, and then treat in the dark for 24 h to allow the GhGDSL102 -101 strain to infect the Arabidopsis thaliana inflorescence. Then grow under normal culture conditions, and wait until the pods of the plants mature, and then harvest the T0 generation seeds.

[0053] 4 GhGDSL102 Screening and identification of transgenic Arabidopsis thaliana The collected T0 Arabidopsis thaliana seeds are first dried and placed in a suitable container with a desiccant to complete the after-ripening process. Then, the treated seeds are sown on a planting tray containing nutrient soil: vermiculite at a volume ratio of 1:1. To ensure that the water uniformly infiltrates the soil from bottom to top, irrigation is performed from the bottom of the tray, and then a layer of transparent plastic film is covered to maintain appropriate humidity. Subsequently, after the seeds are cultured in the growth chamber for one week, they are treated with 10% glufosinate-ammonium herbicide, and sprayed twice a day for one week, and the T1 generation GhGDSL102 overexpression positive plants that grow normally and have green leaves are selected, and the leaf DNA is extracted, and the positive identification is performed by molecular biology methods using universal primers to verify whether the plants successfully integrate GhGDSL102 genes.

[0054] To more clearly GhGDSL102 understand the function, the present application overexpresses GhGDSL102 in Arabidopsis thaliana. The experiment uses the pEarleyGate 101 overexpression vector (Figure 2 Agrobacterium containing the overexpression vector was genetically transformed into wild-type Arabidopsis thaliana using the flower-dipping method. After culturing under normal photoperiod and waiting for maturity, seeds of the mature transgenic T0 generation were harvested. Regarding plant resistance in the pEarleyGate 101 vector, it exhibited resistance to glufosinate-ammonium herbicide. Seedlings were sprayed with 10% glufosinate-ammonium herbicide (…). Figure 3 (a) By spraying herbicides, positive plants were screened, and their DNA was extracted for positive identification. Figure 3 (b) Eight transgenic lines were then selected for propagation. After stable inheritance in the T3 generation, three lines with high expression levels were identified by quantitative real-time PCR. Compared to the wild type, the overexpression lines... GhGDSL102 Gene expression levels increased significantly. Figure 3 (c)

[0055] 5. Determination of oil content and fatty acid composition in Arabidopsis thaliana seeds 20 mg of mature Arabidopsis thaliana seeds were weighed and ground into powder using an automated sample grinder (JXFSTRBP-64, Shanghai Jingxin). The oil content and fatty acid composition of the sample were determined using a Nexis GC-2030 (Shimadzu Corporation, Kyoto, Japan). The method for fatty acid detection is described by Xin et al. (Xin et al. 2022).

[0056] To clarify GhGDSL102 Regarding its effect on plant oil accumulation, this invention screened three overexpression transgenic lines and determined the oil content and fatty acid composition of their T3 generation mature seeds. The results showed that the oil content of the three overexpression lines of Arabidopsis thaliana was significantly reduced by 9.95%, 17.19%, and 13.87% respectively compared to the wild type. Figure 4 (a). The oleic acid (C18:1) content in the seeds of the three overexpression lines of Arabidopsis thaliana was reduced by 4.9%, 10.9%, and 7.3% respectively compared with the wild type (see [reference]). Figure 4 (b) The content of linolenic acid increased by 8.86%, 9.96%, and 8.73%, respectively. These results indicate that... GhGDSL102 Overexpression of the gene in Arabidopsis thaliana can reduce the oil content of mature seeds and also affect the content of oleic acid and linolenic acid in the fatty acid composition of Arabidopsis thaliana seeds.

[0057] 6 VIGS Silent Cotton GhGDSL102 Express (1) Vector construction: Using SnapGene software from GhGDSL102 Design suitable primer pairs for Tm from the CDS sequence, and then test the specificity using Cotton MD. GhGDSL102The 210 bp size of the silencing fragment was cloned in the plasmid, and the PCR product was inserted between the Xbal and BamHI sites of the CLCRV silencing expression vector, and finally the CLCRV::GhGDSL102 recombinant plasmid was obtained.

[0058] (2) Cotton infection: Select 'Zhong 24' with strong growth force as the receptor (already de-fuzzed), soak in water for a day and a night until it is white, then lay it flat in moist nutrient soil. After about 10 days (when the two cotyledons are flat), infect. Activate the correct PCR Agrobacterium CLCRV::GhGDSL102, CLCRV::00, CLCRV::PDS and the auxiliary vector overnight (28°C shaker 210 rpm), centrifuge 5000 rpm for 8 min in a 50 ml centrifuge tube, collect the colonies. Add an appropriate amount of prepared transformation medium and adjust the OD 600 value to 0.8-1, and let the resuspended bacteria stand in the dark for about 3 h. Mix the auxiliary vector with CLCRV::GhGDSL102, CLCRV::00 and CLCRV::PDS respectively according to 1:1, inject into the whole cotyledon of 'Zhong 24' through a 1 mL syringe, and grow normally in the greenhouse after 24 h in the dark.

[0059] (3) Fatty acid detection: After 15 days of injection, the 'Zhong 24' infected by CLCRV::PDS showed albinism, the silencing efficiency of CLCRV::GhGDSL102 was detected, and it was confirmed GhGDSL102 that the expression was inhibited. The CLCRV::GhGDSL102 and CLCRV::00 strains were cut from the third leaf, and the fatty acid components were measured. The collected leaves and harvested seeds were freeze-dried using a vacuum freeze dryer (Christ® Alpha I-5; Martin Christ). The detection method of fatty acids is described in Xin et al. (Xin et al. 2022).

[0060] By VIGS to reduce GhGDSL102 in cotton, PDS injection was performed on the cotyledon when the cotton seedling cotyledon was flat, and yellowing phenotype appeared after about 20 days. Analysis of the yellowing phenotype of CLCrV::PDS plants found that the yellowing phenotype was still relatively obvious in the later growth stage of the plants, indicating that the gene silencing was successful and the silencing efficiency was stable (a in Figure 5 ). The relative expression of GhGDSL102 in CLCrV::00 and CLCrV::GhGDSL102 plants was detected by qRT-PCR, and the expression of CLCrV::GhGDSL102 GhGDSL102 was significantly lower than that of CLCrV::00, indicating that GhGDSL102 was successfully silenced in cotton (b in Figure 5(b) Simultaneously, this invention measured the oil content of leaves of the same location and size on silent cotton plants, as well as the oil content of cotton seeds from mature cotton bolls. The results showed that CLCrV:: GhGDSL102 The oil content in the leaves and cottonseeds of the plants was significantly higher than that in the control group CLCrV::00. The oil content in the leaves of the three silent plants was significantly higher by 35.36%, 13.98%, and 21.45%, respectively. Figure 5 In the middle (c), the oleic acid content in the leaves increased significantly by 52.01%, 27.65%, and 44.45%, respectively. Figure 5 The oil content in cottonseed increased by 12.17%, 8.71%, and 9.11%, respectively (d); Figure 5 In the middle (e), the oleic acid content in cottonseed increased by 8.22%, 4.86%, and 9.63%, respectively. Figure 5 (f)

[0061] The above results indicate that silencing in cotton GhGDSL102 This will increase the oil and oleic acid content in cotton leaves and seeds. The results indicate... GhGDSL102 It plays a role in the synthesis of cottonseed oil and fatty acids.

[0062] 7. Identification of transgenic cotton knockout lines and detection of target sequence editing sites. DNA was extracted from the knockout line of transgenic cotton and identified using Vazyme's 2 × Taq Plus Master Mix II (Dye Plus).

[0063] Detection primers were designed upstream and downstream of the sgRNA target sequences: the upstream primer was 5'-TTCTGAGAACTTCAGTGGCAC-3', and the downstream primer was 5'-GTAACAAAATGACCTAAGGTC-3'. Six nucleotide barcodes were then added to the 5' end of each primer to detect different samples. A total of 20 barcode primers were designed, and the upstream and downstream primers were arranged in a permutation and combination manner. A total of 80 transgenic cotton plants were sequenced in one go. The specific primer sequences are shown in Table 2. The raw paired-end sequencing data were obtained, and the specific mutations and editing efficiency of each plant were obtained using the CRISPR_Barcode_HiTom_Analysis workflow (https: / / github.com / tiramisutes / CRISPR_Barcode_HiTom_Analysis).

[0064] Table 2 Barcode Primer List

[0065] For further researchGhGDSL102 In cotton, the biological function of this study is to construct the CRISPR / Cas9 vector, and to transfect the hypocotyl of Baimian No. 1 seedlings by Agrobacterium tumefaciens liquid. After target point identification, 3 cotton edited strains (a) were obtained in T0 generation. The mutation sites of the three strains were amplified (b), and two types of editing were obtained after sequencing (-1 bp and -2 bp (c)). The results showed that through the precise editing of CRISPR / Cas9 system, the mutation of the gene was realized, and the phenotype of the three edited plants was further identified. GhGDSL102 GhGDSL102 Figure 6 Figure 6 Figure 6 GhGDSL102

[0066] 8 GhGDSL102 Gene editing strain editing target and phenotype analysis T1 generation transgenic plants were planted in Anyang field, a total of 25 single plants (using CR for naming), including 9 strains of CR1, 8 strains of CR2, and 8 strains of CR3. The target sequences of all strains were amplified by PCR, and sequenced by Sanger technology to obtain the editing type of T1 generation plants (). Figure 7 Analysis found that in CR1 strain, except for 3 strains that were not edited, the remaining 6 strains had editing types including deletion of 1 bp; in CR2 strain, 4 strains were not edited, and the remaining 4 strains had editing types including deletion of 1 bp and 5 bp; in CR3 strain, 4 strains were not edited, and the remaining 4 strains had editing types including deletion of 1 bp. T1 generation had two editing types including deletion of 1 bp and 5 bp.

[0067] To determine the editing efficiency of transgenic edited strains, the target sequences of 80 T2 generation transgenic strains were amplified by PCR using barcode primers. The PCR products were mixed and purified, and the editing type of the target sequence was determined by high-throughput sequencing (). Figure 8 The results showed that 39 editing types were deletion of 1 bp pure lines, 29 were deletion of 1 bp heterozygotes, 7 were mainly deletion of 5 bp, and 5 were mainly insertion of 1 bp.

[0068] The oil content of T2 generation harvested seeds was detected using nuclear magnetic resonance oil content detector. Although the T2 generation seeds were obtained less, GC was used to measure the oil content and fatty acid changes when the T3 generation seed phenotype was stable. Among the three edited types of cotton, -1 bp (CR-1), -5 bp (CR-2), and +1 bp (CR-3), CR-1 (-1 bp homozygous line) significantly increased by 19.4%.

[0069] ​​​​​​9. Identification of transgenic cotton overexpression lines Constructed using cotton OE vector—WMV067-AADA+GFP GhGDSL102 -OE vector ( Figure 9 ), and transfected the hypocotyls of Bai Mian No. 1 seedlings, obtaining 9 plants GhGDSL102 Transgenic overexpression cotton lines were identified. The overexpression vector was identified using universal primers. Three overexpression transgenic lines were identified in the T0 generation. Figure 10 (a), and the expression levels of the three overexpression lines were measured. The expression levels of the three overexpression lines GhGDSL102 were significantly higher than those of the wild type. Figure 10 (a) T2 generation transgenic plants were obtained through two generations of continuous self-pollination.

[0070] 10 GhGDSL102 Phenotypic analysis of overexpression transgenic cotton The oil content of mature cottonseed from T2 generation overexpression lines and the control material Bai Mian No. 1, planted in the Sanya breeding field in 2024, was determined by GC. The oil content of the three overexpression cotton lines was significantly reduced by 11.70%, 9.14%, and 19.25% compared with the control material, respectively. Figure 11 In the fatty acid fraction (a), the oleic acid content decreased significantly by 5.54%, 7.09%, and 6.29%, respectively. Figure 11 (b)

[0071] In summary, this invention, through the application of... GhGDSL102 Gene overexpression was used to transform Arabidopsis thaliana, and the seed oil content of the transgenic T3 line was then measured, revealing heterologous expression. GhGDSL102 The expression significantly reduced the oil content of Arabidopsis seeds. Compared with the wild type, the oil content of the three overexpression lines was reduced by 9.95%, 17.19%, and 13.87%, respectively. The oleic acid (C18:1) content of the seeds of the three overexpression lines was reduced by 4.9%, 10.9%, and 7.3%, respectively, compared with the wild type, while the linolenic acid (LAA) content was increased by 8.86%, 9.96%, and 8.73%, respectively. Therefore, it is speculated that heterologous expression of GhGDSL102 in Arabidopsis reduces the C18:1 content, thereby reducing the oil content and affecting the positive regulation of LAA synthesis by this gene.

[0072] Meanwhile, this invention utilizes the virus-induced gene silencing (VIGS) method to... GhGDSL102The function in cotton was preliminarily verified. The results show that after the expression of the gene is significantly reduced, the oil content of the CLCrV::GDSL cotton leaves and cotton seeds of three strains is increased, and in the leaves, the three strains are increased by 35.36%, 13.98% and 21.45% respectively, and in the cotton seeds, the three strains are increased by 12.17%, 8.71% and 9.11% respectively; the content of oleic acid (C18:1) in the leaves and cotton seeds of the three silencing strains is increased compared with the control group, and in the leaves, the three strains are increased by 52.01%, 27.65% and 44.45% respectively, and in the cotton seeds, the three strains are increased by 8.22%, 4.86% and 9.63% respectively, so it is inferred that, GhGDSL102 After silencing in cotton, the content of C18:1 is increased, and then the accumulation of cotton oil is increased, and since the content of linolenic acid in cotton oil is relatively small, no significant change is observed.

[0073] Meanwhile, three positive transgenic strains are obtained by overexpressing cotton, the oil content of T2 generation cotton seeds of the overexpression transgenic cotton plants is determined, and the oil content of the three overexpression strains is significantly reduced by 11.70%, 9.14% and 19.25% respectively compared with the control, and the content of C18:1 in the fatty acid composition is reduced by 5.54%, 7.09% and 6.29% respectively. Among the three edited strains CR-1 (-1bp), CR-2 (-5bp) and CR-3 (+1bp), the oil content of CR-1 (-1bp homozygous strain) is significantly increased by 19.4%. After the T3 generation seeds are harvested, the oil content and fatty acid change are further determined. The above research results show that GhGDSL102 the gene can affect the accumulation of cotton oil, GhGDSL102 it is a gene for negatively regulating the oil content of seeds.

[0074] Obviously, the above embodiments of the present application are only examples for clearly illustrating the present application, and are not intended to limit the embodiments of the present application. For ordinary skilled users in the art, other different forms of changes or variations can be made on the basis of the above description. Here, all the embodiments are not required to be exhausted. Any modification, equivalent replacement and improvement made within the spirit and principle of the present application should be included in the protection scope of the claims of the present application.

Claims

1. GhGDSL102 Use of genes in modulating oil content in plants.

2. Use according to claim 1, characterized in that, The plants include cotton and Arabidopsis.

3. A method of modulating oil content in a plant, comprising, overexpression GhGDSL102 genes that decrease the oil content of a plant, silencing or knocking out GhGDSL102 genes that increase the oil content of a plant.

4. The method of claim 3, wherein, The plants include cotton and Arabidopsis.

5. The method of claim 3, wherein, overexpression GhGDSL102 genes that decrease the oil content of plant seeds, silencing or knocking out GhGDSL102 genes that increase the oil content of plant seeds.

6. GhGDSL102 Use of genes in altering the fatty acid composition of plants, characterized in that, overexpression GhGDSL102 genes, which decrease the oleic acid C18:1 content, are silenced or knocked out GhGDSL102 genes, which increase the oleic acid C18:1 content.

7. A method of modulating the fatty acid composition of a plant, characterized in that, overexpression GhGDSL102 genes, which decrease the oleic acid C18:1 content, are silenced or knocked out GhGDSL102 genes, which increase the oleic acid C18:1 content.

8. Inhibition GhGDSL102 Use of expression of genes in increasing oil content in plants.

9. Inhibition GhGDSL102 Use of the expression of a gene in increasing the oleic acid C18:1 content of a plant.