TsRNA detection primer composition, kit, method and application

Abstract

The invention relates to the field of biotechnology and molecular diagnosis, and discloses a tsRNA detection primer composition, a kit, a method and application, and the primer composition comprises a specific connection primer aiming at a tsRNA target, CRISPR / Cas13a guide RNA, a signal probe and an RT-PCR primer. According to the kit and the method, three modes of fluorescence detection, colorimetric detection and RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection are provided on the basis of the combination of'linker-tailing 'ligation reaction and a CRISPR / Cas13a system. According to the colorimetric detection mode, a Cas13a-mediated in-situ synthesis bimetallic nano-enzyme technology is innovatively introduced, and dual amplification of signals is realized through magnetic separation and nano-enzyme catalytic color development. The method can effectively distinguish tsRNA and female parent tRNA which are highly homologous in sequence, has the advantages of high specificity, high sensitivity, simplicity and convenience in operation and result visualization, and can be widely applied to ultra-sensitive detection of tumor marker tsRNA and related scientific research and clinical auxiliary diagnosis.

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and molecular diagnostics, and particularly to tsRNA detection primer compositions, kits, methods and applications. Background Technology

[0002] Cancer, as a disease that seriously threatens human health, has always had early diagnosis, treatment monitoring, and prognostic assessment as core topics in medical research. In recent years, a class of tRNA-derived small RNAs (tsRNAs) has gradually become a research hotspot. tsRNAs mainly originate from mature tRNAs or pre-tRNAs, and are usually produced under stress conditions such as hypoxia and starvation. In mammals, the anticodon loop of mature tRNA is cleaved by angiopoietin (ANG) to form 5' tiRNA and 3' tiRNA. tsRNAs possess specific secondary structures and various chemical modifications, enabling them to exist stably and widely in body fluids, have a long half-life, and exhibit significant cell and tissue specificity.

[0003] As an emerging non-coding RNA, tsRNA plays a crucial role in tumorigenesis and development, exhibiting rich biological regulatory functions. For example, at the transcriptional level, tsRNA can competitively bind to and inhibit oncogene expression; at the post-transcriptional level, it can inhibit the initiation complex, thereby affecting overall protein synthesis; some tsRNAs can even mimic miRNAs to participate in regulation. Furthermore, tsRNA is widely involved in regulating processes such as the cell cycle and apoptosis, and even initiates reverse transcription and promotes viral synthesis during viral infection. Based on these characteristics, tsRNA shows great potential in clinical applications of oncology.

[0004] In diagnostics, tsRNAs exhibit significant differences in the body fluids of cancer patients. For example, elevated plasma 5-tRF-GlyGCC expression has an area under the curve (AUC) of 0.882 for diagnosing colorectal cancer, while decreased plasma tRF-5026a has an AUC of 0.883. Some tsRNAs in the serum of gastric cancer patients also have extremely high diagnostic value. In prognostic assessment, tsRNA expression levels are closely related to tumor malignancy, metastasis, and recurrence. For instance, analysis of peripheral blood and bone marrow small RNA profiles from acute myeloid leukemia (AML) patients revealed that tsRNAs can not only distinguish between normal individuals and AML patients but also indicate poor prognosis. Adding specific tsRNAs to the traditional International Prognostic Index (IPI) for joint scoring can significantly address the problem of inaccurate intermediate / high-risk stratification.

[0005] Despite the high clinical value of tsRNA, its research and application still face significant challenges in detection technology, mainly in the following aspects:

[0006] 1. High sequence homology (core pain point): The tsRNA is completely identical to the maternal tRNA sequence. Conventional detection methods have difficulty distinguishing between free tsRNA fragments and full-length mature tRNA, making it impossible to know the true abundance of tsRNA.

[0007] 2. Low abundance and small fragment size: tsRNA molecules are typically 18-30 nt in length, similar to miRNAs, and have low abundance in body fluids, requiring ultrasensitive and highly specific detection systems for accurate capture.

[0008] 3. Existing technologies have significant limitations: Currently, the main methods for detecting tsRNA include small RNA sequencing, RT-PCR, and Northern Blot. These methods suffer from drawbacks such as large sample requirements, cumbersome procedures, long detection cycles, and reliance on expensive equipment and specialized personnel. In particular, they fail to meet the clinical demand for rapid, low-cost, and easily interpretable detection methods.

[0009] To address these challenges, emerging biosensing technologies offer novel approaches. The CRISPR / Cas13a system, with its isothermal high specificity and strong signal amplification capabilities, recognizes target RNA under crRNA guidance and activates its trans-cleavage activity, efficiently cleaving surrounding reporter molecules and achieving cascaded signal amplification. Furthermore, metal nanozymes, as artificial enzymes combining the properties of nanomaterials with the catalytic activity of enzymes, offer advantages over natural enzymes, including high stability, low cost, and ease of preparation. Bimetallic nanozymes, in particular, achieve a synergistic catalytic performance advantage ("1+1>2") through electronic coupling and spatial synergy between the two metals, and the interaction between the two atoms prevents metal aggregation, making them more suitable for complex biomedical scenarios. Summary of the Invention

[0010] In view of this, the purpose of this invention is to provide tsRNA detection primer compositions, kits, methods and applications that can overcome the technical problems existing in the current tsRNA detection technology, such as the inability to accurately distinguish tsRNA from maternal tRNA, low detection sensitivity, reliance on expensive equipment and lack of visualization detection methods, and to achieve a visually intuitive presentation of results.

[0011] The present invention solves the above-mentioned technical problems through the following technical means:

[0012] In a first aspect, the present invention provides a tsRNA detection primer composition, the primer composition comprising:

[0013] Group A: Primers used for the ligation reaction, including 5' Prime-Gly-GCC nucleotide sequences as shown in SEQ ID No. 1 and 3' Prime-Gly-GCC nucleotide sequences as shown in SEQ ID No. 2; the 5' end of the nucleotide sequence of SEQ ID No. 1 is modified with a phosphate group and the 3' end is modified with an amino group;

[0014] Group B: Guide RNAs for CRISPR / Cas13a reactions, including 5'crRNA-Gly-GCC with nucleotide sequences as shown in SEQ ID No. 3 and 3'crRNA-Gly-GCC with nucleotide sequences as shown in SEQ ID No. 4;

[0015] Group C: Nucleic acid probes for signal output, selected from probes with nucleotide sequences as shown in SEQ ID No. 5 or RNA reporters with nucleotide sequences as shown in SEQ ID No. 6;

[0016] Group D: Primer pairs used for RT-PCR amplification, selected from primer pairs consisting of nucleotide sequences such as SEQ ID No. 7 and SEQ ID No. 8, and / or primer pairs consisting of nucleotide sequences such as SEQ ID No. 9 and SEQ ID No. 10.

[0017] The five RNA sequences (SEQ ID No. 1-SEQ ID No. 4, SEQ ID No. 6), one DNA and RMA mixed sequence (SEQ ID No. 5), and four DNA sequences (SEQ ID No. 7-SEQ ID No. 10) designed in this invention are as follows:

[0018] 5'Prime-Gly-GCC (SEQ ID No. 1):

[0019] 5P-GCGAGCACAGAGAGAUAACGACUC-NH2.

[0020] 3'Prime-Gly-GCC (SEQ ID No. 2):

[0021] GCGAGCACAGAGAGAUAACGAAUA.

[0022] 5'crRNA-Gly-GCC (SEQ ID No.3):

[0023] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCUCUGUGCUCGCGCGAGAAUUCUACCAC.

[0024] 3'crRNA-Gly-GCC(SEQ ID No.4):

[0025] GAUUUAGACUACCCCAAAAAACGAAGGGGACUAAAACCGAACCCGGGCCUCUAUUCGUUAUCUCU。

[0026] probe(SEQ ID No.5):

[0027] 5'Biotin-rU / rA / rU / rA / rU / rA / rU / rA / rU / rA / rU / ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAAT。

[0028] RNA reporter(SEQ ID No.6):

[0029] FAM-UAUAUA-BHQ1

[0030] 5'Universal prime-R(SEQ ID No.7)

[0031] GAGTCGTTATCTCTCTGTGCTCGC。

[0032] 5'prime-F(SEQ ID No.8)

[0033] GCATTGGTGGTTCAGTGGTAGAAT。

[0034] 3'prime-R(SEQ ID No.9)

[0035] TGCATTGGCCGGGAATCGAACCCG。

[0036] 3'Universal prime-F(SEQ ID No.10)

[0037] GCGAGCACAGAGAGATAACGA.

[0038] In a second aspect, the present invention provides a tsRNA detection kit, comprising the primer composition described above, and an enzyme reaction system for ligating tsRNA, the enzyme reaction system comprising RNA ligase and its reaction buffer, ATP and a coagulant; the kit is also optionally selected from one or more of the following detection systems: (1) CRISPR / Cas13a fluorescence detection system: containing Cas13a protein; (2) CRISPR / Cas13a colorimetric detection system: containing Cas13a protein, magnetic beads, and platinum and palladium salts for constructing nanozymes; (3) RT-PCR detection system: containing reverse transcriptase and DNA polymerase.

[0039] Preferably, when used for fluorescence detection, the primer composition comprises SEQ ID No. 1-SEQ ID No. 4 and SEQ ID No. 6; when used for colorimetric detection, the primer composition comprises SEQ ID No. 1-SEQ ID No. 4 and SEQ ID No. 5, and the kit further comprises a reducing agent and a chromogenic substrate; when used for RT-PCR detection, the primer composition comprises at least one pair of SEQ ID No. 1-SEQ ID No. 2 and SEQ ID No. 7-SEQ ID No. 10.

[0040] Thirdly, the present invention provides the use of the above-described primer composition or the above-described kit in the preparation of products for detecting tsRNA abundance.

[0041] Fourthly, the present invention provides the application of the kit described above in the preparation of products for detecting tsRNA abundance, wherein the detection using the kit includes a "linker-tailing" ligation step and a signal detection step;

[0042] The "connector-tailing" ligation step includes: establishing a "tailing" system for the 5'tsRNA target: mixing the RNA sample to be tested with the primers, RNA ligase and auxiliary reagents shown in SEQ ID No. 1, and performing a ligation reaction; establishing a "connector" system for the 3'tsRNA target: mixing the RNA sample to be tested with the primers, RNA ligase and auxiliary reagents shown in SEQ ID No. 2, and performing a ligation reaction;

[0043] The signal detection step is selected from one or more of CRISPR / Cas13a-mediated fluorescence detection, CRISPR / Cas13a-mediated colorimetric detection, and RT-PCR detection.

[0044] Preferably, in the "connector-tailing" ligation step, the volume ratio of each component is as follows: 1 part of primer SEQ ID No.1 or SEQ ID No.2 at a concentration of 1 μM, 1-3 parts of ligase buffer, 0.5-2 parts of ATP, 3-7 parts of PEG-8000, 0.5-2 parts of T4 RNA Ligase, and 3-7 parts of RNA sample; the reaction conditions are: incubation at 30-45℃ for 60-100 min.

[0045] Preferably, the signal detection step is CRISPR / Cas13a-mediated fluorescence detection, and the specific steps include:

[0046] S1. The tailed product is mixed with Cas13a protein, crRNA shown in SEQ ID No.3, and RNAreporter shown in SEQ ID No.6, and fluorescence signals are collected. The abundance of 5'tsRNA is determined based on the fluorescence signal intensity.

[0047] S2. The adapter product is mixed with Cas13a protein, crRNA shown in SEQ ID No. 4, and RNAreporter shown in SEQ ID No. 6, and fluorescence signals are collected; the abundance of 3'tsRNA is determined based on the fluorescence signal intensity.

[0048] More preferably, the stronger the fluorescence signal, the higher the tsRNA abundance; no fluorescence signal indicates the absence of tsRNA.

[0049] Preferably, the signal detection step is a CRISPR / Cas13a-mediated colorimetric detection, specifically including the following steps:

[0050] A1. Preparation of magnetic bead probe: Magnetic beads are combined with the probe shown in SEQ ID No. 5;

[0051] A2. Shearing reaction: The tailed product and the linker product were mixed and reacted with Cas13a protein, group B crRNA and MB@probe, respectively;

[0052] A3. Nanozyme color development: Platinum salt, palladium salt and reducing agent are added to the reaction system to form bimetallic nanozymes in situ. After magnetic separation and washing, colorimetric substrate is added; the abundance of tsRNA is determined based on the colorimetric signal intensity.

[0053] More preferably, the weaker the colorimetric signal, the higher the tsRNA abundance; the stronger the colorimetric signal, the lower the tsRNA abundance.

[0054] Preferably, in step A3, the platinum salt is K2PtCl4, the palladium salt is K2PdCl4, the reducing agent is NaBH4, and the chromogenic substrate includes TMB and H2O2; the reaction time for in-situ formation of nanozymes is 1-5 min, and the chromogenic reaction time is 10-20 min.

[0055] Preferably, the signal detection step is RT-PCR detection, specifically including: using the tailed product or the adapter product as a template, amplifying the product using the primer pair described in group D under the action of reverse transcriptase and DNA polymerase; performing gel electrophoresis analysis on the amplified product, the band appearing at 50-55bp is tsRNA, the band appearing at 100-110bp is maternal tRNA, and the brighter the band, the higher the tsRNA abundance.

[0056] This invention develops a novel tsRNA detection method, which involves two steps: tsRNA elongation and tsRNA recognition and CRISPR / Cas13a system signal output. First, tails and adapters are designed for 5' tsRNA and 3' tsRNA, respectively. Under the action of T4RNA Ligase 1, the 5' tsRNA is tailed at the 3' end, and the 3' tsRNA is adaptered at the 5' end, thus elongating the tsRNA (…). Figure 1 A). Notably, its parental tRNA is also head-terminated. Then, 5'crRNA and 3'crRNA were cleverly designed to specifically recognize the elongation product. Specifically, the recognition region (28 nt) of the crRNA recognizes either the linker or tail on one side, and specifically recognizes either 5'crRNA or 3'crRNA on the other. In other words, only specific tsRNAs that have completed head-termination or tail addition can be fully complementary to the crRNA, activating the Cas13a system. In the dual-mode, the fluorescence signal is generated by an RNA reporter modified with FAM and BHQ1, which acts as a trans-cleavage substrate for Cas13a activation, producing significant fluorescence upon cleavage. Figure 1 C). The visualized colorimetric signal is generated by a PtPd bimetallic nanozyme attached to a probe on the surface of a magnetic bead (MB). Specifically, the probe consists of two parts: a 5' DNA end and a 3' RNA end containing 6 nt, facilitating recognition by Cas13a trans-cleavage activity. Biotin modified at the RNA end enriches the probe onto MBs modified with streptavidin (C). Figure 1 B). At the same concentration of Pt 2+ and Pd 2+Under the action of NaBH4, a bimetallic nanozyme PtPd is formed using DNA as the growth nucleus. This metal nanozyme exhibits very strong peroxidase-like activity, catalyzing the conversion of TMB to oxTMB within 2 minutes, resulting in a blue color. Utilizing this property, in the presence of tsRNA, the probe is cleaved and detached from the microplate (MB). After washing and magnetic separation, the remaining PtPd decreases, and TMB does not develop color. In the absence of tsRNA, the probe and PtPd on the MB are retained, rapidly catalyzing the color development of TMB. In summary, the output mode of tsRNA is strong fluorescence with weak colorimetry (colorless). Figure 1 D), while other RNAs, including homologous maternal tRNA, produce a non-fluorescent, strong colorimetric signal (blue). Figure 1 E).

[0057] The beneficial effects of this invention are:

[0058] (1) This invention employs a unique "connector-tailing" strategy to lengthen tsRNA, avoiding the problem of missed detection due to short fragments. Utilizing the efficient ligation characteristics of T4 RNA Ligase 1 for single-stranded small RNA fragments (tsRNA), combined with the high specificity recognition of the CRISPR / Cas13a system, it can accurately distinguish short-chain tsRNA from long-chain maternal tRNA (pre-tRNA or mature tRNA) with complex folding structures, thereby revealing the true abundance of tsRNA. This invention enhances anti-interference capabilities, enabling accurate identification of low-abundance tsRNA among a large number of maternal tRNAs, with a detection limit as low as 0.17%, achieving precise identification of highly homologous tsRNAs and tRNAs.

[0059] (2) In colorimetric detection mode, this invention combines the "reverse cleavage" cascade amplification effect of CRISPR / Cas13a with the highly efficient catalytic amplification effect of bimetallic nanozymes (PtPd). Once activated, Cas13a can continuously cleave the probe, while the in-situ generated PtPd nanozymes have a synergistic catalytic activity of "1+1>2". The combination of the two greatly reduces the detection limit to as low as 3.47 fM, which is 10 times higher than the sensitivity of traditional techniques. 5 This can avoid missed detections caused by insufficient sensitivity.

[0060] (3) This invention integrates three modes: fluorescence (precise quantification), colorimetry (intuitive, no need for expensive instruments, suitable for POCT on-site testing), and RT-PCR (traditional verification). Users can flexibly choose according to laboratory conditions and testing needs. This invention is simple to operate, uses isothermal reactions, does not rely on large instruments, has low cost, and is suitable for clinical environments. Attached Figure Description

[0061] Figure 1This diagram illustrates the dual-mode fluorescence-colorimetric detection of tsRNA using Cas13a based on a "linker-tailing" ligation reaction and a bimetallic nanozyme. In the diagram, A represents the "linker-tailing" ligation reaction; B represents MB@Probe preparation; C represents Cas13a fluorescence mode detection of tsRNA; and D and E represent the principles of Cas13a colorimetric mode detection in the presence and absence of tsRNA, respectively.

[0062] Figure 2 For screening metal nanozymes, the figures show the absorbance changes of Pt, Pd, Co, PtPd, PtCo, PdCo, ​​and PtPdCo at 370 nm over 40 min; H represents the color changes of different metal nanozymes catalyzing TMB color development after 40 min; and I represents the optimization of the concentration of PtPd generated by NaBH4 catalysis.

[0063] Figure 3 The figures show the morphology and elemental characterization of PtPd. Figure A shows the morphology and lattice of PtPd measured by HRTEM, and Figure B shows the surface elements of PtPd characterized by XPS energy dispersive spectroscopy.

[0064] Figure 4 To investigate the morphology and elemental composition of MB@DNA@PtPd, the figure shows: A. TEM imaging of MB@DNA@PtPd; B. EDS spectroscopy characterization of the elemental composition of MB@DNA@PtPd.

[0065] Figure 5 To investigate the elemental composition of MB@DNA@PtPd, in the figure, A is the XPS energy dispersive spectroscopy characterizing the surface elements of MB@DNA@PtPd; B and C are the XRD characterizing the elemental composition of PtPd and MB@DNA@PtPd, respectively; D is the potential of probe, streptavidin-modified MB (SA-MB), and SA-MB@probe tested by Zeta testing.

[0066] Figure 6 To demonstrate the sensitivity of this invention, in the figure, A shows the PAGE test of the elongation ability of T4 RNA Ligase 1 on tsRNA and tRNA; B and D show the fluorescence signals and images under UV light after testing different concentrations of tsRNA; C shows the linear relationship between fluorescence signal and tsRNA concentration; E and F show the absorbance and color changes at 370 nm after testing different concentrations of tsRNA; and G shows the linear relationship between absorbance at 370 nm and tsRNA concentration.

[0067] Figure 7 For the specificity test of the present invention, in the figure, A and B show the specificity of the fluorescence signal test method and the fluorescence signals of different RNAs under ultraviolet light; C and D show the specificity of the colorimetric signal test method and the color changes of different RNAs.

[0068] Figure 8 For the interference resistance, repeatability and reproducibility tests of the present invention, the figures show: A and E are fluorescence and colorimetric signals of tsRNA and tRNA mixtures with different ratios; B and F are fluorescence signals and linear relationships between absorbance and ratio; C and D are fluorescence and colorimetric signals of mixtures with different ratios under ultraviolet and incandescent lamps; and G, H, I and J are the repeatability and reproducibility test results.

[0069] Figure 9 The figure shows the principle and sensitivity test of RT-PCR based on "adaptor-tailing". A is a schematic diagram of the principle; B is the optimization of RT-PCR annealing temperature; C is the sensitivity test of 5'tsRNA; D is the sensitivity test of 3'tsRNA; E is the anti-interference ability test of 5'tsRNA; F is the anti-interference ability test of 3'tsRNA.

[0070] Figure 10 For the specificity and reproducibility tests of RT-PCR based on "adaptor-tailing", A and B in the figure represent specificity tests; C and D represent repeatability and reproducibility tests of 5'tsRNA and 3'tsRNA.

[0071] Figure 11 To test the abundance of tsRNA in cells using a Cas13a-based fluorescence-colorimetric dual-mode detection method, the figures show: A and C: fluorescence intensities of 5'tsRNA and 3'tsRNA in HEK293 cells at different concentrations; B and D: linear relationships between 5'tsRNA and 3'tsRNA fluorescence intensities and cell concentration, respectively; E: colorimetric spectra and color changes of 3'tsRNA in HEK293 cells at different concentrations; and F: linear relationship between absorbance at 370 nm and cell concentration.

[0072] Figure 12 To test the abundance of tsRNA in mouse blood using a Cas13a-based fluorescence-colorimetric dual-mode detection method, the figure shows the fluorescence intensity of 5'tsRNA and 3'tsRNA in the blood of healthy mice and AML mice (A, B, and D) and their intensity under UV light; and the absorbance of 3'tsRNA in healthy mice and AML mice (C and E).

[0073] Figure 13 To illustrate the application of RT-PCR in actual sample detection, in the figure, A and B show the RT-PCR detection of the abundance of 5'tsRNA and 3'tsRNA in cells at different concentrations; C and D show the RT-PCR testing of the abundance of 5'tsRNA and 3'tsRNA in the blood of healthy mice and mice with leukemia.

[0074] Figure 14To test the abundance of 5'tsRNA and 3'tsRNA in the serum of healthy volunteers and AML patients using a Cas13a-based fluorescence-colorimetric dual-mode detection method, the figure shows the fluorescence intensity of 5'tsRNA and 3'tsRNA in the serum of each healthy volunteer and AML patient, as well as their intensity under UV light, in A, B, C, and D; and the absorbance and color change of 3'tsRNA in the serum of each healthy volunteer and AML patient, in E and F.

[0075] Figure 15 To illustrate the application of RT-PCR in AML patients, Figure A and B show the abundance of 5'tsRNA and 3'tsRNA in the serum of healthy volunteers and AML patients, respectively, using RT-PCR. Detailed Implementation

[0076] The technical solutions of the present invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0077] Example 1: Construction and screening of bimetallic nanozymes.

[0078] Add 1 μL of 20 mM NaBH4 to 5 μL of 20 mM K2PtCl4, 5 μL of 20 mM K2PdCl4, 5 μL of 20 mM CoCl2·6H2O, 5 μL of a mixture of 20 mM K2PtCl4 and K2PdCl4, 5 μL of a mixture of 20 mM K2PtCl4 and CoCl2·6H2O, 5 μL of a mixture of 20 mM CoCl2·6H2O and K2PdCl4, 5 μL of a mixture of 20 mM K2PdCl4, K2PtCl4 and CoCl2·6H2O, and react for 2 min to form single-metal nanozymes Pt, Pd and Co, bimetallic nanozymes PtPd, PtCo and PdCo, ​​and trimetallic nanozymes PtPdCo. Add 5 μL of each nanozyme to 50 μL of TMB and 50 μL of H2O2, and record their respective color changes and absorbance at 370 nm.

[0079] To screen for the best-performing metal nanozymes, this invention tested the performance of Pt, Pd, and Co. Under the action of NaBH4, Pt... 2+ Pd 2+ and Co 2+ It is reduced to its elemental form. For example... Figure 2A-2H, Pt can rapidly catalyze TMB color development, Pd's catalytic activity is time-dependent, while Co's catalytic performance is the weakest, with no obvious signal. PtPd bimetallic nanozymes rapidly reach a signal plateau within 10 minutes, and their catalytic effect is significantly stronger than that of single-metal nanozymes Pt and Pd, while PtCo and PdCo show no significant enhancement in catalytic performance. This may be because Pt provides electrons to Pd, forming a symbiotic structure that enhances the performance of both. PtPdCo trimetallic nanozymes can reach maximum signal in a short time, with a catalytic efficiency higher than PtPd bimetallic nanozymes. However, due to its rapid catalysis, changing quickly from blue to green and then brownish-yellow, this rapid change is not conducive to stable signal acquisition. The optimal concentration of NaBH4 is 5 mM (…). Figure 2 I). In summary, to achieve rapid and stable signal output, this invention selects PtPd bimetallic nanozymes as the colorimetric signal output element.

[0080] Example 2: Morphology and elemental composition characterization of PtPd and MB@Probe@PtPd.

[0081] As an important sensing element for colorimetric sensors, PtPd was first synthesized using high-resolution transmission electron microscopy (HRTEM), XPS, and XRD to verify its synthesis. HRTEM morphology and size analysis showed that the PtPd particle size distribution ranged from 1 to 3.7 nm, mainly concentrated at 2.2 nm, and exhibited good dispersibility. The lattice spacing of the PtPd nanoparticles was 0.233 nm. Figure 3 A). The crystallization characteristics of PtPd were investigated using XRD. Due to the small particle size of PtPd, the diffraction peaks were weak. Figure 5 B). Diffraction peaks corresponding to Pt were found at 39.892° and 46.395° (PDF 87–0640), and diffraction peaks corresponding to Pd were found at 39.924° and 46.433° (PDF 87–0643). XPS technology was used to characterize the surface elemental composition and valence state of PtPd. Figure 3 In the energy spectrum shown in B, photoelectron signals of Pd 3d and Pt 4f elements can be observed (based on a C 1s (284.8 eV) calibration baseline). The Pt 4f peak is resolved into four peaks with binding energies of 76.08 eV and 72.78 eV, corresponding to Pt 3d and Pt 4f respectively. 2+ 4f 5 / 2 and Pt 2+ The binding energies of 74.18 eV and 70.68 eV correspond to Pt 4f 5 / 2 and Pt 4f 7 / 2, respectively. In the X-ray photoelectron spectrum of Pd 3d electronic states, the Pd 3d 3 / 2 peak at 343.08 eV and the Pd 3d 5 / 2 peak at 337.88 eV are attributed to Pd 4f 7 / 2. 2+The binding energies at 339.98 eV and 334.78 eV correspond to Pd, respectively. 0 3d 3 / 2 and Pd 0 3d 5 / 2. The above data proves the successful synthesis of PtPd.

[0082] This invention constructs an MB@probe@PtPd signal output terminal for tsRNA colorimetric detection, and first explores the characteristics of MB@probe@PtPd. For example... Figure 4 A. TEM morphology and size analysis showed that MB@probe@PtPd was between 230 and 275 nm, with a distinct transparent ring at the edge of MB, indicating successful DNA-PtPd attachment to MB. Elemental characterization revealed the presence of C, N, O, P, Fe, Pd, and Pt elements on the individual material. Figure 4 B). Surface elemental characterization by XPS revealed photoelectron signals containing C1s, N1s, P2p, O1s, Pd 3d, and Pt 4f elements. Figure 5 A). The Pt 4f peak in MB@probe@PtPd was resolved into four peaks with binding energies of 77.18 eV and 71.68 eV, corresponding to Pt... 2+ 4f 5 / 2 and Pt 2+ The binding energies of 74.48 eV and 70.78 eV correspond to Pt 4f 5 / 2 and Pt 4f 7 / 2, respectively. In the X-ray photoelectron spectrum of Pd 3d electronic states, the Pd 3d 3 / 2 peak at 342.48 eV and the Pd 3d 5 / 2 peak at 337.68 eV are attributed to Pd 4f 7 / 2. 2+ The binding energies at 340.38 eV and 335.28 eV correspond to Pd, respectively. 0 3d 3 / 2 and Pd 0 3d 5 / 2. Compared to PtPd materials, their peak shift is likely due to interactions with DNA. In XRD analysis, C appeared in the energy spectrum. 10 N9P3O 12 The corresponding diffraction peaks of Fe3O4 (PDF 72–2134), Pd (PDF 75–0449), and Pt (PDF 87–0643) are shown in PDF 87–0640. Figure 5 C). Finally, this invention tested the Zeta potential of probe, streptavidin-modified MB (SA-MB), and SA-MB@probe, and found that SA-MB@probe, like probe, exhibited a negative charge (C). Figure 5 (D) indicates that the almost uncharged MB successfully bound a large number of probes. The above data fully proves that MB@probe@PtPd was successfully synthesized.

[0083] Example 3: Investigation of the sensitivity, specificity, and repeatability of fluorescence-colorimetric dual-mode technology based on the Cas13a system.

[0084] To test the performance of the method, this invention uses different concentrations and ratios of 5'tsRNA-Gly-GCC (GCAUUGGUGGUUCAGUGGUAGAAUUCUCGC), tRNA-Gly-GCC (5P-GCAUUGGUGGUUCAGUGGUAGAAUUCUCGCCUGCCACGCGGGAGGCCCGGGUUCGAUUCCCGGCCAAUGCA), and 3'tsRNA-Gly-GCC (5P-GAGGCCCGGGUUCGAUUCCCGGCCAAUGCA) as targets to participate in the reaction.

[0085] The "head-tailing" step is the tsRNA extension step and is fundamental to recognition. This invention first investigates the efficiency of the ligation reaction, such as... Figure 6 A. After attaching a tail to the 3' end of 5' tsRNA and a adapter to the 5' end of 3' tsRNA, the fragments significantly increased in size (lines 7 and 10). Similarly, after adding a head and tail to the parent tRNA, fragment enlargement was observed (lines 6 and 9), indicating that T4 RNA Ligase 1 effectively elongates tsRNA. Furthermore, this invention investigates the Cas13a system's ability to recognize tsRNA. Figure 6 For B and 6D, the fluorescence signal increased continuously with increasing tsRNA concentration. Under UV light, fluorescence was observed even at concentrations as low as 0.5 nM tsRNA. A good linear relationship was observed between fluorescence signal and concentration from 1 nM to 100 nM. Figure 6 C), with a detection limit as low as 0.44 nM. On the other hand, the addition of dual nanozymes significantly expands the detection range, such as... Figure 6 For E and 6F, the blue color gradually deepens from 100 nM to 10 fM as the concentration decreases. This is calculated based on the linear relationship between absorbance at 370 nm and concentration, and the 3σ rule. Figure 6 (G), with a detection limit as low as 3.47 fM. Compared with other methods, the method developed in this invention has greater practical advantages in terms of time, detection limit, and accuracy.

[0086] This invention further explores the specificity of fluorescence and colorimetric detection methods for tsRNA. For example... Figure 7In A and 7B, among numerous tsRNAs and tRNAs at concentrations 10 times higher, tsRNA-Gly and tsRNA mixtures (including Mix-tsRNA and Mix, which contain tsRNA-Gly and other RNAs) exhibited significant fluorescent signals; among similarly short miRNA fragments, only tsRNA showed a clear fluorescent signal; in mixtures, the Cas13a system, with the assistance of crRNA, could also successfully identify tsRNA. Similarly, in colorimetric detection methods, such as... Figure 7 In C and 7D, among various RNAs, tsRNA-Gly and tsRNA mixtures (including Mix-tsRNA and Mix, which contain tsRNA-Gly and other RNAs) showed the lightest color. Other RNAs, including maternal tRNA, were similar to the control, exhibiting a deep blue color. This demonstrates that fluorescence and colorimetric detection methods have high specificity in tsRNA detection and are not affected by interference from other RNAs.

[0087] It is worth noting that tsRNA originates from maternal tRNA, and the two share 100% sequence homology. This means that during sequence recognition, the greatest interference to tsRNA comes from tRNA itself. To test the interference of the method, this invention tests the signals of mixtures of tsRNA / tRNA at different ratios. For example... Figure 8 A. As the proportion of tsRNA gradually decreases, the fluorescence signal gradually weakens, and a mixture as low as 1% can be identified under ultraviolet light. Figure 8 C); The colorimetric signal gradually increases, and the blue color gradually deepens as perceived by the naked eye. Figure 8 E and 8D). Fitting revealed that the fluorescence signal and colorimetric signal exhibited good linear relationships with the ratio and followed the 3σ rule, respectively. Figure 8 (B and 8F), the calculated fluorescence detection limit is as low as 0.7%, and the colorimetric detection limit is as low as 0.17%.

[0088] Next, the reproducibility of the method was tested. Through repeated experiments by different researchers and the same researcher, the RSD of the fluorescence signal was found to be 4.86% and 3.71%; the RSD of the colorimetric signal was 4.59% and 3.60%. Figure 8 The percentages (G-8J) are all less than 5%, which fully demonstrates that the method has good reproducibility and repeatability.

[0089] Furthermore, to compare performance with traditional methods, this invention developed an RT-PCR technique based on "adaptor-tailing": According to other literature on RT-PCR techniques for tsRNA detection (adding polyA to the 3' end of tsRNA before RT-PCR), this technique cannot distinguish between 3' tsRNA and maternal tRNA. This is because the primers specifically bind to the same position as 3' tsRNA or maternal tRNA, resulting in identical sequences that cannot be distinguished. Therefore, this invention constructs an RT-PCR technique based on "adaptor-tailing": a tail sequence is added to the end of 5' tsRNA; under the action of specific primers, the amplification products of 5' tsRNA and maternal tRNA have different lengths; an adapter sequence is added to the 5' end of 3' tsRNA, such as... Figure 9 A. Extend tsRNA. Similarly, utilizing the length difference between 3' tsRNA and the parental tRNA, products of different lengths were amplified, and the 3' tsRNA and parental tRNA were clearly distinguished by electrophoresis. At the optimal annealing temperature (61.8℃), Figure 9 B), RT-PCR can detect as low as 100 nM 5'tsRNA and 100 pM 3'tsRNA (B). Figure 9 C and 9D). This technique has strong anti-interference capabilities, and can identify as low as 1% 5' tsRNA and 10% 3' tsRNA in mixtures of different proportions of tsRNA and tRNA. Figure 9 E and 9F). Further studies revealed that this technique has good specificity, with corresponding bands appearing only in tsRNA or mixtures containing tsRNA. Figure 10 A-10B). Meanwhile, the "adaptor-tailing" RT-PCR technology exhibits high reproducibility and repeatability. Figure 10 (C-10D). Although the newly developed RT-PCR technology performs better than traditional techniques, it is still slightly inferior to the fluorescence-colorimetric dual-mode technology based on Cas13a and bimetallic nanozymes. This technology is 200-10 times more sensitive than RT-PCR. 5 It is twice as fast and has stronger anti-interference ability (detection limit as low as 0.17%).

[0090] Example 4: Cell detection.

[0091] HEK293 cells were serially diluted, and RNA was extracted from each cell. The method described in this invention was used to detect 5' tsRNA and 3' tsRNA, respectively. As cell concentration decreased, fluorescence intensity continuously decreased (…). Figure 11 A and 11C), the colorimetric signal gradually increases ( Figure 11 E). This indicates that as cell concentration decreases, the concentration of extracted total RNA decreases, including a decrease in tsRNA abundance. The lowest concentration resolvable under UV light and the naked eye is 10.4 cells·mL -1 Both fluorescence and colorimetric signals showed a good linear relationship with cell concentration. Figure 11 (B, 11D, and 11F), calculated according to the 3σ rule, the detection limit is 570 cells·mL. -1 (5' tsRNA fluorescence mode), 714 cells·mL -1 (3' tsRNA fluorescence mode), 2.22 cells·mL -1 (Colorimetric mode).

[0092] Furthermore, RT-PCR was used to detect tsRNA in HEK293 cells at different concentrations. The results showed that RT-PCR could detect 10 tsRNAs of 5' tsRNA and 10 tsRNAs of 3' tsRNA, respectively. 5 and 10 6 cells·mL -1 For tRNA, this technology can detect levels as low as 10. 4 cells·mL -1 ( Figure 13 (A-13B). The concentration difference may be due to concentration coverage in PCR. Specifically, in cells, the concentration of tsRNA is lower than that of tRNA, and PCR amplification preferentially selects the higher concentration, resulting in a reduced probability of amplifying the lower concentration target. In contrast, fluorescence and colorimetric detection techniques based on Cas13a and bimetallic nanozymes have higher detection capabilities, with detection limits as low as 570 cells / mL. -1 (Fluorescence) and 2.22 cells·mL -1 (Colorimetric analysis). This is due to the trans-cleavage activity of Cas13a and the signal amplification capability of the bimetallic nanozyme.

[0093] Example 5: Clinical sample testing in mice and AML patients.

[0094] Studies have shown that the abundance of tsRNA in the blood of patients with acute myeloid leukemia (AML) is higher than that in healthy individuals, and this can be used for early diagnosis and prognosis of AML. To verify this viewpoint, an AML mouse model was constructed in the early stages of this invention. Blood was collected from healthy mice and mice with AML, and RNA was extracted to test the abundance of tsRNA. Figure 12 For both A and 12B, regardless of whether it was 5' tsRNA or 3' tsRNA, the fluorescence signal in AML mice was significantly higher than that in healthy mice, and the same result could be observed under ultraviolet light. Figure 12 D). The colorimetric signal of diseased mice was significantly lower than that of healthy mice. Figure 12C and 12E). The results showed that the abundance of tsRNA in the blood of diseased mice was significantly higher than that in healthy mice. Furthermore, this invention utilized RT-PCR technology to detect tsRNA in mouse blood and tested its detection capability in complex samples (C and 12E). Figure 13 C). The results showed that, in the detection of 5' tsRNA, the abundance of tsRNA in mice with AML was significantly higher than that in healthy mice, consistent with the results of fluorescence and colorimetric detection techniques. Figure 13 C). However, no significant difference was found between healthy and diseased mice in the 3' tsRNA assay. Figure 13 (D) In ​​the results of fluorescence and colorimetric detection techniques, the average fluorescence intensity of diseased mice was significantly higher than that of healthy mice, and the two could be clearly distinguished in colorimetric mode. This inconsistency may be due to the lower abundance of tsRNA in mouse blood, which is below the detection range of RT-PCR. Therefore, fluorescence and colorimetric detection techniques are more advantageous in practical applications.

[0095] Next, this invention collected blood samples from 4 healthy volunteers and 16 AML patients, and extracted RNA from the serum. Detection revealed that the fluorescence intensity of both 5'tsRNA and 3'tsRNA in AML patients was significantly higher than that in healthy volunteers. Figure 14 A-14D). In the colorimetric signals, it is evident that the signal from healthy volunteers appears deep blue, while the signal from AML patients is significantly weaker (A-14D). Figure 14 (E-14F). These data indicate that the abundance of tsRNA in the serum of AML patients is significantly higher than that in healthy volunteers. The abundance of tsRNA in serum can be used to identify the occurrence of AML. Simultaneously, tsRNA in the serum of healthy volunteers and AML patients was detected using "adaptor-tailed" RT-PCR technology. Figure 15 A showed that for 5' tsRNA testing, AML patients had more amplification products than healthy volunteers, while no significant difference was found in 3' tsRNA testing. Figure 15 (B) However, both 5' tsRNA and 3' tsRNA could be clearly identified in healthy volunteers and AML patients in both fluorescence and colorimetric detection results. This difference may also be due to the very low abundance of tsRNA. Furthermore, RT-PCR results also showed that the abundance of tRNA in serum was very low or absent, while tsRNA was dominant. This provides useful evidence for research on the potential intercellular communication function of tsRNA.

[0096] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention. Technical aspects, shapes, and structures not described in detail in this invention are all well-known technologies.

Claims

1. A tsRNA detection primer composition, characterized in that, The primer composition comprises: Group A: Primers used for the ligation reaction, including 5' Prime-Gly-GCC nucleotide sequences as shown in SEQ ID No. 1 and 3' Prime-Gly-GCC nucleotide sequences as shown in SEQ ID No. 2; the 5' end of the nucleotide sequence of SEQ ID No. 1 is modified with a phosphate group and the 3' end is modified with an amino group; Group B: Guide RNAs for CRISPR / Cas13a reactions, including 5'crRNA-Gly-GCC with nucleotide sequences as shown in SEQ ID No. 3 and 3'crRNA-Gly-GCC with nucleotide sequences as shown in SEQ ID No. 4; Group C: Nucleic acid probes for signal output, selected from probes with nucleotide sequences as shown in SEQ ID No. 5 or RNA reporter with nucleotide sequences as shown in SEQ ID No. 6; Group D: Primer pairs used for RT-PCR amplification, selected from primer pairs consisting of nucleotide sequences such as SEQ ID No. 7 and SEQ ID No. 8, and / or primer pairs consisting of nucleotide sequences such as SEQ ID No. 9 and SEQ ID No.

10.

2. tsRNA detection kit, characterized in that, The kit includes the primer composition of claim 1 and an enzyme reaction system for ligating tsRNA, the enzyme reaction system including RNA ligase and its reaction buffer, ATP and a coagulant; the kit is selected from one or more of the detection systems (1), (2) and (3): (1) CRISPR / Cas13a fluorescence detection system: containing Cas13a protein; (2) CRISPR / Cas13a colorimetric detection system: containing Cas13a protein, magnetic beads, and platinum and palladium salts for constructing nanozymes; (3) RT-PCR detection system: containing reverse transcriptase and DNA polymerase.

3. The tsRNA detection kit according to claim 2, characterized in that, When used for fluorescence detection, the primer composition comprises SEQ ID No. 1-SEQ ID No. 4 and SEQ ID No. 6; when used for colorimetric detection, the primer composition comprises SEQ ID No. 1-SEQ ID No. 4 and SEQ ID No. 5, and the kit further comprises a reducing agent and a chromogenic substrate; when used for RT-PCR detection, the primer composition comprises at least one pair of SEQ ID No. 1-SEQ ID No. 2 and SEQ ID No. 7-SEQ ID No.

10.

4. The use of the primer composition of claim 1 or the kit of any one of claims 2-3 in the preparation of products for detecting tsRNA abundance.

5. The use of the kit according to claim 2 or 3 in the preparation of a product for detecting tsRNA abundance, characterized in that, The detection is performed using the kit described in claim 2 or 3, including a "connector-tail" connection step and a signal detection step; The "connector-tailing" ligation step includes: establishing a "tailing" system for the 5'tsRNA target: mixing the RNA sample to be tested with the primers, RNA ligase and auxiliary reagents shown in SEQ ID No. 1, and performing a ligation reaction; establishing a "connector" system for the 3'tsRNA target: mixing the RNA sample to be tested with the primers, RNA ligase and auxiliary reagents shown in SEQ ID No. 2, and performing a ligation reaction; The signal detection step is selected from one or more of CRISPR / Cas13a-mediated fluorescence detection, CRISPR / Cas13a-mediated colorimetric detection, and RT-PCR detection.

6. The application according to claim 5, characterized in that, In the "connector-tailing" ligation step, the volume ratio of each component is as follows: 1 part of primer SEQ ID No.1 or SEQ ID No.2 at a concentration of 1 μM, 1-3 parts of ligase buffer, 0.5-2 parts of ATP, 3-7 parts of PEG-8000, 0.5-2 parts of T4 RNA Ligase 1, and 3-7 parts of RNA sample; the reaction conditions are: incubation at 30-45℃ for 60-100 min.

7. The application according to claim 5, characterized in that, The signal detection step is a CRISPR / Cas13a-mediated fluorescence detection, and the specific steps include: S1. The tailed product is mixed with Cas13a protein, crRNA shown in SEQ ID No. 3, and RNAreporter shown in SEQ ID No. 6, and fluorescence signals are collected; the abundance of 5'tsRNA is determined based on the fluorescence signal intensity. S2. The adapter product is mixed with Cas13a protein, crRNA shown in SEQ ID No. 4, and RNAreporter shown in SEQ ID No. 6, and fluorescence signals are collected; the abundance of 3'tsRNA is determined based on the fluorescence signal intensity.

8. The application according to claim 5, characterized in that, The signal detection step is a CRISPR / Cas13a-mediated colorimetric detection, and the specific steps include: A1. Preparation of magnetic bead probe: Magnetic beads are combined with the probe shown in SEQ ID No. 5; A2. Shearing reaction: The tailed product and the linker product were mixed and reacted with Cas13a protein, group B crRNA and MB@probe, respectively; A3. Nanozyme color development: Platinum salt, palladium salt and reducing agent are added to the reaction system to form bimetallic nanozymes in situ. After magnetic separation and washing, colorimetric substrate is added; the abundance of tsRNA is determined based on the colorimetric signal intensity.

9. The application according to claim 8, characterized in that, In step A3, the platinum salt is K2PtCl4, the palladium salt is K2PdCl4, the reducing agent is NaBH4, and the chromogenic substrate includes TMB and H2O2; the reaction time for in-situ nanozyme formation is 1-5 min, and the chromogenic reaction time is 10-20 min.

10. The application according to claim 5, characterized in that, The signal detection step is RT-PCR detection, and the specific steps include: using the tailed product or the adapter product as a template, amplification is performed using the primer pair described in group D under the action of reverse transcriptase and DNA polymerase; the amplified products are analyzed by gel electrophoresis, and the band appearing at 50-55bp is tsRNA, the band appearing at 100-110bp is maternal tRNA, and the brighter the band, the higher the tsRNA abundance.

Images