Nucleic acid aptamer specifically binding dehydroepiandrosterone, kit and use thereof

By screening out nucleic acid aptamers with high homology and affinity, the problems of complexity and high cost in the detection of dehydroepiandrosterone (DHEA) in existing technologies have been solved, and low-cost and accurate DHEA detection has been achieved.

CN116286833BActive Publication Date: 2026-07-10HANGZHOU BAICHEN MEDICAL LAB CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310112553.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-14
Publication Date
2026-07-10
Estimated Expiration
2043-02-14

Smart Images

  • Figure CN116286833B_ABST
    Figure CN116286833B_ABST
Patent Text Reader

Abstract

The application discloses a nucleic acid aptamer specifically combined with dehydroepiandrosterone, a kit and application, and comprises a nucleotide sequence shown in SEQ ID No. 1; or a nucleotide sequence with high homology with the nucleotide sequence shown in SEQ ID No. 1 and capable of being specifically combined with dehydroepiandrosterone; or a nucleotide sequence derived from the nucleotide sequence shown in SEQ ID No. 1 and capable of being specifically combined with dehydroepiandrosterone; wherein the primer of dehydroepiandrosterone comprises lib1S1, Lib1A2 and Lib1S1-CS-biotin. The nucleic acid aptamer with high affinity and high specificity is screened, has strong specificity and sensitivity, is a chemical synthetic material, has low use cost and does not have the problem of batch difference in the detection process, and the use of antibody material in the detection process is avoided, so that the detection cost is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and relates to nucleic acid aptamers, particularly to nucleic acid aptamers, kits, and applications that specifically bind to dehydroepiandrosterone. Background Technology

[0002] Dehydroepiandrosterone (DHEA), also known as the "aging hormone," is the most abundant corticosteroid hormone in blood plasma and the most common steroid substance in the human peripheral blood circulation. It is an essential precursor for the synthesis of steroid hormones in eggs and plays an important role in the growth and development of follicles.

[0003] DHEA primarily originates from the adrenal cortex and is synthesized and secreted by the adrenal glands and gonads, with small amounts also secreted by the testes and ovaries. Its synthesis is mainly regulated by the hypothalamic-pituitary-adrenal neuroendocrine axis. In the bloodstream, it is regulated by target organs and converted into other hormones such as estrogen, androgen, progesterone, and corticosteroids. As the most abundant corticosteroid hormone in plasma, plasma DHEA levels can serve as a specific and sensitive indicator reflecting age-related changes in the body.

[0004] In serum, DHEA levels are relatively low, primarily existing in the stable form of DHEA-S. DHEA-S is mostly present as sulfate conjugates, and the majority originates from the zona reticularis of the adrenal cortex, closely related to 24-hour urinary 17-ketosteroid excretion. DHEA secretion levels increase with age after birth, peaking around age 30.

[0005] Dehydroepiandrosterone (DHEA) has regulatory effects on reproductive function: protecting the central nervous system, inhibiting neurodegenerative diseases, enhancing brain recognition and memory functions, regulating and stabilizing the body's immunity, and enhancing bone metabolism. Therefore, its content level can be used to assist in the detection of clinical symptoms such as adrenal tumors, polycystic ovary syndrome, and precocious puberty.

[0006] Nucleic acid aptamers are DNA or RNA molecules isolated through systematic evolution of ligands using exponential enrichment (SELEX) technology. They can bind with high affinity and specificity to other targets such as proteins, metal ions, small molecules, peptides, and even whole cells, thus showing broad prospects in biochemical analysis, environmental monitoring, basic medicine, and new drug synthesis. Compared with antibodies, nucleic acid aptamers have advantages such as smaller molecular weight, better stability, easier modification, no immunogenicity, shorter production cycle, and can be synthesized artificially, eliminating a series of processes such as animal immunization, feeding, protein extraction, and purification.

[0007] Currently, the methods for detecting dehydroepiandrosterone (DHEA) on the market are mainly divided into two categories: high-performance liquid chromatography (HPLC) and radioimmunoassay (RIA).

[0008] The detection procedure for high performance liquid chromatography is as follows (only a general procedure is shown):

[0009] (1) Take 100 mL of sample and then use hydrochloric acid to adjust the pH value to 2-3;

[0010] (2) The processed sample was extracted through an SPE column activated with 10 mL of methanol and 10 mL of deionized water, and then the residual water in the SPE column was removed by vacuum pump.

[0011] (3) Elute with 10 mL of dichloromethane-methanol (V / V = 80 / 20), and then blow the eluent dry with nitrogen.

[0012] (4) Dissolve and dilute to 1 mL with methanol;

[0013] (5) Analyze the processed sample using HPLC.

[0014] The radioimmunoassay procedure is as follows:

[0015] Take 0.1 mL of plasma, add 0.5 mL of heavy distilled water, 0.2 mL of 0.1 mol / L NaOH, and 5 mL of dichloromethane. Place the mixture in a 12 mL conical stopper with a ground glass stopper and shake for 5 min. Let stand for a moment, discard the supernatant. Add 1 mL of heavy distilled water to wash the dichloromethane mixture and shake for 1 min. Centrifuge at 2500 rpm for 5 min and discard the aqueous layer. Duplicate the dichloromethane mixture, adding 1 mL to each tube and evaporating to dryness in a 45–50°C water bath. Add 50 μL of DHEA to each tube and dry with compressed air. Add 0.2 mL of 1:10,000 antiserum to each tube, shake well, and incubate overnight (4°C for 16–24 h). The following day, add 0.1 mL of 5 g / L gelatin buffer to each tube and place them in an ice-water bath at 4°C. Add 0.5 mL of 2.5 g / L DCC to each tube, incubate at 4°C for 10 min, centrifuge at 2500 rpm for 10 min, and take 0.4 mL of the supernatant. Add it to 8 mL of scintillation buffer, mix on a vortex mixer for 1 min, and perform scintillation counting at least 4 h later. DHEA in the sample competitively binds to the quantified 3H-DHEA and the added specific antibody. Once the reaction reaches equilibrium, the free fraction is adsorbed by DCC, and the bound fraction can be used for counting. The content in unknown samples can be determined according to the standard curve.

[0016] The two detection methods described above demonstrate that their procedures are complex, time-consuming, and costly. Summary of the Invention

[0017] To address the aforementioned problems, the first aspect of this invention provides a nucleic acid aptamer that specifically binds to dehydroepiandrosterone (DHEA), exhibiting high specificity and sensitivity. As a chemically synthesized substance, it has low usage costs and eliminates batch-to-batch variability issues during detection. Furthermore, it avoids the use of antibodies, further reducing detection costs, and is of significant importance for clinical testing applications.

[0018] Secondly, the present invention provides a kit comprising the above-mentioned nucleic acid aptamers.

[0019] Thirdly, the present invention provides applications of the above-mentioned nucleic acid aptamers.

[0020] To achieve the above objectives, the present invention adopts the following technical solution:

[0021] First, the present invention provides a nucleic acid aptamer that specifically binds to dehydroepiandrosterone (DHEA), comprising the nucleotide sequence shown in SEQ ID No. 1; or, a nucleotide sequence that has high homology with the nucleotide sequence of SEQ ID No. 1 and is capable of specifically binding to DHEA; or a nucleotide sequence that is derived from the nucleotide sequence shown in SEQ ID No. 1 and is capable of specifically binding to DHEA; wherein the primers for DHEA include lib1S1, Lib1A2, and Lib1S1-CS-biotin.

[0022] As a preferred embodiment of the present invention, the high homology refers to at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% homology with the nucleotide sequence shown in SEQ ID Nos.1.

[0023] As a preferred embodiment of the present invention, the nucleic acid aptamer comprises a nucleotide sequence complementary to the nucleotide sequence and maintains affinity.

[0024] As a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer includes base modifications and maintains affinity.

[0025] As a preferred embodiment of the present invention, the base modification is thiomodification, phosphorylation, methylation, amylation, thiolation, selenium-substituted oxygen modification, or isotope linkage modification.

[0026] As a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer contains a marker and maintains affinity.

[0027] As a preferred embodiment of the present invention, the marker is a fluorescent marker, a radioactive marker, a therapeutic marker, a biotin marker, a digoxigenin marker, a nanoluminescent material marker, a small peptide marker, an siRNA marker, or an enzyme marker.

[0028] As a preferred embodiment of the present invention, the method for screening nucleic acid aptamers that specifically bind to dehydroepiandrosterone includes the following steps:

[0029] 1) Fixed library;

[0030] 2) Magnetic bead and library incubation;

[0031] 3) Document cleaning;

[0032] 4) Target elution;

[0033] 5) Q-PCR detection;

[0034] 6) ePCR amplification;

[0035] 7) Single-chain preparation;

[0036] 8) Repeat steps 2)-7) 15 times, using the secondary library obtained in the previous operation as the starting nucleic acid library for each operation;

[0037] The sequence of primer lib1S1 is shown in SEQ ID No. 2, the sequence of primer lib1A2 is shown in SEQ ID No. 3, and the sequence of primer Lib1S1-CS-biotin is shown in SEQ ID No. 4.

[0038] Secondly, the present invention provides a kit comprising the above-mentioned nucleic acid aptamer that specifically binds to dehydroepiandrosterone.

[0039] Finally, this invention provides the application of nucleic acid aptamers that specifically bind to dehydroepiandrosterone (DHEA), and utilizes these nucleic acid aptamers to biodetect DHEA.

[0040] Compared with the prior art, the present invention has the following beneficial effects:

[0041] 1) The dehydroepiandrosterone nucleic acid aptamer discovered by the present invention has the characteristics of high specificity, easy synthesis, strong stability and low cost.

[0042] 2) This invention does not use antibody substances in the detection process, thus providing an accurate and stable detection method for clinical testing. Attached Figure Description

[0043] Figure 1 This refers to the retention rate of dehydroepiandrosterone nucleic acid in each round of screening according to the present invention.

[0044] Figure 2 This is a sequence and secondary structure prediction diagram of the nucleic acid aptamer of this invention.

[0045] Figure 3These are the detection CD spectra of the experimental group and the blank group of this invention.

[0046] Figure 4 This is the control group data after the nucleic acid aptamer cloning titration treatment of this invention.

[0047] Figure 5 These are experimental group data after nucleic acid aptamer cloning titration treatment according to the present invention.

[0048] Figure 6 This is the fluorescence quantitative PCR detection pattern of the present invention.

[0049] Figure 7 It is a linear curve of dehydroepiandrosterone molecules at different concentrations.

[0050] Figure 8 This is the chromatogram of the control group of this invention.

[0051] Figure 9 This is the chromatogram of the experimental group of this invention. Detailed Implementation

[0052] To facilitate understanding of the technical means, creative features, objectives, and effects of this invention, the invention is further described below with reference to specific embodiments. However, the following embodiments are merely preferred embodiments of this invention and not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments described herein without creative effort are all within the scope of protection of this invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0053] Example 1

[0054] Screening for nucleic acid aptamers that specifically bind to dehydroepiandrosterone:

[0055] I. Design of Library and Primers

[0056] Random single-stranded DNA library: 5'-CTGGCACTTCACGCATAGAG-36N-CTATGCGTGCTACCGTGAAG-3'; where "36N" represents a sequence composed of 36 arbitrary nucleotide bases. This library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0057] Primer information is shown in Table 1, and the primers were synthesized by General Biotech (Anhui) Co., Ltd.

[0058] Table 1. Primers and sequences for dehydroepiandrosterone (DHEA).

[0059]

[0060]

[0061] In this primer, S represents the forward primer, A represents the reverse primer, the 25 A's in the sequence represent a polyA tail composed of 25 adenosine nucleotides (A), and "Spacer 18" represents an 18-atom hexaethylene glycol intermediate arm. The structural formula of "Spacer 18" used in the above 3' primers is shown in formula (I).

[0062]

[0063] Primers were prepared into 100 μM stock solutions using DPBS buffer (DPBS: 100 mM, NaCl: 150 mM, KCl: 1 mM, MgCl2: 1 mM, CaCl2: 1 mM; pH 7.4, 25 °C) and stored at -20 °C for later use.

[0064] II. Screening

[0065] Taking the first round as an example, the subsequent iterative screening process is as follows:

[0066] 1. Library variational complexity

[0067] The library was diluted to the designed concentration of 1 μM to 10 μM, and the reaction system was 100 μL to 140 μL. Then, primers were added in a volume twice the amount of the library (28 μL), mixed well, and then slowly renaturated.

[0068] PCR renaturation program for PCR instrument:

[0069] 95℃ for 10 min, 60℃ for 1 min, and finally cooled to 25℃ (cooling rate of 0.1℃ / s).

[0070] 2. Clean the magnetic beads (purchased from Boyue Biotechnology, M1000S3).

[0071] Take an appropriate amount of SA magnetic beads according to the library volume (1 mL for the first round, and the amount of magnetic beads to be used in subsequent screenings should be determined according to the library volume). Wash the magnetic beads 5 times with DPBS buffer (pH 7.4, unless otherwise specified in all embodiments of this invention, DPBS is pH 7.4). Transfer the magnetic beads to a new tube for the last wash.

[0072] 3. Fixed document library

[0073] After the library was renatured, its concentration C1 was measured.

[0074] After the library has undergone refolding, add it to the cleaned magnetic beads and incubate it on a shaker at room temperature for 1 hour.

[0075] After incubation, the supernatant was collected after standing on a magnetic rack to measure the concentration of C2 and to calculate the fixation rate of the library.

[0076] The calculation formula is: ((1-C1) / C2)x100%, and the retention rate in the first round is 96%.

[0077] 4. Washing

[0078] Add 200 μL of PBS buffer to the magnetic beads after library fixation and perform 4 elutions. Replace the pipette tip and centrifuge tube for each elution. After pipetting and rinsing, place the centrifuge tube containing the magnetic beads on a magnetic rack and let it stand for 1 minute to allow the magnetic beads to aggregate. Then take out the supernatant from each elution and record it as wash1, wash2, wash3, and wash4. Finally, perform real-time PCR.

[0079] 5. Back-screening

[0080] Add pure DPBS or DPBS containing an appropriate amount (2%-5%) of organic matter (keeping it the same substance as the solution for dissolving the target molecules, generally pure methanol solution) to the eluted magnetic beads for reverse screening and incubation for 30-60 minutes. After reverse screening, place the beads on a magnetic rack and let them stand. Take the supernatant and mark it as E- for later use. Perform real-time PCR. Then wash the reverse-screened magnetic beads with DPBS once.

[0081] 6. Positive screening

[0082] Add diluted target molecule solution (2%-6% relative content of target solution in reaction system) to the magnetic beads after reverse screening and elution, and perform positive screening incubation for 45-60 minutes. After incubation, place the beads on a magnetic rack and collect the supernatant, which is marked as E+ for later use in real-time PCR.

[0083] 7. Quantitative Real-Time PCR (qPCR)

[0084] Centrifuge the wash solution, E-, and E+ thoroughly, and add Evergreen (4% of the qPCR-mix volume) and qPCR-mix to perform real-time PCR. The reaction volume is 32 μL (30 μL qPCR-mix and 2 μL elution / screening elution).

[0085] 8. PCR amplification

[0086] Add all the remaining E+ from the completed quantitative PCR to the amplification mix, add 8 mL of mineral oil, vortex mix for 3-5 minutes, and aliquot 100 μL / well into an 8-pack for PCR amplification.

[0087] 9. Concentrate PCR products

[0088] Take out the amplified product and transfer it to a 15mL centrifuge tube. Add n-butanol to the 12.5mL mark and vortex for 1 min. Centrifuge at 7500 rpm for 4 min to concentrate to 100μL. Then add 100μL loading buffer and denature in a boiling water bath for 10 min for later use.

[0089] 10. Electrophoretic separation for the preparation of single-chain [substances]

[0090] Add preheated TBE buffer (500 mL) to the prepared gel plate, start the electrophoresis apparatus for pre-electrophoresis for 3 min, then use a pipette to blow the gel onto the gel plate, add the denatured library to the gel plate using a pipette, run the gel at 300V for about 30 min, then use a disposable blade to cut the gel strip, use a 0.5 mL centrifuge tube to fit a 2 mL centrifuge tube to centrifuge and break up the gel strip, add 1.2 mL L PBS and boil in a water bath for 30 min, repeat the operation once, that is, boil in a water bath twice, and obtain the single-stranded DNA preparation solution through a needle filter membrane.

[0091] 11. Concentrated single-stranded DNA

[0092] Transfer the single-stranded DNA preparation solution to a 15 mL centrifuge tube, then add n-butanol to the 14 mL mark. Centrifuge at 7500 rpm for 1 min to concentrate the single-stranded DNA. When the volume of the single-stranded DNA is concentrated to about 100 μL, transfer it to the centrifuge tube cap and use a dialysis membrane for overnight dialysis.

[0093] 12. Dialysis for the next round of document screening

[0094] After overnight dialysis, the library is first removed to determine its concentration, and then stored for subsequent library screening.

[0095] A total of 15 rounds of screening were conducted, with slight variations in the screening criteria for each round, as detailed in Table 2.

[0096] Table 2. Dehydroepiandrosterone aptamer screening process

[0097]

[0098]

[0099] After 15 rounds of iterative screening, the screening data was organized, processed, and analyzed to obtain the retention rate for each round of screening, as shown below. Figure 1 As shown.

[0100] After cloning and sequencing analysis of the enriched library products, several sequences were selected and synthesized by Shanghai Sangon Biotech. Affinity was tested; the methods for affinity testing are detailed in Examples 2 and 3. One sequence was identified as having strong binding ability and, after verification, showed ideal affinity for dehydroepiandrosterone (DHEA), and was named TQBXT-Apt-024. The sequence and secondary structure prediction diagram of this nucleic acid aptamer are shown below. Figure 2 As shown

[0101] TQBXT-Apt-024: CTGGCACTTCACGCATAGAGGAAGCCCTTCGTTTATGCAAGCGGTAGGGTGTGGAGTCTATGCGTGCTACCGTGAAG (SEQ ID No. 1).

[0102] Example 2

[0103] Preliminary screening of dehydroepiandrosterone (DHEA) screening library monoclonal antibodies using circular dichroism chromatography (JASCO, Japan, model J-1700):

[0104] Test method:

[0105] (1) Dilute the dehydroepiandrosterone small molecule to 5 uM with DPBS buffer and set aside. Dilute all monoclonal antibodies to 4 uM and set aside.

[0106] (2) Taking 24# monoclonal antibody as an example;

[0107] Experimental group: Take 100 μL of diluted dehydroepiandrosterone (DHEA) and add 100 μL of diluted monoclonal antibody, mix well and incubate for 30 min.

[0108] Control group: Take 100 μL of DPBS, add 100 μL of diluted monoclonal antibody, mix well and incubate for 30 min.

[0109] (3) The samples from the experimental group and the blank group were added to quartz cuvettes respectively, and the CD spectra were detected at wavelengths of 220-320nm. The experimental results are shown in the figure. Figure 3 As can be seen, the peak height of the experimental group is significantly larger, which is speculated to be due to the small molecule binding with the aptamer to produce a new conformation, and the aptamer may have affinity.

[0110] Example 3

[0111] Isothermal titration calorimetry (ITC) for determining the affinity of dehydroepiandrosterone (DHEA) aptamers for DHEA:

[0112] Instrument brand: MicroCal; Model: PEAQ-ITC.

[0113] 1) Dilute the 30 mmol molecular stock solution to 200 μM using DPBS buffer (at this point, the small molecule solution contains 0.67% methanol). Dissolve the 8 clone libraries in DPBS to 10 μM (add 2 μL of methanol to 298 μL of aptamers so that the aptamers also contain 0.67% methanol). At the same time, prepare DPBS buffer containing 0.67% methanol.

[0114] 2) After the instrument completes its self-test upon startup, select the automatic cleaning function for the titration needle and titration cell. After cleaning, titrate with ultrapure water to check the instrument's stability and the cleanliness of the titration needle and titration cell. Then, begin sample injection: titrate 280 μL of DPBS buffer containing 0.67% methanol with 60 μL of molecular diluent to obtain control group data. Clean the titration needle and titration cell again, and inject the sample: titrate 280 μL of a clone library containing 0.67% methanol with 60 μL of molecular diluent to obtain experimental group data. The experimental titration method is as follows: the first drop is injected as 0.4 μL, and the subsequent 19 drops are injected as 3 μL each, with each injection lasting 20 seconds and an interval of 150 seconds between injections. After the experiment, clean the titration needle and titration cell and turn off the instrument.

[0115] Data analysis was performed using MicroCal PEAQ-ITC Analysis Software. The experimental group data was subtracted from the control group data, and the titration curve of the final dehydroepiandrosterone molecule and clone sequence was plotted. The software automatically integrated the area of ​​each exothermic peak to obtain the binding isotherm curve, as well as data such as binding ratio, dissociation constant, enthalpy change, entropy change, and Gibbs free energy.

[0116] The following data are from the clonal titration of effective aptamers of dehydroepiandrosterone:

[0117] 1.60 μL of molecular dilution buffer was used to titrate 280 μL of DPBS buffer containing 0.67% methanol to obtain control group data. See [link to data]. Figure 4 .

[0118] 2. Titrate 280 μL of a cloning library containing 0.67% methanol with 60 μL of molecular dilution buffer. Clone #24 was the effective aptamer. Experimental data were obtained; see [link to data]. Figure 5 .

[0119] According to ITC verification, the affinity of the dehydroepiandrosterone aptamer for dehydroepiandrosterone reached 4.04 uM.

[0120] Example 4

[0121] ELISA experiments confirmed that the dehydroepiandrosterone aptamer can bind to the dehydroepiandrosterone molecule.

[0122] Test method:

[0123] 1) Add 100 μL of diluted SA protein at a concentration of 1 mg / mL to the first and second columns of the microplate, and incubate at 4°C for 24 hours.

[0124] 2) Clean the ELISA plate

[0125] The microplate was washed with a plate washer, and the washing buffer was DPBS containing 0.05% Tween 20.

[0126] 3) Blocking the ELISA plate

[0127] Add 100 μL of 10 mg / mL BSA blocking buffer to the wells coated with protein and block at 37°C for 2 h (if at 4°C, overnight blocking is required).

[0128] 4) Washing

[0129] After sealing, the plate was washed again with a plate washer.

[0130] 5) Library variation

[0131] The target aptamer clone library was diluted to 400 nM and then mixed with Lib1CS-bition primers for slow renaturation. The Lib1CS-biotin primers were matched to the aptamers. The renaturation program was 95℃ for 10 min, 60℃ for 1 min, and finally cooled to 25℃ (at a rate of 0.1℃).

[0132] 6) Library incubation

[0133] Add the renatured library to the wells of the coated microplate at 100 μL per well, and incubate with shaking for 15-30 min. After incubation, wash each well 2-2 times with 100 μL of DPBS each time. Finally, add another 100 μL of DPBS to each well and let stand at room temperature for 2-3 h to remove the self-dissociated aptamers. After 2-3 h, remove the supernatant and wash each well 4-5 times with DPBS. Finally, remove all supernatant, blot the microplate dry, and store at 4℃ for later use.

[0134] 7) Target incubation

[0135] Eight concentrations of dehydroepiandrosterone (DHEA) and control DHEA were diluted to 1600 nM, 1400 nM, 1200 nM, 1000 nM, 800 nM, 600 nM, 400 nM, and 200 nM, respectively. 100 μL of DHEA was added to each of the eight wells in the second column of the ELISA plate according to the concentration gradient. 100 μL of control DHEA was added to each of the eight wells in the second column of the ELISA plate according to the concentration gradient. The plates were incubated at room temperature with shaking for 60 min.

[0136] 8) Quantitative Real-Time PCR

[0137] The small molecule will compete for the TQBXT-Apt-024 monoclonal antibody from the ELISA plate. 2 μL of supernatant was collected from each well for quantitative real-time PCR detection. Experimental results are shown below. Figure 6 .

[0138] The measurement data were processed to obtain linear curves of dehydroepiandrosterone (DHEA) molecules at different concentrations, as shown in the figure. Figure 7 The dehydroepiandrosterone 24# aptamer can bind to dehydroepiandrosterone molecules, and the content of dehydroepiandrosterone molecules in the sample can be calculated based on the curve above.

[0139] Example 5

[0140] Application of dehydroepiandrosterone aptamers in chromatographic detection pretreatment

[0141] Instrument manufacturer: Waters Corporation, Model: I-Class / XVEO-TQD.

[0142] Test method:

[0143] 1) Biotin-enhanced modification of TQBXT-Apt-024 (Anhui General Biotechnology) resulted in the following sequence: Biotin-AAAAAAAAAAAAAAAAAAAAAAAAAAA-Spacer18-CTGGCACTTCACGCATAGAGGAAGCCCTTCGTTATGCAAGCGGTAGGGTGTGGAGTCTATGCGTGCTACCGTGAAG

[0144] 2) Dissolution: Take out the modified primer powder synthesized by General Biotech and centrifuge at 12000 rpm for 10 min. Add DPBS buffer to dissolve, then dilute with DPBS to a final concentration of 1 uM 1000 μL, vortex to mix, and set aside for use.

[0145] 3) Refolding treatment: The diluted solution obtained in step 2 was aliquoted and placed into a PCR instrument for refolding. The PCR program was: 95℃ for 10 min, 4℃ for 5 min; thereby forming the aptamer into the desired structure.

[0146] 4) Pipette 1 mL of 10 mg / mL streptavidin magnetic beads (purchased from Invitrogen, Dynabeads) TM MyOne TMCarboxylic Acid (catalog number: 65001) was used to wash the magnetic beads four times with 1000 μL of DPBS each time. The beads were then hooked with a magnet to remove the supernatant. (During the final wash, the magnetic beads were temporarily stored in a small amount of DPBS to prevent them from drying out.) The resulting magnetic bead solution was then aliquoted into two portions: one 500 μL portion, labeled as the experimental group; and the other 500 μL portion, labeled as the control group, for later use.

[0147] 5) Add 1000 μL of the aptamer liquid obtained in step 3 after the renaturation process to the magnetic beads obtained in step 4, mix well, and shake on a rotary table at room temperature for 60 min.

[0148] 6) Washing and Adsorption: Using a magnet to hold the magnetic beads from the previous step, remove the supernatant and wash them again. Each time, add 1000 μL of wash buffer (DPBS) to the magnetic beads, mix at room temperature for 1 min, then hold the beads with a magnet, let them stand at room temperature for 1 minute, remove the supernatant, and repeat the washing operation 5 times. Finally, add 500 μL of DPBS and mix to bring the volume to a final level. To prevent inconsistent bead volume due to bead loss during washing, the control group magnetic beads were also washed 5 times with 500 μL of DPBS.

[0149] 7) Dilute the dehydroepiandrosterone standard with DPBS to a concentration of 200 μM, 1000 μL, for later use.

[0150] 8) Take the control group magnetic beads and the magnetic beads obtained in step 6), remove the supernatant, add 500 μL of dehydroepiandrosterone (DHEA) standard diluted with DPBS, mix well, shake in a vortex mixer at room temperature for 20 min, remove the supernatant, and rinse the magnetic beads twice with 500 μL of DPBS. Simultaneously, add 500 μL of DHEA standard diluted with DPBS to the experimental group magnetic beads obtained in step 6, mix well, shake in a vortex mixer at room temperature for 20 min, remove the supernatant, and rinse the magnetic beads twice with 500 μL of DPBS.

[0151] 9) Elute each of the magnetic beads obtained in the previous step with 200 μL of methanol. After mixing, incubate at room temperature for 10 min, then use a strong magnet to adsorb the magnetic beads, collect the supernatant, label it, and use a mass spectrometer to detect the content of dehydroepiandrosterone.

[0152] This embodiment utilizes a standard of dehydroepiandrosterone (DHEA) and dehydroepiandrosterone aptamer magnetic beads prepared using the aptamer from the previous embodiment for the enrichment and purification of DHEA samples. The DHEA bound to the aptamer on the magnetic beads was eluted with methanol, and the concentration of DHEA was detected by mass spectrometry. The main purpose is to test the enrichment ability of the aptamer-magnetic bead complex, providing a template for future applications.

[0153] The chromatographic data are as follows:

[0154] Control group data are shown Figure 8 The upper peak is the peak of the actual sample, and the lower peak is the peak of the internal standard. The actual sample response value of the control group is 2021.

[0155] Experimental group data can be found Figure 9 The upper peak represents the actual sample peak, and the lower peak represents the internal standard peak. The actual sample response value of the experimental group was 414,000, which is about 205 times that of the control group, showing a significant difference.

[0156] This invention offers broad prospects for the application of mass spectrometry and chromatography.

[0157] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A nucleic acid aptamer that specifically binds to dehydroepiandrosterone, characterized in that, The nucleotide sequence is shown in SEQ ID No.

1.

2. The nucleic acid aptamer that specifically binds to dehydroepiandrosterone according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid aptamer contains markers and maintains affinity.

3. The nucleic acid aptamer that specifically binds to dehydroepiandrosterone according to claim 2, characterized in that, The marker is a fluorescent marker, a radioactive marker, a therapeutic marker, a biotin marker, a digoxigenin marker, a nanoluminescent material marker, a small peptide marker, an siRNA marker, or an enzyme marker.

4. The nucleic acid aptamer that specifically binds to dehydroepiandrosterone according to claim 1, characterized in that, The screening method for nucleic acid aptamers that specifically bind to dehydroepiandrosterone includes the following steps: 1) Fixed library; 2) Magnetic bead and library incubation; 3) Document cleaning; 4) Target elution; 5) Q-PCR detection; 6) ePCR amplification; 7) Single-chain preparation; 8) Repeat steps 2)-7) 15 times, using the secondary library obtained in the previous operation as the starting nucleic acid library for each operation; The sequence of primer lib1S1 is shown in SEQ ID No. 2, the sequence of primer lib1A2 is shown in SEQ ID No. 3, and the sequence of primer Lib1S1-CS-biotin is shown in SEQ ID No.

4.

5. A reagent kit, characterized in that, Includes the nucleic acid aptamer that specifically binds to dehydroepiandrosterone as described in any one of claims 1-4.

6. The use of the nucleic acid aptamer that specifically binds to dehydroepiandrosterone as described in any one of claims 1-4 in the preparation of reagents for the biological detection of dehydroepiandrosterone.