ZmSPL19 gene and application thereof in regulation and control of nitrogen utilization efficiency

Abstract

The invention discloses a ZmSPL19 gene and application thereof in regulation and control of nitrogen utilization efficiency, and belongs to the field of plant biotechnology breeding. According to the corn ZmSPL19 gene provided by the invention, after the endogenous gene generates function loss mutation in a plant or the expression of the ZmSPL19 gene is inhibited, an excellent phenotype with improved nitrogen utilization efficiency can be obtained; the improvement of the nitrogen utilization efficiency includes that the growth of main roots is fast, or any characteristic of biomass, spike position leaf nitrogen content, chlorophyll relative content and net photosynthetic rate is improved, or any character of female spike length, grain number, spike weight and single-plant grain yield is remarkably increased. The ZmSPL19 gene as well as the function loss mutant resource and the application method thereof can be used for effectively culturing high-nitrogen-efficiency and high-yield corn varieties, and has a wide application prospect in the field of corn biotechnology breeding.

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology breeding, specifically involving the utilization of ZmSPL19 Methods and applications for regulating nitrogen use efficiency by generating loss-of-function mutations in genes. Background Technology

[0002] Nitrogen is a core component of key macromolecules such as plant proteins and chlorophyll, accounting for 1%-4% of plant dry matter. Its demand intensity far exceeds that of other nutrients, and it plays a significant regulatory role in maize growth, development, and grain yield. Adequate nitrogen supply can optimize photosynthetic efficiency, prolong leaf area duration, and thus increase yield. Nitrogen deficiency, on the other hand, causes stunted growth, reduced biomass, and premature yellowing of older leaves. Furthermore, the effects of nitrogen deficiency are specific to different growth stages: nitrogen deficiency in the early germination stage leads to a decrease in growth rate, and losses at this stage cannot be compensated for by later topdressing; nitrogen deficiency during the vegetative growth stage inhibits ear development and hinders the formation of potential grains; nitrogen deficiency during the reproductive growth stage accelerates leaf senescence, increases grain abortion rate and empty stalk rate, and ultimately reduces yield.

[0003] Nitrogen use efficiency has become a core indicator for evaluating the sustainability of crop production. Currently, the global nitrogen use efficiency of maize is only 36%, significantly lower than that of rice and wheat at 42%, and there are significant differences between different varieties and regions. Therefore, improving the nitrogen use efficiency of maize is a strategic requirement for alleviating environmental pressure and achieving sustainable development of the maize industry. Summary of the Invention

[0004] All references cited herein are incorporated herein by reference. Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Unless otherwise stated, the techniques used or mentioned herein are standard techniques known to one of ordinary skill in the art. Materials, methods, and examples are for illustrative purposes only and are not intended to be limiting.

[0005] This application's embodiments, through a series of experimental studies, have discovered that [the following occurs in corn plants]... ZmSPL19 After a gene undergoes a loss-of-function mutation, it can produce unexpected technical effects. The mutant plants exhibit phenotypes such as rapid taproot growth, increased biomass, increased nitrogen content in ear leaves, increased relative chlorophyll content, increased net photosynthetic rate, increased ear length, increased number of kernels, increased ear weight, or increased kernel yield per plant. The aforementioned gene resources and functions are of great significance for maize breeding.

[0006] Optionally, embodiments of this application provide a method for producing maize plants, wherein the maize plants have a phenotype of rapid taproot growth, or increased biomass, ear leaf nitrogen content, relative chlorophyll content, net photosynthetic rate, or significantly increased ear length, kernel number, ear weight, or single-plant kernel yield. The method includes the following steps: One or more maize plants are produced, and the maize plants shown have endogenous... ZmSPL19 The gene contains at least one loss-of-function mutation, or is endogenous. ZmSPL19 Gene expression is suppressed; Obtain at least one seed from the corn plant produced in the aforementioned steps; Optionally, wherein ZmSPL19 The gene's polynucleotide sequence is selected from one of the following groups of sequences: (a) A polynucleotide sequence as shown in SEQ ID No: 1, 2 or 3; (b) The polynucleotide sequence that encodes the amino acid sequence shown in SEQ ID No:4 or 5; (c) A polynucleotide sequence that can hybridize with the polynucleotide sequence described in (a) or (b) under strict hybridization conditions, and a loss-of-function mutation of the polynucleotide sequence in maize plants has the function of increasing the main root growth, or increasing any of the following traits: biomass, ear leaf nitrogen content, relative chlorophyll content, net photosynthetic rate, or ear length, number of kernels, ear weight, or kernel yield per plant. (d) A polynucleotide sequence that has at least 90%, 95%, or 98% similarity to any of the polynucleotide sequences shown in (a)-(c), and a loss-of-function mutation of this polynucleotide sequence in the maize plant has the function of significantly increasing any of the following traits: rapid taproot growth, or increased biomass, ear leaf nitrogen content, relative chlorophyll content, net photosynthetic rate, or ear length, kernel number, ear weight, or kernel yield per plant; or (e) A polynucleotide sequence complementary to any of the sequences described in (a)-(d).

[0007] Optionally, the embodiments provided in this application... ZmSPL19 Genes, including homologous genes or the same gene from different varieties that have at least 80%, 85%, 90%, 95%, 98%, or 99% sequence similarity to their polynucleotide sequences, or genes disclosed in the embodiments of this invention. ZmSPL19 The homologous gene or the same gene in different varieties has at least 90%, 95% or 98% sequence similarity in amino acid sequence, and the homologous gene, after endogenous homozygous loss-of-function mutation, has the function of increasing the growth of the main root of the plant, or increasing any characteristic such as biomass, nitrogen content of ear leaves, relative chlorophyll content, net photosynthetic rate, or significantly increasing any trait such as ear length, number of grains, ear weight, or grain yield per plant. The homologous gene can be isolated from any plant.

[0008] Optionally, the method provided in this application can be applied to any substance containing ZmSPL19Plants with homologous genes. Preferably, the plants include monocotyledonous plants such as corn, millet, wheat, barley, rye, rice, and sorghum, and dicotyledonous plants such as cotton, corn, peanut, sunflower, sweet potato, potato, apple, and tobacco.

[0009] The percentage of sequence similarity described in this application can be obtained using well-known bioinformatics algorithms, including the Myers and Miller algorithm, the Needleman-Wunsch global alignment method, the Smith-Waterman local alignment method, the Pearson and Lipman similarity search method, and the Karlin and Altschul algorithm, which are well known to those skilled in the art.

[0010] Those skilled in the art should know that single nucleotide polymorphisms (SNPs) exist for the same gene among different varieties of the same plant, meaning that the nucleotide sequence of the same gene often differs by a few bases. However, there are many varieties of the same crop, and it is impossible for the inventors to list them all. The embodiments of this application only provide sequences of representative varieties of maize. Therefore, those skilled in the art should know that sequences from different varieties may differ from those disclosed in this invention. ZmSPL19 Nucleotide sequences containing SNPs in their genes and nucleotide sequences, and methods and applications for obtaining traits such as improved nitrogen use efficiency, enhanced primary root growth advantage during germination under nitrogen conditions, increased seedling biomass under high nitrogen conditions, and / or increased field grain yield by utilizing their endogenous loss-of-function mutations, are also within the scope of protection of this invention.

[0011] Optionally, the loss-of-function mutations described in this application are obtained by mutation, which includes substitution, deletion, and / or addition of one or more nucleotides in the nucleotide sequence of the gene.

[0012] Optionally, the loss-of-function mutations mentioned herein include, but are not limited to, those obtained through physical mutagenesis, chemical mutagenesis, gene editing, etc. Physical mutagenesis includes, but is not limited to, radiation mutagenesis, space breeding, etc.; chemical mutagenesis methods include mutagenesis induced by treatment with mutagens such as EMS; gene editing methods include, but are not limited to, ZFN, TALEN, and / or CRISPR / Cas methods.

[0013] Those skilled in the art know that the main principle of the CRISPR / Cas gene editing system or gene editing method is to find the position to be gene-edited in the host genome through a nucleic acid fragment called guide RNA (gRNA), that is, the target DNA sequence, and then cut the DNA by the Cas protein. In this application, the Cas protein includes but is not limited to proteins such as Cas9, Cas12, Cas12a, Cas12j, Cas12e, Cas13 and / or Cas14.

[0014] Optionally, when the gene editing system used is CRISPR / Cas9, the mutant gene sequence obtained by the CRISPR / Cas9 method, the target sequence used in the CRISPR / Cas9 technology is selected from one of the sequences in the following group: (a) A fragment conforming to the 5'-Nx-NGG-3' sequence arrangement rule in the nucleotide sequences shown in SEQ ID No: 1, 2 or 3, where N represents any one of A, G, C and T, 14 < X < 30, and X is an integer, and Nx represents X consecutive nucleotides; or (b) A nucleotide sequence complementary to the polynucleotide sequence described in (a).

[0015] Optionally, the target sequence of the CRISPR / Cas9 technology is as shown in SEQ ID NO: 10 or 11.

[0016] Optionally, the ZmSPL19 gene function loss mutant Zmspl19-1 mutation characteristics are: ZmSPL19 a large fragment deletion occurs between the 340th and 1162nd bases of the genomic DNA (SEQ ID NO: 1); or ZmSPL19 a large fragment deletion occurs between the 214th and 418th bases of the CDS (SEQ ID NO: 2) of the transcript Zm00001eb207010_T001, or a large fragment deletion occurs between the 214th and 418th bases of the CDS (SEQ ID NO: 3) of the transcript Zm000,01eb207010_T002; Zmspl19-1 mutation characteristics are: ZmSPL19 a large fragment deletion occurs between the 343rd and 1165th bases of the genomic DNA (SEQ ID NO: 1); or ZmSPL19A large deletion occurs between bases 217 and 421 in the CDS (SEQ ID NO:2) of transcript Zm00001eb207010_T001, or a large deletion occurs between bases 217 and 421 in the CDS (SEQ ID NO:3) of transcript Zm00001eb207010_T002. Optionally, the loss-of-function mutant plants described in the embodiments of this application can also be obtained by crossing with maize plants that have or overexpress this loss-of-function mutation.

[0017] Optionally, the method described in the embodiments of this application, wherein the reduction or suppression ZmSPL19 Normal expression or protein function of homologous genes can be achieved through RNA interference (RNAi) and / or mutation, or by altering the promoter of functional genes using natural variation, molecular biology methods, or gene editing to obtain a phenotype with reduced expression levels or protein content. Those skilled in the art will recognize that RNAi technology is a conventional technique in the field, which involves the specific binding of 21-23 bp short double-stranded RNA (siRNA: small interfering RNA) or long double-stranded RNA (dsRNA: double-stranded RNA) to the homologous region of the mRNA expressing the target gene, causing mRNA degradation and thus inhibiting gene expression.

[0018] Alternatively, in this application, endogenous maize can be inhibited using RNAi. ZmSPL19 Gene expression, thereby affecting the activity of the aforementioned genes, and inhibiting gene expression, can improve the nitrogen use efficiency of plants, enhance the growth advantage of the taproot during germination under nitrogen conditions, increase seedling biomass under high nitrogen conditions, and / or increase field grain yield; more specifically, it can accelerate the growth of the taproot of plants, or increase any of the following traits: biomass, nitrogen content in ear leaves, relative chlorophyll content, net photosynthetic rate, or significantly increase any of the following traits: ear length, number of grains, ear weight, or grain yield per plant.

[0019] Optionally, this application also provides ZmSPL19 The application of genes in maize plants that improve nitrogen use efficiency, enhance taproot growth advantage during germination under nitrogen conditions, increase seedling biomass under high nitrogen conditions, and / or increase field grain yield; more specifically, the application of genes that increase taproot growth, or improve any of the following traits: biomass, ear leaf nitrogen content, relative chlorophyll content, net photosynthetic rate, or ear length, number of grains, ear weight, or grain yield per plant.

[0020] Optionally, this application also provides a method for obtaining this application by means of any of the foregoing. ZmSPL19The application of gene loss-of-function mutants in maize breeding, preferably, includes, but is not limited to, applications that improve nitrogen use efficiency in maize plants, enhance taproot growth advantage during germination under nitrogen conditions, increase seedling biomass under high nitrogen conditions, and / or increase field grain yield. More specifically, applications that significantly increase taproot growth, or any of the following traits: biomass, ear leaf nitrogen content, relative chlorophyll content, net photosynthetic rate, or ear length, number of grains, ear weight, or grain yield per plant.

[0021] Optionally, embodiments of this application also provide feed, coarse flour, protein, or oil products made from corn, wherein the feed, coarse flour, protein, or oil products contain... ZmSPL19 Loss-of-function mutants of genes, the ZmSPL19 Contains at least one loss-of-function mutation, or endogenous ZmSPL19 Gene expression is suppressed. The loss-of-function mutation includes the substitution, deletion, and / or addition of one or more nucleotides in the nucleotide sequence of the aforementioned gene.

[0022] Optionally, embodiments of this application also provide a gene mutant, wherein the gene mutant is... ZmSPL19 A loss-of-function mutant, characterized by endogenous mutations in the maize plant. ZmSPL19 After gene mutation, it has the function of improving nitrogen use efficiency and / or increasing the number of lateral roots in plants. ZmSPL19 The gene's polynucleotide sequence is selected from one of the following groups of sequences: (a) A polynucleotide sequence as shown in SEQ ID No: 1, 2 or 3; (b) The polynucleotide sequence that encodes the amino acid sequence shown in SEQ ID No: 4 or 5; (c) A polynucleotide sequence that can hybridize with the polynucleotide sequence described in (a) or (b) under strict hybridization conditions, and a loss-of-function mutation of the polynucleotide sequence endogenous in maize plants has the function of increasing nitrogen use efficiency and / or increasing the number of lateral roots. (d) A polynucleotide sequence that has at least 90%, 95%, or 98% similarity to any of the polynucleotide sequences shown in (a)-(c), and a loss-of-function mutation in this polynucleotide sequence endogenously in the maize plant has the function of increasing nitrogen use efficiency and / or increasing the number of lateral roots; or (e) A polynucleotide sequence complementary to any of the sequences described in (a)-(d).

[0023] Optionally, the loss-of-function mutant is a large deletion between bases 340 and 1162 or between bases 343 and 1165 in SEQ ID NO:1, or a large deletion between bases 214 and 418 or between bases 217 and 421 in SEQ ID NO:2, or a large deletion between bases 214 and 418 or between bases 217 and 421 in SEQ ID NO:3.

[0024] Optionally, the methods described in the embodiments of this application for transferring nucleotide sequences, vectors, constructs, or expression cassettes into plants, introducing them into plants, or transforming plants all refer to transferring the target nucleotide sequence, construct, vector, or expression cassette into recipient cells or recipient plants through conventional transgenic methods or methods of hybridization with target transgenic plants. Any transgenic method known to those skilled in the art can be used to transform recombinant expression vectors into plant cells to produce transgenic plants or mutants of the embodiments of this application. Transformation methods may include direct or indirect transformation methods. Specifically, the transformation methods include, but are not limited to, polyethylene glycol-induced DNA uptake, liposome-mediated transformation, gene gun introduction, electroporation, microinjection, and Agrobacterium-mediated plant transformation methods.

[0025] Compared with the prior art, this application has the following beneficial effects: (1) This application provides a method for producing maize plants and its application, by obtaining ZmSPL19 Loss-of-function mutants of genes, or mutants that suppress gene function in plants ZmSPL19 By controlling gene expression levels, plants with superior agronomic traits such as improved nitrogen use efficiency, enhanced taproot growth advantage during germination under nitrogen conditions, increased seedling biomass under high nitrogen conditions, and / or increased grain yield in the field can be obtained. The aforementioned genes, methods, and their applications provide new germplasm resources and breeding strategies for maize breeding, which are of great significance to global food security and sustainable agricultural development. (2) It was clarified that corn ZmSPL19 The functions resulting from gene mutations provide new genetic resources for crop species and offer new insights into the study of gene action mechanism networks.

[0026] Term definitions involved in the present invention Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods, apparatus, and materials similar to or equivalent to those described herein may be used in the practice or testing of this invention, preferred methods, apparatus, and materials are now described.

[0027] In the context of this application, the terms "polynucleotide" or "nucleotide" mean deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and their polymers in single-stranded or double-stranded form. Unless specifically limited, the term covers nucleic acids containing known analogs of natural nucleotides, which have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.

[0028] In this application, the term "homologous gene" refers to two or more gene sequences with a sequence similarity of 80%, including orthologous genes (also known as vertical homologous genes, positive homologous genes, or directed evolutionary homologous genes), transverse homologous genes (also known as paralogous genes, paralogous homologous genes, or parallel evolutionary homologous genes), and / or heterologous genes.

[0029] The term "sequence similarity" refers to the degree of similarity between two sequences. It is a quantitative concept used to compare the similarity between different sequences, thereby discovering and analyzing the association between the two sequences. Sequence similarity can be used to compare gene sequences, protein sequences, DNA sequences, etc.

[0030] The term "strict hybridization conditions" as used in this application refers to conditions of low ionic strength and high temperature known in the art. Typically, under strict conditions, the detectability of a probe hybridizing with its target sequence is significantly higher than that with other sequences (e.g., at least twice the background level). Strict hybridization conditions are sequence-dependent and will vary under different environmental conditions; longer sequences hybridize specifically at higher temperatures. Target sequences that are 100% complementary to the probe can be identified by controlling the strictness of hybridization or washing conditions. Detailed guidance on nucleic acid hybridization can be found in relevant literature (Tijssen, ...). Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Probes, (Overview of principles of hybridization and the strategy of nucleic acid assays. 1993). More specifically, the stringent conditions are typically chosen to be below the melting point (T0) of the specific sequence at a specified ionic strength pH. m Approximately 5-10℃. m The temperature at which 50% of the probe complementary to the target sequence hybridizes to the target sequence under equilibrium conditions (at specified ionic strength, pH, and nucleic acid concentration) (because the target sequence is present in excess, therefore at T...). m(Under equilibrium conditions, 50% of the probe is occupied). Strict conditions may include: a salt concentration of less than about 1.0 M sodium ions at pH 7.0 to 8.3, typically about 0.01 to 1.0 M sodium ions (or other salts), and a temperature of at least about 30°C for short probes (including, but not limited to, 10 to 50 nucleotides) and at least about 60°C for long probes (including, but not limited to, greater than 50 nucleotides). Strict conditions can also be achieved by adding a destabilizing agent such as formamide. For selective or specific hybridization, the positive signal may be at least twice the background hybridization, and, where appropriate, 10 times the background hybridization. Exemplary strict hybridization conditions may be: 50% formamide, 5×SSC and 1% SDS, incubated at 42°C; or 5×SSC, 1% SDS, incubated at 65°C, washed in 0.2×SSC and washed in 0.1% SDS at 65°C. The washing can be performed for 5, 15, 30, 60, 120 minutes or longer.

[0031] The term "recombinant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, along with vectors containing helper plasmids, are commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: the cis-acting sequence required for T-DNA transfer, a selection marker engineered for expression in plant cells, and the heterologous DNA sequence to be transcribed.

[0032] The term "hybridization" is used in a broad sense to refer to the process by which gametes from different populations or genotypes combine to produce hybrids. Depending on the parental relationship, it includes close hybridization and distant hybridization.

[0033] The term "mutation" as used in this application refers to a "loss-of-function mutation" or "loss-of-function mutation," which is a mutation in the coding sequence of a gene that causes a reduction or complete loss of function in the gene product (usually a protein). Loss-of-function mutations can be caused, for example, by truncation of the gene product (due to frameshift or nonsense mutations), and the phenotype associated with an allele having a loss-of-function mutation can be recessive or dominant.

[0034] The term "RNA interference" (RNAi) is a gene blocking technology that uses a double-stranded RNA (dsRNA) molecule to block or silence the expression of a specific gene at the mRNA level; it is also known as sequence-specific post-transcriptional gene silencing (PTGS). Attached Figure Description

[0035] Figure 1 For different nitrates (NO3) - Under concentration gradient treatments (0, 0.04 mM, 0.4 mM, 4 mM, 10 mM), the aboveground parts (a) and roots (b) of maize inbred line B73 seedlings at the one-leaf-one-heart stage were examined. ZmSPL19 Changes in the relative expression levels of genes.

[0036] [[ID=३४]]Figure 2 Nitrogen starvation (a; 0–4 days) and nitrogen resupply (b; 0, 1, 4, 8, 12 h) were observed in the roots of maize inbred line B73 seedlings at the two-leaf-one-heart stage. ZmSPL19 The relative expression levels of genes change dynamically.

[0037] Figure 3 for ZmSPL19 A schematic diagram of the gene-editing CRISPR / Cas9 vector.

[0038] Figure 4 for ZmSPL19 A schematic diagram of the linear structure of the T-DNA region elements and target sites in the CRISPR / Cas9 vector for gene knockout.

[0039] Figure 5 for ZmSPL19 Gene-edited mutant materials ( Zmspl19-१ and Zmspl19-२ A diagram illustrating mutation types.

[0040] Figure 6 For nitrogen-containing and nitrogen-deficient conditions ZmSPL19 Gene-edited mutant materials ( Zmspl19-१ and Zmspl19-२ ) and the dynamic changes in taproot length during the germination period of wild-type maize; where a is the growth dynamics of taproot length during the germination period of wild-type maize. Zmspl19-१ and Zmspl19-२ The phenotypes of the primary roots of germinating wild-type maize seeds cultured for 6 days under nitrogen-containing and nitrogen-deficient conditions are shown, with b–e representing nitrogen-containing (b and d) and nitrogen-deficient (c and e) conditions, respectively. Zmspl19-१ (b and c) and Zmspl19-२ (d and e) and their corresponding wild-type maize germination period taproot length growth dynamics diagrams.

[0041] Figure Seven for ZmSPL19 Gene-edited mutant materials ( Zmspl19-१ and Zmspl19-२ Phenotypic (a) and seedling biomass statistics (b) of wild-type maize after two weeks of cultivation under different nitrogen conditions (0 mM KNO3, 0.2 mM KNO3, 5 mM KNO3).

[0042] Figure 8 Under conventional nitrogen application conditions in the field ZmSPL19 Gene-edited mutant materials ( Zmspl19-१ and Zmspl19- 2 Statistics on the nitrogen content of ear leaves during the silking stage of wild-type maize and their corresponding wild-type maize.

[0043] Figure 9 Under conventional nitrogen application conditions in the field ZmSPL19 Gene-edited mutant materials ( Zmspl19-१ and Zmspl19- 2 The phenotype (a) of wild-type maize at the silking stage, as well as the SPAD value (b) and net photosynthetic rate (c) of ear-side leaves, are statistically analyzed.

[0044] [[ID=६४]]Figure 10 Under conventional nitrogen application conditions in the field ZmSPL19 Gene-edited mutant materials ( Zmspl19-१ and Zmspl19- 2 The female ear phenotype (a) and ear length (b), number of kernels per ear (c), ear weight (d), and kernel yield per ear (e) of wild maize, respectively. Detailed Implementation

[0045] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0046] The inbred lines and maize varieties used in the following examples can be obtained from the "China Crop Germplasm Information Network" and the corresponding seeds can be obtained by applying for them.

[0047] Example 1. ZmSPL19 Transcriptional response analysis of genes under different nitrate concentrations, nitrogen starvation, and nitrogen supply conditions In order to investigate ZmSPL19To investigate the gene response to nitrogen, seeds of the maize inbred line B73 were used as plant material. Plump seeds of uniform size were selected, first surface-sterilized with a 0.3%–0.5% sodium hypochlorite solution for 10 min, then rinsed five times with sterile water, and finally soaked in a saturated calcium sulfate solution for 16 h. Germination was then carried out on filter paper. When the radicle reached 1 cm in length, seeds of uniform germination were stuffed into a sponge and placed in a planting basket, which was then inserted into the holes of the hydroponic incubator lid. The basket was then placed in a 25℃ constant temperature and light incubator (16 h light / 8 h dark) and cultured in sterile water for 6 days. Subsequent treatment experiments were conducted when the seedlings reached the one-leaf-one-heart stage.

[0048] In order to detect ZmSPL19 Genes in different nitrates (NO3) - The expression characteristics under concentration gradients were investigated as follows: B73 maize seedlings that had grown to the one-leaf-one-heart stage were selected and replaced with nitrogen-containing plants containing different concentrations of NO3. - The cells were cultured in Hoagland nutrient solution, with KNO3 as the sole nitrogen source. A nitrate concentration gradient was constructed by adjusting the concentrations of potassium nitrate (KNO3) and potassium chloride (KCl) in the nutrient solution: the treatment group received 0, 0.04 mM, 0.4 mM, 4 mM, and 10 mM KNO3 sequentially (without additional KCl); the control group received the same concentrations of KCl solution (0, 0.04 mM, 0.4 mM, 4 mM, and 10 mM, without KNO3) to exclude potassium ions (K... + To minimize interference, the remaining components and their concentrations were: 5 mM CaCl2, 2 mM MgSO4, 0.05 mM EDTA-Fe-Na salt, 0.5 mM KH2PO4, 50 μM H3BO4, 10 μM MnCl2, 1 μM ZnSO4, 0.3 μM CuSO4, and 0.5 μM Na2MoO4. The pH was adjusted to 5.8.

[0049] The nutrient solution was changed every 3 days during the culture period. After 2 weeks of culture, the aboveground parts and roots were collected separately. RNA was extracted using the Trizol method and detected by quantitative real-time PCR (qRT-PCR). ZmSPL19 Changes in expression levels. Using maize... Tubulin5(Zm00001eb107490) was used as an internal reference gene. The qRT-PCR primer sequences were: qZmSPL19-F: 5'-GGAAATAAGAGAGGTGTCAACG-3' (SEQ ID NO:6), qZmSPL19-R: 5'-TTCATTGGCCAAGGCTCATCT-3' (SEQ ID NO:7); qTubulin5-F: 5'-GCCGTTGCCGAGGTGTTC-3' (SEQ ID NO:8), qTubulin-R: 5'-GTCCTTCTCAAGAGCAGCCAAGT-3' (SEQ ID NO:9); the results showed that... ZmSPL19 Gene transcription levels were affected by different NO3 levels - The effect of concentration treatment. Specifically ZmSPL19 Gene expression levels in the aboveground and root parts of the maize B73 inbred line increased with NO3 levels. - The increase in supply significantly reduced ( P <0.05; [[ID=七五]]Figure 1 ).

[0050] In order to detect ZmSPL19 To investigate the dynamic changes in gene expression under nitrogen starvation and nitrogen supply conditions, and to further verify the association between this gene and the nitrogen signaling response in maize, the following experiment was conducted: Maize B73 inbred line seedlings at the one-leaf-one-heart stage were selected and first transferred to Hoagland nutrient solution containing 4 mM KNO3 for two weeks. Then, the seedlings were divided into two groups. The experimental group was transferred to a nutrient solution without KNO3 (replaced with 4 mM KCl) for nitrogen starvation treatment, while the control group continued to be cultured in Hoagland nutrient solution containing 4 mM KNO3. Seedling root samples were collected at 0, 1, 2, 3, and 4 days (d) after nitrogen starvation treatment. After 4 days of nitrogen starvation treatment, the experimental group seedlings were transferred to a nitrogen-containing nutrient solution containing 4 mM KNO3 for nitrogen replenishment treatment. At the same time, the control group seedlings were transferred to a nitrogen-starved nutrient solution containing 4 mM KCl for continued culture. Seedling root samples were collected at 0, 1, 4, 8, and 12 hours (h) after nitrogen replenishment. Total RNA was extracted from samples at different time points using the Trizol method, and cDNA was synthesized by reverse transcription and then detected by qRT-PCR. ZmSPL1९ The transcriptional level of genes. The results showed that... ZmSPL19 Gene transcription levels were significantly regulated by nitrogen deficiency and nitrogen replenishment: After nitrogen starvation treatment, the expression level of this gene in the roots of maize B73 inbred lines gradually increased, with the expression levels on days 2, 3, and 4 of treatment being significantly higher than that on day 0 of treatment. P <0.05); After nitrogen resupply, the expression level of this gene decreased significantly at 1 h (P<0.05), and then showed a fluctuating downward trend.s ).

[0051] Therefore, we can know that corn Figure 2 Gene transcription levels are regulated by different nitrate concentrations, nitrogen starvation, and nitrogen supply.

[0052] Example 2. ZmSPL19 Obtaining gene-editing materials ZmSPL19 The genomic DNA sequence is shown in SEQ ID NO:1, and the CDS sequences of the two corresponding transcripts are shown in SEQ ID NO:2 and 3, respectively. The protein amino acid sequences corresponding to the two transcripts are shown in SEQ ID NO:4 and 5, respectively. For the purpose of research... ZmSPL19 The function of genes, as described in this embodiment, is constructed. ZmSPL19 The gene was knocked out using a CRISPR / Cas9 gene knockout vector, and then genetically transformed into maize plants (background material ZC01).

[0053] Construction of gene knockout vectors: selection ZmSPL19 The target region is located between the first and second exons of the gene (Zm00001eb207010_T002), based on... ZmSPL19 The nucleotide sequence of the gene (SEQ ID NO:1) was used to identify target 1 and target 2 using the online tool GRISPR-P2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The target sequences are as follows: ZmSPL19 : 5'-GCAGGGTCAAGGAGTACCACCGG-3' (SEQ ID NO: 10); ZmSPL19-Target1 : 5'-CCAGATGCATTCGCCTTTGCCTC-3' (SEQ ID NO:11). Next, a single guide RNA (sgRNA) sequence targeting the gene was designed. The specific nucleotide sequence of the sgRNA is: GTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:12). Homologous recombination technology was used to ligate the sgRNA into the pCPB vector (see the literature RNA-guided Cas9 as an in vivo desired-target mutator in maize. Plant Biotechnol J. 2017 Dec;15(12):1566-1576. doi:10.1111 / pbi.12739.) to construct the desired gene. ZmSPL19-Target2The gene knockout vector was named pCPB-Ubi::hspCas9. ZmSPL19 The structure of a gene knockout vector is as follows: ZmSPL19 As shown, the component structure between LB and RB is as follows: Figure 3 As shown.

[0054] Genetic transformation of maize plants: using Agrobacterium-mediated transformation Figure 4 The gene knockout vector pCPB-Ubi::hspCas9 was genetically transformed into maize plants (maize inbred line ZC01). The obtained maize plants were identified by PCR and subjected to Sanger sequencing of their nucleotide sequences, ultimately yielding two homozygous mutant plants, which were named... [[ID=九十三]]ZmSPL19 and Zmspl19-१ Its gene mutation types are as follows Zmspl19-२ As shown. Figure 5 The mutation characteristics are: Zmspl19-१ A large deletion occurs in the genomic DNA between bases 340 and 1162; or ZmSPL19 Transcript Zm00001eb207010_T001 has a large deletion between bases 214 and 418 in its CDS, or transcript Zm00001eb207010_T002 has a large deletion between bases 214 and 418 in its CDS. ZmSPL19 The mutation characteristics are: Zmspl19-१ A large deletion occurs in the genomic DNA between bases 343 and 1165; or ZmSPL19 Transcript Zm00001eb207010_T001 and transcript Zm00001eb207010_T002 both exhibit large deletions in their CDS between bases 217 and 421. Further amino acid sequence analysis revealed that these mutants experienced premature termination of protein translation and disrupted... ZmSPL19 The SBP functional domain of the gene. For Zm00001eb207010_T001 (SEQ ID NO:2), its SBP domain coding region is located at nucleotides 175 to 408 of the CDS sequence, corresponding to amino acid residues 59 to 136 of the encoded protein; for Zm00001eb207010_T002 (SEQ ID NO:3), its SBP domain coding region is located at nucleotides 175 to 408 of the CDS sequence, corresponding to amino acid residues 59 to 136 of the encoded protein. This domain is a core conserved domain of the SPL (SQUAMOSA promoter-binding protein-like) protein family, and its core function is to specifically bind to the GTAC core cis-acting element in the promoter region of downstream target genes, thereby regulating the transcriptional expression of target genes.

[0055] Example 3. ZmSPL19 Analysis of primary root growth characteristics of knockout mutants during germination under different nitrogen conditions Select wild type, ZmSPL19 and Zmspl19-१ Plump seeds of the mutant material were first surface-sterilized with 0.3%–0.5% sodium hypochlorite solution for 10 min, rinsed 5 times with sterile water, then soaked in saturated calcium sulfate solution for 16 h, and finally germinated on filter paper. Seeds were ready for use when the radicle length reached 4–5 cm. Two treatment groups were set up: nitrogen (5 mM KNO3) and nitrogen-free (0 mM KNO3, with 5 mM KCl to eliminate potassium ion interference). Each group had 5 replicates, with 2 seeds per replicate. The sterilized seeds were placed in petri dishes lined with moist filter paper. The nitrogen-treated group was watered with sterile water containing 5 mM KNO3, while the nitrogen-free group was watered with sterile water without nitrogen (5 mM KCl). The dishes were incubated in a 25℃ constant temperature and light incubator (16 h light / 8 h dark). Germination was observed and recorded daily during the incubation period. The primary root length was measured using ImageJ, and a growth dynamic graph was plotted based on the primary root length.

[0056] The results showed that under nitrogen-free conditions, Zmspl19-२ , Zmspl19-१ The taproot length of the mutants did not differ significantly from their corresponding wild types (WT1, WT2) (P>0.05). However, after culturing under nitrogen conditions for 4–6 days, the taproot length of both mutants was significantly higher than that of their corresponding wild types (P<0.05), indicating that… Zmspl19-२ Gene knockout significantly promoted taproot growth in maize after germination under nitrogen-containing conditions, but had no effect on taproot growth under nitrogen-free conditions. ZmSPL19 ).

[0057] Example 4. Figure 6 Analysis of seedling nitrogen response characteristics of knockout mutants Select wild type, ZmSPL19 and Zmspl19-१Plump seeds of the mutant material were sterilized and germinated on filter paper. Once the radicle length reached 1 cm, they were cultured hydroponically using the paper roll method. Along the long side of the thick germination paper, the germinated seeds were laid flat 4 cm from the top edge of the germination paper. The seeds were spaced 3 cm apart, and a 3 cm gap was maintained between each side of the filter paper. Then, another thin layer of germination paper was placed on top, rolled into a roll approximately 5 cm thick, and secured with a rubber band. A 2 L glass beaker was prepared and filled with sterilized high-nitrogen (5 mM KNO3), low-nitrogen (0.2 mM KNO3), or nitrogen-free (0 mM KNO3) Hoagland nutrient solution (with potassium ions supplemented by KCl solution) to half the beaker's volume (approximately 400 mL). The brown paper roll was placed vertically into the beaker, ensuring the seeds were on top and not submerged in the solution, while ensuring approximately half the length of the paper roll was immersed in the solution. The plants were cultured in a constant temperature and light incubator at 25℃ (16h light / 8h dark). The nutrient solution was changed every 2 days during the cultivation period. The plants were harvested after 14 days of cultivation. After harvesting, the plants were rinsed with distilled water, the surface moisture was blotted with filter paper, and then placed in an oven at 105℃ for 30 min to blanch. They were then dried at 80℃ to constant weight, and the biomass of the plants was measured.

[0058] The results showed that under nitrogen-free and low-nitrogen treatments, Zmspl19-२ With WT1, Zmspl19-१ There was no significant difference in biomass between WT2 and WT2 (P>0.05); however, under high nitrogen treatment, Zmspl19-२ , Zmspl19-१ The biomass of the mutants was significantly higher than that of their corresponding wild-type counterparts (P<0.05), among which Zmspl19-२ The total biomass of the mutant increased by 20.1% compared to WT1. Zmspl19-१ The total biomass of the mutant increased by 50.6% compared to WT2, indicating that... Zmspl19-२ Gene knockout significantly increased maize seedling biomass under high nitrogen conditions (≥5 mM NO3). ZmSPL19 ).

[0059] Example 5. Figure 7 Field nitrogen efficiency characteristics analysis of knockout mutants In the winter of 2023, wild-type and... ZmSPL19 and Zmspl19-१The materials were planted using a phased fertilization method. During the seedling stage (V4), fertilization was carried out in furrows during inter-row cultivation, with a fertilizer combination of 218 kg / ha of urea (equivalent to 100 kg / ha of pure nitrogen), 750 kg / ha of superphosphate (calculated as P2O5), and 135 kg / ha of potassium chloride (calculated as K2O). At the jointing stage (V12), 218 kg / ha of urea (equivalent to 100 kg / ha of pure nitrogen) was applied as a top dressing to meet the nitrogen requirements of maize during its rapid growth phase. The planting density in the experiment was 60,000 plants per hectare, which was set with reference to the conventional planting density of the local main varieties.

[0060] Nitrogen content in leaves was measured using an N-Pen N110 handheld nitrogen meter at the silking stage of the female ear. To ensure accuracy, measurements were taken at the base, middle, and tip of the leaves at the ear position, and averages were calculated. At least 20 plants were measured for each material. Statistical analysis of the data revealed that… Zmspl19-२ and Zmspl19-१ The leaf nitrogen content of the mutant was significantly higher than that of its corresponding wild type (P<0.05), with increases of 8.2% and 8.7%, respectively, indicating that... Zmspl19-२ This gene has an inhibitory effect on nitrogen use efficiency in maize. Knocking out this gene significantly increases the nitrogen content in the ear leaves of ZC01 background maize under conventional nitrogen application conditions in the field. s ).

[0061] Example 6. ZmSPL19 Field photosynthetic characteristics analysis of knockout mutants In the winter of 2023, at the Yazhou experimental station in Sanya, Hainan, similar studies were conducted on wild-type... Figure 8 ZmSPL19 Zmspl19-१ and Zmspl19-2 The photosynthetic indicators of the materials were tested. During the silking stage of maize, the relative chlorophyll content (SPAD value) was measured using a SPAD502 chlorophyll meter, with the measurement site being the middle of the ear-shaped leaves. Each sample was tested in five replicates, and the average value was taken. The net photosynthetic rate of the maize ear-shaped leaves was measured using a LI-6400XT portable photosynthesis meter. Measurements were taken between 10:00 AM and 12:00 PM. Wild-type plants and their corresponding mutant plants within the same group needed to be measured within one hour to ensure consistent environmental conditions. During measurement, after the field temperature stabilized at around 30°C, the middle of the ear-shaped leaves (avoiding damaged or deformed areas) was selected as the measurement site. The leaves were flattened and fixed in a suitable leaf chamber (effective measurement area 2 cm²). 2In the assay, ensure that the leaves completely cover the measurement area and that the leaf chamber is well sealed. Instrument parameters are set as follows: photosynthetically active radiation (PAR) is controlled at 1800 μmol / m / s using an LED light source (simulating maximum field light intensity); CO2 concentration is stabilized at 400 ppm using the built-in control system; gas flow rate is set to 500 μmol / s; leaf chamber temperature is dynamically monitored based on field ambient temperature (approximately 30°C). After the instrument readings stabilize (fluctuations in parameters such as net photosynthetic rate Pn and stomatal conductance not exceeding 5% within 30 consecutive seconds), the net photosynthetic rate value is recorded. Three different parts of each plant are measured (technical replication), and at least five plants are measured for each treatment (biological replication). The average value is taken. To ensure data accuracy, the CO2 and water vapor sensors of the instrument must be calibrated with 400 ppm standard CO2 gas and saturated salt solution before each daily measurement.

[0062] The results showed that, Zmspl19-1 , Zmspl19-2 The SPAD value (relative chlorophyll content) and net photosynthetic rate of the ear-position leaves of the mutant were significantly higher than those of their corresponding wild types (WT1, WT2, P<0.05). Zmspl19-1 The mutant's net photosynthetic rate was 10.4% higher than that of WT1. Zmspl19-2 The mutant's net photosynthetic rate was 9.8% higher than that of WT2, indicating that... ZmSPL19 Gene knockout can significantly increase the chlorophyll content and photosynthetic efficiency of ear leaves in maize under conventional nitrogen application conditions in the field. Figure 9 It should be noted that nitrogen regulates key processes in plant photosynthesis, as described in this embodiment. ZmSPL19 The effect of gene knockout on photosynthetic efficiency is related to the improvement of nitrogen use efficiency in plants.

[0063] Example 7. ZmSPL19 Field analysis of female ear traits and yield of knockout mutants In the winter of 2023, also at the Yazhou Experimental Station in Sanya, Hainan, experiments were conducted on the cultivation of wild-type... Zmspl19-1 and Zmspl19-2 The materials were open-pollinated and harvested 45 days after pollination. Female ear traits (ear length and number of grains per ear) and yield data (ear weight and grain yield per ear) were recorded. At least 10 plants of each material were measured.

[0064] The results showed that, at a nitrogen application rate of 200 kg / ha, compared with their respective wild types (WT1, WT2), Zmspl19- 1 , Zmspl19-2 The mutant ear length, number of kernels, and ear weight were all significantly increased (P<0.05), among which Zmspl19-1The mutant ear length increased by 6.7% compared to WT1, the number of kernels increased by 2.2% compared to WT1, and the ear weight increased by 16.4% compared to WT1. Zmspl19-2 The mutant ear length increased by 11.1% compared to WT2, the number of grains increased by 7.4% compared to WT2, and the ear weight increased by 18.8% compared to WT2; ultimately, in terms of single-plant grain yield, Zmspl19-1 , Zmspl19-2 The mutant strains showed significantly higher levels of nitrogen than their corresponding WT1 and WT2 strains (P<0.05), with increases of 22.3% and 18.5%, respectively, indicating that under conventional nitrogen application conditions in the field, ZmSPL19 Gene knockout significantly improved ear traits in ZC01 background maize, resulting in a significant increase in ear length, kernel number, and ear weight, as well as an increase in kernel yield per plant. Figure 10 ).

[0065] In summary, the above experimental results show that, ZmSPL19 Genes that respond to nitrogen signals show decreased expression under high-nitrogen conditions and increased expression under low-nitrogen conditions; these genes were obtained through gene editing. ZmSPL19 mutant ( Zmspl19-1 , Zmspl19- 2 Under nitrogen-rich conditions, the mutant exhibited superior taproot growth during germination, and under high-nitrogen conditions, seedling biomass was significantly increased. Under conventional nitrogen application in the field, the mutant showed significantly enhanced nitrogen content in the ear leaves, SPAD (relative chlorophyll content), and net photosynthetic rate. All ear traits were significantly improved, with ear length, grain number, and ear weight all increasing significantly, resulting in a significant increase in grain yield per plant. In summary, ZmSPL19 This gene negatively regulates nitrogen use efficiency in maize. Mutating this gene can significantly improve the growth performance and yield of maize under high nitrogen conditions, and has important breeding application value.

[0066] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method of producing a maize plant, comprising, The corn plant has a phenotype of fast taproot growth, or any one of increased biomass, ear leaf nitrogen content, chlorophyll relative content, net photosynthetic rate, or any one of significantly increased ear length, kernel number, ear weight, and grain yield per plant, the method comprising the steps of: producing one or more com plants, wherein the endogenous ZmSPL19 gene of the com plants contains at least one loss-of-function mutation, or the endogenous ZmSPL19 gene expression is suppressed; obtaining at least one seed of the corn plant produced in the preceding step; The ZmSPL19 polynucleotide sequence of the gene is selected from one of the sequences of the following group: (a) a polynucleotide sequence as set forth in SEQ ID No: 1, 2, or 3; or (b) a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID No: 4 or 5.

2. The method of claim 1, wherein the loss-of-function mutation comprises one or more substitutions, deletions, and / or additions of nucleotides in the polynucleotide sequence of the gene; and wherein the gene expression is inhibited by RNA interference.

3. The method of claim 2, wherein the loss-of-function mutation is obtained by physical mutagenesis, chemical mutagenesis, ZFN, TALEN, and / or CRISPR / Cas gene editing technology, or by crossing with a corn plant having the loss-of-function mutation.

4. The method of claim 3, wherein the CRISPR / Cas gene editing is a CRISPR / Cas9 gene editing technology, and the target sequence used by the CRISPR / Cas9 is selected from one of the following sequences: (I) a fragment of the nucleotide sequence as set forth in SEQ ID No: 1, 2, or 3, which conforms to the sequence arrangement rule of 5'-Nx-NGG-3', wherein N represents any one of A, G, C, and T, 14 < X < 30, and X is an integer, Nx represents X consecutive nucleotides; or (II) a nucleotide sequence complementary to the polynucleotide sequence of (I).

5. The method of claim 4, wherein the target sequence is as set forth in SEQ ID NO: 10 or 11.

6. The method of any one of claims 1-4, wherein the loss-of-function mutation is a large fragment deletion between bases 340 and 1162 or between bases 343 and 1165 of SEQ ID NO: 1, or a large fragment deletion between bases 214 and 418 or between bases 217 and 421 of SEQ ID NO: 2, or a large fragment deletion between bases 214 and 418 or between bases 217 and 421 of SEQ ID NO:

3.

7. Use of the method of any one of claims 1-5 in breeding a corn plant with fast taproot growth, or any one of increased biomass, ear leaf nitrogen content, chlorophyll relative content, net photosynthetic rate, or any one of significantly increased ear length, kernel number, ear weight, and grain yield per plant.

Images