Method for constructing Myh6-CRE transgenic golden hamster model and application of Myh6-CRE transgenic golden hamster model
By constructing a Myh6-CRE transgenic golden hamster model and using the Myh6 promoter to drive the expression of Cre recombinase, the genetic manipulation problem of golden hamsters in cardiovascular research has been solved, enabling precise regulation of genes in cardiomyocytes and promoting research on the mechanisms of heart disease and the development of new therapies.
Patent Information
- Application Number
- CN202610029855.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-10
- Publication Date
- 2026-04-07
AI Technical Summary
Due to the lack of genetic manipulation tools, it is difficult to perform conditional gene knockout and lineage tracing in golden hamsters, which limits their application in cardiovascular research, especially the precise regulation and monitoring of the MYH6 gene.
A Myh6-CRE transgenic golden hamster model was constructed. By inserting a specific DNA molecule into the golden hamster genome, the expression of Cre recombinase was driven by the Myh6 promoter, thereby achieving spatiotemporal specific manipulation of genes in cardiomyocytes.
It provides precise means of regulating genes in cardiomyocytes, advances cardiovascular research, helps understand the mechanisms of heart disease, and develops new therapies.
Smart Images

Figure CN121801930A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically to the field of animal model making, and specifically relates to a method and application for constructing a Myh6-CRE transgenic golden hamster model. Background Technology
[0002] Syrian golden hamster ( Mesocricetus auratus Golden hamsters are valuable biomedical model animals. They exhibit higher physiological and pathological similarities to humans in multiple research areas, including lipid metabolism, viral infection, reproductive biology, cardiovascular and liver diseases, surpassing traditional rat models. However, the application of this species is limited by the scarcity of genetic manipulation tools. Golden hamster fertilized eggs are extremely sensitive to external factors such as light and pH, making embryo manipulation techniques such as microinjection difficult and inefficient. This severely restricts the development of precise functional genomics research, such as conditional gene knockout and lineage tracing, and also affects their widespread application in mechanistic exploration and preclinical translational research.
[0003] To overcome this bottleneck, developing efficient and specific genetic manipulation tools is crucial. Among these, the myosin heavy chain 6 (MYH6) gene is a key molecular target in cardiac research. MYH6 is primarily expressed in cardiomyocytes and is a core protein constituting the thick filaments of cardiac sarcomeres. It directly regulates myocardial contraction and plays an irreplaceable role in maintaining normal cardiac function. Its mutations are closely associated with various hereditary heart diseases, such as dilated cardiomyopathy and hypertrophic cardiomyopathy. Therefore, precise regulation and monitoring of MYH6 expression and function are of great significance for a deeper understanding of the mechanisms of heart disease and the development of new therapies.
[0004] Using the Myh6 gene promoter to drive Cre recombinase expression is one of the most classic strategies for achieving conditional gene manipulation (such as knockout, overexpression, or lineage tracing) in cardiomyocytes. The successful construction of a cardiomyocyte-specific Cre expression model in golden hamsters will directly address the core issue of the lack of genetic tools in cardiovascular research on this species. This model enables spatiotemporally specific modification of target genes in cardiomyocytes, allowing for in-depth research into cardiac development, functional maintenance, and disease mechanisms within a more closely resembling human physiology, greatly enhancing the application value of golden hamsters in precision cardiovascular medicine research. Summary of the Invention
[0005] The purpose of this invention is to provide a method and application for constructing a Myh6-Cre golden hamster model.
[0006] This invention provides a specific DNA molecule that comprises, from upstream to downstream, the following elements: an upstream insulator, a Myh6 promoter, a Cre recombinase-encoding gene, and a downstream insulator.
[0007] Specifically, the specific DNA molecule comprises the following elements from upstream to downstream: an upstream insulator, a Myh6 promoter, a Cre recombinase encoding gene optimized by the golden hamster codon, b-globin polyA, and a downstream insulator.
[0008] Specifically, the specific DNA molecule is composed of the following elements from upstream to downstream: an upstream insulator, a Myh6 promoter, a Cre recombinase-encoding gene, b-globin polyA, and a downstream insulator.
[0009] Specifically, the upstream insulator is shown in positions 1-1319 of SEQ ID NO: 1.
[0010] Specifically, the downstream insulator is shown in positions 8558-9804 of SEQ ID NO: 1.
[0011] Specifically, the Myh6 promoter is shown in bits 1320-6755 of SEQ ID NO: 1.
[0012] Specifically, the Cre recombinase encoding gene is shown in sequence 6756-7808 of SEQ ID NO: 1.
[0013] Specifically, the b-globin polyA is shown as SEQ ID NO: 1, numbers 7809-8557.
[0014] Specifically, the specific DNA molecule is shown in SEQ ID NO: 1.
[0015] The present invention also protects a kit for constructing transgenic golden hamsters, which includes any of the specific DNA molecules described above.
[0016] Specifically, the kit also includes Cre identification primers and control primers.
[0017] The Cre identification primers are shown in SEQ ID NO: 2 and SEQ ID NO: 3.
[0018] The control primers are shown in SEQ ID NO:4 and SEQ ID NO:5.
[0019] Specifically, the kit also includes a primer pair consisting of the primers shown in SEQ ID NO: 2 and SEQ ID NO: 3.
[0020] Specifically, the kit also includes a primer pair consisting of the primers shown in SEQ ID NO:4 and SEQ ID NO:5.
[0021] Specifically, the kit also includes a primer pair consisting of the primers shown in SEQ ID NO: 6 and SEQ ID NO: 7.
[0022] The present invention also provides a method for preparing transgenic golden hamsters, comprising the following steps: inserting a specific DNA molecule into the genomic DNA of a golden hamster via pronuclear microinjection, wherein the CRE gene is expressed by the Myh6 promoter between two insulators.
[0023] Specifically, the method includes the following steps: introducing the specific DNA molecule into a golden hamster fertilized egg, thereby inserting the specific DNA molecule into the golden hamster's genomic DNA. Then, from the golden hamsters developed from the fertilized eggs, transgenic golden hamsters with the inserted specific DNA molecule in their genomic DNA are screened.
[0024] Specifically, the method further includes the following steps: screening for gene-modified golden hamsters that stably pass on specific DNA molecules from golden hamsters obtained by mating heterozygous transgenic golden hamsters.
[0025] The screening process specifically includes the following steps: using golden hamster genomic DNA as a template, PCR amplification is performed using primer pair 1 (a primer pair consisting of primers shown in SEQ ID NO: 2 and primers shown in SEQ ID NO: 3) and primer pair 2 (a primer pair consisting of primers shown in SEQ ID NO: 4 and primers shown in SEQ ID NO: 5), respectively; if a 471 bp amplification product is obtained using primer pair 1 and a 341 bp amplification product is obtained using primer pair 2, the golden hamster is a transgenic golden hamster. Transgenic golden hamsters were prepared according to the method described above;
[0026] The genetically modified golden hamsters were mated with other golden hamsters to produce offspring golden hamsters; Select modeling tools from offspring golden hamsters.
[0027] The other golden hamsters mentioned are Cre recombinase reporter golden hamsters.
[0028] The other golden hamsters mentioned are golden hamsters with Cre recombinase reporter elements.
[0029] Specifically, the other golden hamsters mentioned are MA-ROSA26-CAG-L-mem-tdTomato-L-mem-EGFP (MA-R26-mTmG) golden hamsters.
[0030] Specifically, the other golden hamsters mentioned are MA-ROSA26-CAG-L-stop-L-LacZ (MA-R26-lsl-LacZ) golden hamsters.
[0031] The term "modeling tool golden hamster" refers to golden hamsters selected from offspring golden hamsters that possess the specific DNA molecule and the Cre recombinase reporter element.
[0032] A method for screening golden hamsters with the specific DNA molecule described above: using golden hamster genomic DNA as a template, PCR amplification is performed using a primer pair consisting of primers shown in SEQ ID NO: 6 and primers shown in SEQ ID NO: 7; if a 13bp amplification product is obtained, the golden hamster is a golden hamster with the specific DNA molecule described above.
[0033] Method for screening golden hamsters with Cre recombinase reporter element: Using golden hamster genomic DNA as a template, PCR amplification was performed using primers composed of primers shown in SEQ ID NO: 2 and SEQ ID NO: 3; if a 471 bp amplification product was obtained, the golden hamster is a golden hamster with Cre recombinase reporter element.
[0034] This invention also provides a method for constructing a model of a golden hamster, comprising the following steps: The modeling tool, a golden hamster, was prepared according to the method described above. The modeling tool, the golden hamster, is used to induce a disease model, resulting in golden hamsters with disease phenotypes, which are then called model golden hamsters.
[0035] Specifically, the model golden hamster can be a model golden hamster with impaired myocardial function.
[0036] Specifically, the model golden hamster can be a pathological model golden hamster or a fibrotic pathological model golden hamster.
[0037] Specifically, "inducing a disease model using the modeling tool golden hamster to obtain golden hamsters with disease phenotypes" can be interpreted as: using a high-fat diet to induce the modeling tool golden hamsters to obtain golden hamsters with abnormal myocardial cell phenotypes.
[0038] This invention also provides the application of recombinant golden hamsters prepared by any of the above methods, or modeling tools or models prepared by any of the above methods, in studying the molecular mechanisms of Myh6 gene regulation during disease occurrence and progression.
[0039] This invention also provides a method for studying whether Myh6 is involved in the occurrence and development of diseases, comprising the following steps: Myh6-CRE golden hamsters were prepared according to the method described above; The Myh6-CRE golden hamster was bred with the R26-mTmG golden hamster to obtain the R26-mTmG; Myh6-CRE modeling tool golden hamster; The Myh6-CRE golden hamster was bred with the R26-LSL-LacZ golden hamster to obtain the R26-LSL-LacZ; Myh6-CRE modeling tool golden hamster; The modeling tool, golden hamsters, was divided into two groups. The experimental group was induced to develop the disease phenotype, while the control group was not induced. The difference in fluorescence signals between the control and experimental groups was compared. If the green fluorescence signal in the experimental group was significantly enhanced compared with the control group, it indicates that Myh6 is involved in the occurrence and development of the disease.
[0040] Specifically, the R26-mTmG fluorescence signal is a red fluorescence signal.
[0041] Specifically, the fluorescence signal of the R26-mTmG;Myh6-CRE cardiomyocytes is a green fluorescence signal.
[0042] Specifically, the expression of CRE in the R26-LSL-LacZ;Myh6-CRE was determined by Beta-galactosidase staining.
[0043] Specifically, the golden hamster is a standard inbred descendant of the golden hamster.
[0044] The golden hamster model can be used to study the genetic lineage of Myh6+ cells in development and disease, laying the foundation for further research on the role of Myh6+ cells in disease and trauma.
[0045] This invention constructs a Myh6-Cre tool in golden hamsters based on the Cre-LoxP recombination system, which can be used to address scientific questions regarding the molecular mechanisms of Myh6+ regulation in the occurrence and progression of important diseases. This invention will contribute to further exploration of the role of Myh6 in disease development, in order to identify new therapeutic targets and develop more effective treatment strategies. Attached Figure Description
[0046] Figure 1 This is a schematic diagram of the component construction and working principle of the insulator-Myh6-promoter--Cre-b-globin polyA-insulator.
[0047] Figure 2 This is a diagram illustrating the mechanism of action of CRE after crossbreeding transgenic CRE golden hamsters with R26-LSL-LacZ golden hamsters in Example 4.
[0048] Figure 3Results of X-Gal staining for R26-LSL-LacZ;Myh6-CRE golden hamster β-galactosidase. The left image shows R26-LSL-LacZ;Myh6-CRE, where the heart is stained blue. The right image shows the wild-type control. Detailed Implementation
[0049] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0050] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. Unless otherwise specified, the quantitative experiments in the following embodiments are all performed in triplicate, and the results are averaged.
[0051] Example 1: Preparation of Functional DNA Molecules Functional DNA molecules, which are linear double-stranded DNA molecules, as shown in SEQ ID NO: 1.
[0052] In SEQ ID NO: 1, nucleotides 1-1319 form the upstream insulator (1319bp), nucleotides 1320-6755 form the Myh6 promoter, nucleotides 6756-7808 encode the Cre recombinase, nucleotides 7809-8557 form b-globin polyA, and nucleotides 8558-9804 form the downstream insulator.
[0053] An insulator sequence is a transcriptional blocking element with a dual function: firstly, it can prevent the DNA sequence at the insertion site from regulating the transcription of the inserted sequence; secondly, it can prevent abnormal transcription at the genomic transcriptional level by the insertion promoter. These two functions ensure that genes on the genome are not affected by the insertion sequence and also ensure the effective expression of the insertion sequence.
[0054] A double-stranded DNA molecule, as shown in SEQ ID NO: 1, was artificially synthesized and named insulator-Myh6-promoter-Cre-b-globin polyA-insulator (Myh-Cre). The Cre coding region corresponds to positions 6756-7805, and its encoded protein sequence is shown in SEQ ID NO: 8. The start codon ATG is located at positions 6756-6758 of the coding region. The nuclear insertion signal coding region corresponds to positions 6759-6779. Example 2: Obtaining transgenic golden hamsters
[0055] Preparation tube 1: Take the insulator-Myh6-promoter-Cre-b-globin polyA-insulator (linear double-stranded DNA molecule) prepared in Example 1, and adjust the DNA concentration to 5 ng / µL with RNase-free water.
[0056] II. Preparation of F0 Golden Hamster Golden hamsters have a stable estrous cycle of 4 days, and female hamsters can only successfully conceive by mating on the 4th day of the estrous cycle.
[0057] 1. Donor Preparation: Select 8-10 week old female golden hamsters. On the first day of estrus, between 9-10 am, administer intraperitoneal injection of pregnant mare serum gonadotropin (PMSG) (15 IU / 100g) to induce superovulation. On the fourth day, between 6-7 pm, mate with a male hamster in a 1:1 ratio. On the second day, between 9-10 am, examine vaginal secretions under a microscope for sperm; the presence of sperm indicates successful mating. Remove the male hamster and raise it until the fifth day.
[0058] 2. Recipient preparation: Select 8-10 week old female albino golden hamsters (synchronized with the donor's estrus cycle) and mate them with male hamsters in a 1:1 ratio at 6 pm on the 4th day of estrus. On the morning of the 2nd day, at 9-10 am, examine the vaginal secretions for sperm under a microscope. The presence of sperm indicates a 0.5-day true pregnancy recipient.
[0059] 3. Fertilized Egg Acquisition: Golden hamster fertilized eggs are sensitive to pH, temperature, and light. All experiments were conducted at room temperature (28.5℃) under red light. On the afternoon of the second day after mating with the donor hamster (Step 1), between 1 and 2 PM, the donor hamster was euthanized, and fertilized eggs were collected from the oviduct.
[0060] 4. Take the fertilized eggs obtained in step 3 and inject them with the microinjection complex prepared in step 1 (injected until the nucleus swells significantly). Then, place the embryos in HEMC9 medium. The injected embryos are cultured in a tri-gas incubator at 37.5℃, 10% carbon dioxide, 5% oxygen, and 85% nitrogen for 0.5 hours.
[0061] 5. After completing step 4, the fertilized eggs are transferred into the oviducts of the albino golden hamsters obtained in step 2 (20 embryos are transferred to each surrogate mouse). The surrogate mice are then fed normally. The offspring golden hamsters will be born 16-17 days later. The offspring of the original recipient mice that were not transferred will be albino and can be distinguished directly by their color.
[0062] 6. The golden hamsters obtained in step 5 should have their toes clipped and be numbered on days 7-8 after birth, and then undergo PCR identification. Golden hamsters that test positive for PCR are the first-generation hamsters (also known as F0 golden hamsters).
[0063] PCR identification method: Tissue from clipped toes is directly lysed to extract genomic DNA. PCR amplification is performed using primer pairs Myh6-CRE-F1 and Myh6-CRE-R1, and primers WT-TF1 and WT-TR. A positive PCR result is indicated by an amplification product of approximately 471 bp. PCR amplification is then performed using primer pairs WT-TF1 and WT-TR to identify the extracted genomic DNA. Quality control is performed; all genomic DNA samples should show an amplification product of 341 bp. Positive golden hamsters are further amplified using primer pairs Myh6-TF and bGloB-PA-R. If a 1301 bp amplification product is obtained, the golden hamster possesses the specific DNA molecule described above.
[0064] Myh-Cre-F1: TTCGCAAGAACCTGATGGACAT (SEQ IDNO: 2) Myh-Cre- R1: TCCTGGCAATTTCGGCTATACG (SEQ IDNO: 3) WT-TF: CTGCTTTTGCTGACTGCCCAG (SEQ IDNO: 4) WT-TR: GGATTGGAACCGAGACAAGAGC (SEQ IDNO: 5) Myh6-TF: CAGGGAAGTGGTGGTGTAGGAA (SEQ IDNO: 6) bGloB-PA-R: -TTTTGGCAGAGGGAAAAAGA (SEQ IDNO: 7) The offspring of male F0 hamsters and female hamsters (F1 generation hamsters) are 50% heterozygous transgenic golden hamsters.
[0065] The offspring of female F0 hamsters and male hamsters (F1 generation hamsters) are 50% heterozygous recombinant golden hamsters.
[0066] F1 generation heterozygous transgenic hamsters generally cannot be used directly as experimental hamsters and need to be further passaged to establish a breeding line. F2 generation heterozygous transgenic hamsters can be used directly as experimental hamsters or can be further passaged to establish a breeding line.
[0067] The F2 generation of heterozygous transgenic hamsters can be interbred to obtain homozygous transgenic F3 generation hamsters. Quantitative PCR was performed using primer pairs Myh6-CRE-F1 and Myh6-CRE-R1, with PCR amplification using primer pairs WT-F1 and WT-R1 as a negative control to determine whether the F3 generation was homozygous. The homozygous F3 generation was then passaged to establish a lineage.
[0068] The F3 generation homozygotes were used to establish a lineage through crossbreeding, and their offspring could be directly used for experimental hamsters.
[0069] The homozygous transgenic hamster was named TgN(Myh6-Cre) / 0, and the heterozygous transgenic hamster was named TgN(Myh6-Cre) / +. The TgN(Myh6-Cre) / 0 hamsters developed normally, and no obvious growth or reproductive defects were observed. Example 3: Obtaining hybrid MA-ROSA26-LSL-LacZ;Myh6-cre golden hamsters
[0070] The MA-ROSA26-LSL-LacZ model is a golden hamster model previously constructed by the applicant. The Rosa26 locus in one of the hamster's chromosome 18 DNA sequences integrates the following DNA segments: a STOP element with loxP on the upstream side and a β-galactosidase (encoded by the lacZ gene) on the downstream side. This STOP element prevents the transcription of the β-galactosidase. In the presence of Cre recombinase, site-specific recombination occurs between the loxP loci, the STOP element is cleaved, and β-galactosidase is expressed. In the presence of the substrate X-Gal, the β-galactosidase (encoded by the lacZ gene) hydrolyzes it, producing an insoluble blue precipitate. Therefore, blue staining can be observed under a microscope, allowing precise localization of the lacZ reporter gene expression site and verification of the specific activity of Cre recombinase in oocytes (or other specific cells).
[0071] 1. The F2 generation TgN(Myh6-Cre) / + heterozygous golden hamsters (male) obtained in Example 2 were mated with MA-ROSA26-LSL-LacZ golden hamsters (female) to obtain offspring golden hamsters.
[0072] 2. Select hamsters with both Myh6-Cre and LSL-LacZ from the offspring hamsters obtained in step 1, namely MA-ROSA26-LSL-LacZ; Myh6-cre golden hamsters.
[0073] Method for screening golden hamsters with Myh6-Cre: Take tail tissue, extract genomic DNA, and perform PCR amplification using primer pair consisting of Myh6-CRE-F1 and Myh6-CRE-R1 (primer sequences are shown in step 2, section 6 of Example 2); if the amplification product shows a 471 bp marker band on electrophoresis, the golden hamster is a hamster with Myh6-Cre.
[0074] Method for screening hamsters with LacZ: Take tail tissue, extract genomic DNA, and perform PCR amplification using primer pair composed of LacZ-F and LacZ-R; if the electrophoresis of the amplification product shows a 558bp signature band, the golden hamster is a hamster with LacZ.
[0075] LacZ-F: GCTAATCACGACGCGCTGTAT (SEQ ID NO: 8) LacZ-R:GACGAAGCCGCCCTGTAAAC (SEQ ID NO: 9) From the MA-ROSA26-LSL-LacZ;Myh6-cre hamsters obtained in step 2, heart tissue was collected at week 3. After fixation for 20 minutes, it was directly stained with X-gal and incubated in a humidified chamber at 37°C for 2-4 hours. The hearts of MA-ROSA26-LSL-LacZ;Myh6-cre hamsters showed blue color, while wild-type hamsters did not. Figure 3 ). Example 4: Obtaining hybrid MA-ROSA26-mTmG, Myh6-cre golden hamsters
[0076] MA-ROSA26-mTmG Golden Hamster: Strain Name: MA.Cg-Gt(ROSA)26(CAG-mTmG)em1Num; Common Name: MA-ROSA26-mTmG; Background: Golden hamster. This hamster is a standard strain developed by Nanjing Medical University, a heterozygous hamster (fertile). The Rosa26 site on one of this hamster's chromosome 6 DNA segments integrates the following DNA region: an upstream CAG promoter followed by membrane-localized red fluorescent mtdTomato, flanked by loxP stop elements, and downstream membrane-localized green fluorescent protein (mEGFP). The stop element prevents the transcription of this green fluorescent EGFP (only red fluorescence is displayed, no green fluorescence). When Cre recombinase is present, site-specific recombination occurs between the loxP sites under the action of Cre recombinase, the mtdTomato-STOP element is cleaved, and thus mEGFP is expressed (displaying membrane-localized green fluorescence).
[0077] 1. The F2 generation TgN(Myh6-Cre) / + heterozygous golden hamsters (female) obtained in Example 2 were mated with MA-ROSA26-CAG-mTmG golden hamsters (male) to obtain offspring golden hamsters.
[0078] 2. Select hamsters with Myh6-Cre and mTmG from the offspring hamsters obtained in step 1. These are called MA-ROSA26-CAG-mTmG; TgN(Myh6-Cre) golden hamsters, or simply mTmG; Myh6-Cre hamsters.
[0079] Method for screening golden hamsters with Myh6-Cre: Take tail tissue, extract genomic DNA, and perform PCR amplification using primer pair consisting of Myh6-CRE-F1 and Myh6-CRE-R1 (primer sequences are shown in step 2, section 6 of Example 2); if the amplification product shows a 471 bp marker band on electrophoresis, the golden hamster is a hamster with Myh6-Cre.
[0080] Method for screening hamsters with mTmG: Take tail tissue, extract genomic DNA, and perform PCR amplification using primer pair composed of PF1 and PR1; if the electrophoresis of the amplification product shows a 558bp marker band, the golden hamster is a hamster with mTmG.
[0081] PF1: AGGGGAGAGCCGCAATAC (SEQ ID NO: 10) PR1: GATGGGGAGAGTGAAGCAGA (SEQ ID NO: 11) Take the mTmG obtained in step 2; Myh6-Cre hamsters, take heart tissue at week 3 to prepare frozen sections, and observe the area and intensity of red and green fluorescence expression under a laser confocal microscope to determine the expression level of CRE under normal physiological conditions.
[0082] mTmG; Myh6-Cre hamsters can be used as a tool to verify whether the Myh6 gene is involved in the occurrence and development of diseases. The principle is as follows: Under the action of the upstream Myh6 promoter, the CRE recombinase is expressed; the Cre recombinase catalyzes site-specific recombination of DNA between loxP sites, the STOP element is cleaved, thereby clearing tdTomato and enhancing green fluorescence expression; therefore, the number and signal intensity of cells with green fluorescence can reflect whether the Myh6 gene is induced by disease or other substances, thereby determining whether the Myh6 gene is involved in the occurrence and development of diseases or whether it is involved in the body's response to other stimuli.
[0083] Example 5: Constructing a high-fat animal model I. Grouping Processing
[0084] The mTmG; Myh6-Cre golden hamsters (8 weeks old) obtained in Example 3 were divided into two groups of 2 hamsters each.
[0085] Experimental group: From day 1 to day 28, the animals were fed a high-fat diet for 28 consecutive days. Control group: From day 1 to day 28, conventional feed was used as the daily feed for 28 consecutive days; The golden hamsters have free access to acidified water and food. II. Testing
[0086] After completing the grouping process in step one, the golden hamsters were euthanized, their heart tissue was collected and frozen sections were prepared, and fluorescence was observed directly.
[0087] Compared with the control group, the number of green fluorescent cells in the heart tissue of the experimental group animals was significantly reduced, which shows that the expression of the Myh6 gene is involved in the occurrence and development of myocardial inflammation, indicating that the expression of the Myh6 gene plays a key role in maintaining cardiac homeostasis and heart disease.
[0088] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
[0089] SEQ ID NO: 1.
[0090] The upstream insulator is shown in bits 1-1319 of SEQ ID NO: 1.
[0091]
[0092] The Myh6 promoter is shown in bits 1320-6755 of SEQ ID NO: 1.
[0093]
[0094] The sequence 6755-7808 of the Cre recombinase encoding gene is shown in SEQ ID NO: 1.
[0095]
[0096] β-globin polyA: shown as positions 7809 - 8557 in SEQ ID NO: 1.
[0097] TAGCGGCCGCTAGCCTCGAGACTCCTCAGGTGCAGGCTGCCTATCAGAAGGTGGTGGCTGGTGTGGCCAATGCCCTGGCTCACAAATACCACTGAGATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGCTAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACATCAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCATATGCTGGCTGCCATGAACAAAGGTGGCTATAAAGAGGTCATCAGTATATGAAACAGCCCCCTGCTGTCCATTCCTTATTCCATAGAAAAGCCTTGACTTGAGGTTAGATTTTTTTTATATTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATTTTCCTTACATGTTTTACTAGCCAGATTTTTCCTCCTCTCCTGACTACTCCCAGTCATAGCTGTCCCTCTTCTCTTATGAAGATCCCTCGACCTGCAGCCCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCGGATCC.
[0098] Downstream insulator: shown as positions 8558 - 9804 in SEQ ID NO: 1.
[0099]
Claims
1. A specific DNA molecule, characterized by: From upstream to downstream, it includes the following components: upstream insulator, Myh6 gene enhancer, Myh6 promoter, Cre recombinase-encoding gene, b-globin polyA, and downstream insulator; The upstream insulator is shown in positions 1-1319 of SEQ ID NO: 1, the Myh6 promoter is shown in positions 1320-6755 of SEQ ID NO: 1, the Cre recombinase encoding gene is shown in sequences 6755-7808 of SEQ ID NO: 1, the b-globin polyA is shown in positions 7809-8557 of SEQ ID NO: 1, and the downstream insulator is shown in positions 8558-9804 of SEQ ID NO:
1.
2. A kit for constructing transgenic golden hamsters, comprising the specific DNA molecule described in claim 1: Specifically, the specific DNA molecule is shown in SEQ ID NO:
1.
3. The kit according to claim 2, characterized in that: The kit also includes the constructed transgenic identification primers shown in SEQ ID NO:3 and SEQ ID NO:4, and the control primers shown in SEQ ID NO:5 and SEQ ID NO:
6.
4. A method for preparing recombinant golden hamsters, comprising the following steps: inserting the specific DNA molecule of claim 1 into the genomic DNA of a golden hamster by pronuclear microinjection of a fertilized egg, thereby obtaining a transgenic golden hamster containing the specific DNA molecule; wherein the specific DNA molecule segment is a segment from the upstream insulator DNA to the downstream insulator; and the specific DNA molecule is as described in claim 1.
5. The method as described in claim 4, characterized in that: The method includes the following steps: introducing a specific DNA molecule into a golden hamster via pronuclear microinjection of a fertilized egg, thereby inserting the specific DNA molecule into the genomic DNA of the golden hamster to obtain a transgenic golden hamster; the specific DNA molecule is as described in claim 1; the identification primers are shown in SEQ ID NO: 2 and SEQ ID NO: 3, and the control primers are shown in SEQ ID NO: 4 and SEQ ID NO:
5.
6. A method for preparing a model of a golden hamster, comprising the following steps: Transgenic golden hamsters were prepared according to the method described in claim 4 or 5; The genetically modified golden hamsters were mated with other golden hamsters to produce offspring golden hamsters; Select modeling tools from offspring golden hamsters.
7. A method for constructing a model of a golden hamster, comprising the following steps: A modeling tool hamster was prepared according to the method described in claim 6; By inducing disease models in hamsters used as modeling tools, hamsters exhibiting disease phenotypes are obtained, which are called model hamsters.