Bordetella bronchiseptica attenuated strain and application thereof

By constructing attenuated strains of Bordetella bronchiseptica with inserted or deleted fimbriae operon-related genes, the problems of insufficient protective efficacy and exogenous nucleic acid risks of existing vaccines were solved, achieving highly immunogenic and genetically stable immune protection.

CN121852301APending Publication Date: 2026-04-14GUANGZHOU YUANBO MEDICAL TECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202512053160.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-31
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing attenuated strains of Bordetella bronchiseptica have insufficient protective efficacy and the risk of exogenous nucleic acid, which cannot effectively stimulate specific immune responses in dogs and cats, and also pose a risk of genetic variation.

Method used

By continuously passaged and screened and sequencing the genome, we constructed a low-virulence strain of Bordetella bronchiseptica. We inserted or deleted fimbrial operon-related genes, especially the fimB and fimD genes, to reduce the virulence of the strain while maintaining high immunogenicity and ensuring a clear genetic background without plasmid residues.

Benefits of technology

It achieves efficient stimulation of specific immune responses in dogs and cats, reduces the frequency of repeated vaccinations, ensures genetic stability and biosafety, and provides highly effective immune protection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852301A_ABST
    Figure CN121852301A_ABST
Patent Text Reader

Abstract

The invention relates to the field of biotechnology and biological products, in particular to a bordetella bronchiseptica attenuated strain and application thereof. The bordetella bronchiseptica low virulent strain which is remarkably weakened in virulence and keeps high immunogenicity is obtained in a continuous passage and genome sequencing mode, the remarkable virulence weakening characteristic is shown, dog diseases cannot be caused, and the high immunogenicity is achieved. The low virulent strain is used for preparing a bordetella bronchiseptica vaccine, can efficiently stimulate the specific immune response of dog and cat organisms, reduces the repeated inoculation frequency, and avoids the environmental transmission risk of toxic strains from the source. The screened Bordetella bronchiseptica attenuated strain does not contain any exogenous nucleic acid, the genetic background of the strain is clear and traceable, the biological safety requirement of veterinary vaccines is completely met, and a safe and reliable brand-new scheme is provided for dog and cat health protection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and biological products, and in particular to a live attenuated strain of Bordetella bronchiseptica and its applications. Background Technology

[0002] Bordetella bronchiseptica ( Bordetella bronchiseptica *Bordetella* (Bb), belonging to the genus *Bordetella* of the class Beta-Proteobacteria, is an aerobic, Gram-negative bacillus or coccus. It has microcapsules, does not produce spores, moves via flagella, and has numerous pili on its surface to mediate adhesion to host cells. *Bordetella* was first isolated by Ferry in 1910 from the respiratory tract of a dog suffering from canine distemper. It can cause respiratory diseases in various mammals, including dogs, cats, pigs, mice, rats, guinea pigs, skunks, opossums, raccoons, rabbits, ferrets, foxes, hedgehogs, and sheep. *Bordetella* is a major pathogen causing canine infectious respiratory disease (CIRD), also known as kennel cough. Mild infections are accompanied only by a dry cough, while severe infections present with paroxysmal dry cough and mucoid cough, along with ocular and nasal discharge. In affected dogs and cats, the mucosal lining of the trachea and bronchi is congested and has mucoid or mucopurulent discharge. In addition, patchy areas of exudative pneumonia are observed, along with spots and hemorrhages on the pleural surface, which can even lead to pneumonia. This typically occurs in puppies aged 7-35 weeks and kittens under 12 weeks. However, older dogs and cats can also be affected, increasing the risk of other secondary respiratory infections and co-infections.

[0003] Currently, the main measure for preventing and controlling infections caused by *Bordetella bronchiseptica* is vaccination, including inactivated vaccines, live attenuated vaccines, and subunit vaccines. Live attenuated vaccines are considered the preferred vaccine type due to their high immunogenicity, long-lasting immune memory, low production cost, and fewer doses required. While some live attenuated vaccines for *Bordetella bronchiseptica* are registered and marketed abroad, domestic research is limited, and many are still in clinical trials; no similar products are currently on the market. For example, invention patent CN116350763A discloses a live attenuated strain of *Bordetella bronchiseptica*, PZ01-P, which can provide protection for dogs. However, this live strain contains exogenous nucleic acids, posing a risk of genetic mutation and threatening canine health. Furthermore, it is still in the clinical trial stage and has not yet been commercialized.

[0004] The existing attenuated strains of *Bordetella bronchiseptica* have the following shortcomings: (1) Insufficient protective efficacy: After injection of the existing vaccine, dogs and cats are unable to produce high levels of specific antibodies, and cannot form effective immune protection. Multiple vaccinations are required to maintain the effect. It is speculated that the mutated virulence gene of *Bordetella bronchiseptica* reduces the overall virulence of the bacteria, but at the same time greatly weakens the immunogenicity, resulting in insufficient immune response. (2) Contains exogenous nucleic acid: Attenuated strains of *Bordetella bronchiseptica* under the current technology have the potential for exogenous nucleic acid. Some strains did not extract plasmids for identification during the natural selection of virulent strains, resulting in the strains carrying exogenous plasmids; other strains modified by genetic engineering technology introduce resistance genes to improve screening efficiency when the target gene is inactivated by a two-step exchange method. Both of these situations introduce exogenous nucleic acid, which can easily cause genetic variation, threaten the health of dogs and cats, and do not meet the biosafety standards for veterinary biological products. Therefore, it is urgent to develop attenuated live vaccine products to prevent and control infections caused by *Bordetella bronchiseptica*, filling the gap in the domestic market. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the existing technology and provide a significantly weakened virulence strain of Bordetella bronchiseptica while maintaining high immunogenicity.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: Firstly, a live attenuated strain of *Bordetella bronchiseptica*, wherein the live attenuated strain of *Bordetella bronchiseptica* is *Bordetella bronchiseptica* (… Bordetella bronchiseptica The attenuated strain of *Bordetella bronchiseptica* with insertion or deletion mutations; the fimbrial operon-related genes of the attenuated strain of *Bordetella bronchiseptica* contain insertion or deletion mutations; the fimbrial operon-related genes include fimB Gene, fimD Gene, fimBCD At least one of the gene clusters; the insertion or deletion mutation results in a relative decrease in the virulence of the strain while maintaining high immunogenicity.

[0007] Addressing the two major technical bottlenecks of existing attenuated live *Bordetella bronchiseptica* vaccines—low protective efficacy and the risk of exogenous nucleic acid—this invention employs continuous passage screening to identify attenuated strains. This effectively weakens the pathogenicity of *Bordetella bronchiseptica* while reducing respiratory symptoms in experimental dogs, such as coughing, sneezing, and nasal and ocular discharge, while retaining its high immunogenicity. This design not only effectively stimulates a specific immune response in dogs and cats, reducing the frequency of repeated vaccinations, but also ensures that the selected strains have a clear and pure genetic background, free from potential risks such as plasmid residues and the introduction of resistance genes, providing a solid guarantee for the health of dogs and cats, and meeting the stringent biosafety requirements for veterinary drug development. This invention first screens *Bordetella bronchiseptica* strain DG-Bbs-01, which has no hemolytic activity, from the natural environment. Through continuous passage culture, strains DG-Bbs-02 and DG-Bbs-03 were successfully isolated.

[0008] The DG-Bbs-02 strain exhibits relatively weakened virulence, but at appropriate inoculation doses, it can induce high immunogenicity and protective efficacy. fimD The gene has 5 bases inserted between 201-202 bp, GCTCT, which can be used for the preparation of attenuated live vaccine of Bordetella bronchiseptica or to provide a basic strain for screening for significantly weakened virulence.

[0009] DG-Bbs-03 strain fimD The gene inserts 5 bases GCTCT between 201-202 bp. fimB The gene inserts a single G base between 188 and 189 bp. This mutation in the gene exhibits good attenuation of toxicity while maintaining high immunogenicity and protective efficacy.

[0010] The present invention contains only the attenuated strain of Bordetella bronchiseptica DG-Bbs-02. fimD The gene inserts 5 bases GCTCT between 201-202 bp. The attenuated Bordetella bronchiseptica strain DG-Bbs-03 of this invention only... fimD The gene inserts 5 bases GCTCT between 201-202 bp. fimB The gene has a single G base inserted between 188-189 bp, contains no exogenous nucleic acid, has a clear genetic background, and exhibits genetic stability. Mutations in this gene lead to enhanced attenuation of the strain's virulence. The attenuated Bordetella bronchiseptica strain DG-Bbs-03 obtained by screening in this invention exhibits good immunogenicity and high safety. This invention constructs... fimBCDThe DG-Bbs-04 strain, with a 1565 bp deletion, was used to screen for attenuated *Bordetella bronchiseptica* strains, and its virulence and immunogenicity were verified. The results showed that the attenuated DG-Bbs-03 strain had the same virulence and immunogenicity as the DG-Bbs-04 strain, suggesting that the reduced virulence of the attenuated DG-Bbs-03 strain was related to the fimbriae operon. fimBCD It is associated with the inactivation of related genes.

[0011] Preferably, the mutation is fimD A base insertion mutation was performed on the gene; the resulting strain was named DG-Bbs-02 and was deposited at the China Center for Type Culture Collection (CCTCC) on November 3, 2025, with accession number CCTCC NO: M20252420; the DG-Bbs-02 strain... fimD The nucleotide sequence of the gene is shown in SEQ ID NO: 3.

[0012] Preferably, the mutation includes fimB Genes and fimD A base insertion mutation was performed on the gene; the resulting strain was named DG-Bbs-03 and was deposited at the China Center for Type Culture Collection (CCTCC) on November 3, 2025, with accession number CCTCC NO: M 20252421; the DG-Bbs-03 strain... fimD The nucleotide sequence of the gene is shown in SEQ ID NO: 3. fimB The nucleotide sequence of the gene is shown in SEQ ID NO: 4.

[0013] Preferably, the mutation includes fimBCD The gene cluster deletion mutation resulted in a strain named DG-Bbs-04, which was deposited at the China Center for Type Culture Collection (CCTCC) on November 3, 2025, with accession number CCTCC NO: M20252422. The DG-Bbs-04 strain... fimBCD The gene nucleotide sequence is shown in SEQ ID NO: 6.

[0014] Secondly, the present invention provides a method for constructing the above-mentioned attenuated strain of *Bordetella bronchiseptica*, comprising the following steps: using *Bordetella bronchiseptica*... Bordetella bronchiseptica Using the bacterium as the starting bacterium, strains with weakened virulence were screened through continuous passages to obtain the attenuated strain of *Bordetella bronchiseptica*; the fimbrial operon-related genes of the attenuated strain of *Bordetella bronchiseptica* contained insertion or deletion mutations; or, by knocking out... fimBCD The gene yielded the attenuated strain of Bordetella bronchiseptica.

[0015] Preferably, the fimbriae operon-related genes include fimBGene, fimD Gene, fimBCD At least one of the gene clusters.

[0016] Preferably, the insertion mutation or deletion mutation results in a relative reduction in the virulence of the strain while maintaining high immunogenicity.

[0017] Thirdly, the present invention provides the application of the above-mentioned attenuated strain of Bordetella bronchiseptica or its passaged culture in the preparation of attenuated Bordetella bronchiseptica vaccine.

[0018] This invention relates to the DG-Bbs-01 strain. fimBCD Gene knockout experiments confirmed the unique advantages of strains DG-Bbs-02 and DG-Bbs-03. After being freeze-dried, attenuated strains of DG-Bbs-02 and DG-Bbs-03 were used to prepare a vaccine. In vivo canine inoculation experiments showed that dogs vaccinated with this vaccine were effectively protected against infection by virulent strains of *Bordetella bronchiseptica*, effectively overcoming the technical challenge of insufficient immunogenicity in traditional attenuated live vaccines. Furthermore, it can be inferred that the weakened virulence of the attenuated strain DG-Bbs-03 is related to the fimbriae operon. fimBCD The inactivation of related genes is associated with the fimbriae operon, therefore, the fimbriae operon... fimBCD Inactivation of the relevant genes can achieve a toxicity reduction effect.

[0019] Fourthly, the present invention provides the use of the above-mentioned attenuated strain of Bordetella bronchiseptica or its passaged culture in the preparation of drugs or preparations for preventing or alleviating Bordetella bronchiseptica infection and the diseases caused thereby.

[0020] Preferably, the drug or preparation is applied to dogs or cats.

[0021] Fifthly, the present invention provides a live attenuated vaccine of Bordetella bronchiseptica, the vaccine comprising the above-mentioned live attenuated strain of Bordetella bronchiseptica or its passaged culture, and pharmaceutically acceptable excipients.

[0022] Preferably, the content of attenuated Bordetella bronchiseptica strain in the attenuated Bordetella bronchiseptica vaccine is ≥1×10⁻⁶. 6 CFU / Toufen.

[0023] Preferably, the pharmaceutically acceptable excipients include lyophilization protectants.

[0024] The beneficial effects of this invention are as follows: Existing live attenuated vaccines against Bordetella bronchiseptica contain exogenous plasmids, increasing the risk of genetic mutations. Furthermore, existing live attenuated vaccines against Bordetella bronchiseptica have insufficient immunogenicity to provide adequate protection for dogs and cats.

[0025] This invention obtained two attenuated strains of *Bordetella bronchiseptica* with significantly reduced virulence while maintaining high immunogenicity through sequential passage and genome sequencing. The attenuated strain DG-Bbs-02... fimD The gene inserts 5 bases GCTCT between 201-202 bp, in the DG-Bbs-03 attenuated strain. fimD The gene inserts 5 bases GCTCT between 201-202 bp and fimB The gene inserts one G base between 188-189 bp.

[0026] The DG-Bbs-04 deletion strain constructed in this invention demonstrates that the reduced virulence of the attenuated bronchial septicemia DG-Bbs-03 strain is related to the fimbriae operon. fimBCD Related to the inactivation of relevant genes.

[0027] The attenuated Bordetella bronchiseptica strains screened in this invention were subjected to plasmid extraction and electrophoresis verification, which proved that the strains were free of exogenous plasmids, had a clear genetic background, avoided the risk of genetic variation, and maintained their original genetic characteristics after continuous passage, without any virulence reversion. Furthermore, gene deletion verification demonstrated that the attenuation of virulence in strains DG-Bbs-02 and DG-Bbs-03 was related to the fimbriae operon. fimBCD The inactivation of related genes provides a method for controlling the virulence of Bordetella bronchiseptica in dogs. Attached Figure Description

[0028] Figure 1 The growth morphology of strain DG-Bbs-01 on 20% sterile defibrinated sheep blood-ginger medium.

[0029] Figure 2 The results of the fimBCD gene identification of the double exchanger obtained by conjugation transfer are shown below; where M: 2000 bp DNA Marker; 1-6: bacterial culture of the double exchanger obtained by conjugation transfer; 7: genome of the positive control strain DG-Bbs-01; 8: blank control ddH2O.

[0030] Figure 3 The strains of attenuated Bordetella bronchiseptica DG-Bbs-02 from generations 1, 10, 20, 30, 40, and 50 are described. fimD Gene identification results; where M: 2000 bp DNA Marker; 1-6: bacterial suspensions of attenuated Bordetella bronchiseptica strain DG-Bbs-02 from generations 1, 10, 20, 30, 40, and 50; 7: bacterial suspension of strain DG-Bbs-01; 8: blank control ddH2O.

[0031] Figure 4The strains are the 1st, 10th, 20th, 30th, 40th, and 50th generations of attenuated Bordetella bronchiseptica strain DG-Bbs-03. fimB Gene identification results; where M: 2000 bp DNA Marker; 1-6: bacterial suspensions of attenuated strain DG-Bbs-03 of Bordetella bronchiseptica from generations 1, 10, 20, 30, 40, and 50; 7: bacterial suspension of strain DG-Bbs-01; 8: blank control ddH2O.

[0032] Figure 5 The strains are the 1st, 10th, 20th, 30th, 40th, and 50th generations of attenuated Bordetella bronchiseptica strain DG-Bbs-03. fimD Gene identification results; where M: 2000bp DNA Marker; 1-6: bacterial suspensions of the attenuated strain DG-Bbs-03 of Bordetella bronchiseptica from generations 1, 10, 20, 30, 40, and 50; 7: bacterial suspension of strain DG-Bbs-01; 8: blank control ddH2O.

[0033] Figure 6 The results of exogenous plasmid identification for the attenuated strain of Bordetella bronchiseptica, DG-Bbs-03; where M: 5000 bp DNA Marker; 1: DG-Bbs-01 strain; 2: DG-Bbs-02 strain; 3: DG-Bbs-03 strain; 4: plasmid control; 5: genome control. Detailed Implementation

[0034] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0035] Unless otherwise specified, the experimental methods used in this invention are conventional methods, and the materials and reagents used are commercially available products that can be obtained through commercial channels.

[0036] The initiating pathogen of this invention, *Bordetella bronchiseptica*, can be obtained through commercial channels or by self-isolation. The DG-Bbs-01 strain of this invention was self-isolated and, through molecular identification and animal experiments, was confirmed to be *Bordetella bronchiseptica*, possessing pathogenicity causing canine infectious respiratory diseases and carrying an operon gene sequence.

[0037] Strains DG-Bbs-02, DG-Bbs-03, and DG-Bbs-04 were submitted to the China Center for Type Culture Collection for preservation.

[0038] Preservation information: Bordetella bronchiseptica strain DG-Bbs-02 was deposited at the China Center for Type Culture Collection (CCTCC) on November 3, 2025, with accession number CCTCC NO: M 20252420.

[0039] The strain Bordetella bronchiseptica DG-Bbs-03 was deposited at the China Center for Type Culture Collection on November 3, 2025, with accession number CCTCC NO: M 20252421.

[0040] The strain Bordetella bronchiseptica DG-Bbs-04 was deposited at the China Center for Type Culture Collection on November 3, 2025, with accession number CCTCC NO: M 20252422.

[0041] In this invention, the DG-Bbs-01 strain fimB The gene nucleotide sequence is shown in SEQ ID NO: 1. fimD The gene nucleotide sequence is shown in SEQ ID NO: 2.

[0042] DG-Bbs-02 and DG-Bbs-03 strains fimD The gene nucleotide sequence is shown in SEQ ID NO: 3.

[0043] DG-Bbs-03 strain fimB The gene nucleotide sequence is shown in SEQ ID NO: 4.

[0044] DG-Bbs-01 strain fimBCD The gene nucleotide sequence is shown in SEQ ID NO: 5.

[0045] DG-Bbs-04 strain (gene deletion) fimBCD The gene nucleotide sequence is shown in SEQ ID NO: 6.

[0046] The culture medium used in this invention was purchased from Qingdao Haibo Biotechnology Co., Ltd., and was prepared before use: TSB-YE medium: Weigh 36.0 g of medium powder (Qingdao Haibo-HB4150), heat and stir to dissolve in 1000 mL of distilled water, dispense into Erlenmeyer flasks, 225 mL per flask, autoclave at 121℃ for 25 minutes, and set aside.

[0047] TSA-YE solid plates: Weigh 51.0 g (Qingdao Haibo-HB4154) powder, dissolve it in 1000 mL ddH2O, autoclave at 121℃ for 15 min, and after cooling to 45-55℃, pour the plates for later use and store at 4℃.

[0048] SS agar medium: Weigh 63.53 g of medium powder (Qingdao Haibo-HB4089), dissolve it in 1000 mL of distilled water, heat to boiling, do not autoclave, cool to 45-50℃ and pour into plates.

[0049] 20% sterile defibrinated sheep blood-Baojiang's medium: Weigh 44.0g of medium powder (Qingdao Haibo-HB8483-1), add it to 800 mL of distilled water, and add 10 mL of glycerol. Mix well, heat to dissolve, autoclave at 121℃ for 25 minutes, and when it cools to about 45-50℃, add 200 mL of sterile defibrinated sheep blood (Shanghai Yuanye-MP20026), mix well, pour into sterile Petri dishes, and set aside.

[0050] 10% sterile defibrinated sheep blood-MacConkey medium: Weigh 52.0 g of medium powder (Qingdao Haibo-HB6238), heat and dissolve in 900 mL of distilled water, autoclave at 121℃ for 25 minutes, and when cooled to about 45-50℃, add 100 mL of sterile defibrinated sheep blood (Shanghai Yuanye-MP20026), mix well, and pour into sterile Petri dishes for later use.

[0051] 10% NBS-TSA-YE solid plates: Weigh 51.0 g (Qingdao Haibo-HB4154) powder, dissolve it in 800 mL ddH2O, autoclave at 121℃ for 15 min, and after cooling to 45-55℃, add 200 mL NBS, mix well, pour into plates for later use, and store at 4℃.

[0052] Example 1: Isolation, purification and identification of Bordetella bronchiseptica Dry nasal and pharyngeal swab samples were collected from sick dogs at a veterinary hospital. Symptoms included runny nose, sneezing, coughing, lethargy, and decreased appetite. The swabs were thoroughly soaked in prepared TSB-YE medium, and then rotated to mix completely. The suspension was streaked onto plates using an inoculation loop on SS agar, 20% sterile defibrinated sheep blood-Borghexetine agar, and 10% sterile defibrinated sheep blood-MacConkey agar. The plates were then incubated at 37°C for 18–48 hours, and colony growth was observed.

[0053] Observation of agar plates revealed small, round, grayish-white colonies with neat edges, moist, smooth, raised surfaces. Single colonies were picked, inoculated onto TSB-YE liquid medium, and incubated on a shaker at 37°C and 60 rpm for 24–48 h. Nucleic acid was extracted from suspected colonies for 16S rRNA identification (Tables 1 and 2) and Gram staining.

[0054] 16S rRNA amplification primer sequence: 16s rRNA-F: 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID NO: 7); 16s rRNA-R: 5'-TACGGTTACCTTGTTACGACTT-3' (SEQ ID NO: 8).

[0055] Table 1: 16S rRNA PCR identification system Table 2: PCR identification procedure for 16S rRNA The PCR products were subjected to 1% agarose gel electrophoresis and then recovered. The recovered products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.

[0056] After repeated isolation, screening, and identification, a strain of Bordetella bronchiseptica without hemolytic activity was obtained. This strain was streaked onto 20% sterile defibrinated sheep blood-Zingiber's bromide medium and incubated at 37°C for 48 h. No β-hemolytic zone was observed. The strain formed small, round, smooth, raised, grayish-white colonies. The appearance is shown in the image below. Figure 1 As shown, it is named DG-Bbs-01.

[0057] Example 2: Screening, establishment and identification of attenuated strains of Bordetella bronchiseptica Because *Bordetella bronchiseptica* is prone to commensal changes under unsuitable growth conditions, this invention selects a method of continuous passage attenuation on TSA-YE solid plates free of NBS or sterile defibrinated sheep blood to screen for attenuated strains of *Bordetella bronchiseptica*. The specific method is as follows: Using an inoculation loop, pick DG-Bbs-01 bacterial cells and streak them onto TSA-YE agar plates, incubating at 37°C for 24–48 h. Continue this process, streaking single colonies from each generation onto TSA-YE agar plates and incubating at 37°C for 24–48 h. Repeat this process, subculturing 45 times on TSA-YE agar plates. Observe the colony morphology, size, and growth rate of each generation in detail, and test the virulence of the strain every 5 generations. Specifically, inoculate every 5 generations of the strain into 3 mL of 10% NBS-TSB-YE liquid medium and incubate at 37°C for 24 h. Then, inoculate the seed culture 1:50 into 10 mL of 10% NBS-TSB-YE liquid medium and incubate at 37°C for 8–9 h until the logarithmic growth phase (OD) is reached. 600 =1.2-1.5. Collect the bacterial culture and wash twice with two volumes of PBS. Adjust the CFU of the bacterial culture to 1-3 × 10⁻⁶ with PBS. 8 / mL. BALB / c mice were injected intraperitoneally with 200 µL of bacterial solution, and their mental state, coat condition, lung lesions, and other clinical symptoms were observed on days 1, 3, 5, 7, and 9. The mice were scored according to the symptom observation indicators and scoring table. The higher the score, the more severe the symptoms. The results are shown in Table 3.

[0058] Table 3: Clinical symptom scoring table for mice immunized with different generations of bacterial strains After 15 generations of passages, this invention screened a strain with reduced virulence. Compared to strain DG-Bbs-01, this strain caused a decrease in the severity and duration of depression, disheveled fur, and lung lesions in mice. This strain was named DG-Bbs-02. The colony morphology of this strain remained unchanged, but its growth rate and colony size were reduced compared to strain DG-Bbs-01. Whole-genome sequencing of strain DG-Bbs-02 revealed that... fimD The gene inserts 5 bases GCTCT between 201 and 202 bp.

[0059] When the strain was passaged to the 25th generation, another attenuated strain was screened. Compared with strain DG-Bbs-01, this strain did not cause depression, disheveled fur, or lung lesions in mice. This strain was named DG-Bbs-03. The colony morphology of strain DG-Bbs-03 remained unchanged, while its growth rate and colony size decreased compared to strain DG-Bbs-01. The genome of strain DG-Bbs-03 was extracted and sequenced, and the results showed that... fimD The gene inserts 5 bases GCTCT between positions 201-202 bp. fimBThe gene has a single G base inserted between 188-189 bp, meaning that strain DG-Bbs-03 has an additional base G on top of the genome of strain DG-Bbs-02. fimB Base insertion in a gene.

[0060] The strain was passaged to the 45th generation and still retained the same mutation site, and like the attenuated strain DG-Bbs-03, it did not cause disease in mice.

[0061] Example 3: Respiratory inoculation test of the strain The DG-Bbs-01, DG-Bbs-02, and DG-Bbs-03 strains selected above were used to conduct respiratory inoculation experiments on healthy 2-month-old experimental dogs, and the observation period was 14 days. Specifically, the experimental dogs were divided into 7 groups, with 2 dogs in each of groups 1-6 and 1 dog in group 7. Group 1 was inoculated with 500 μL of DG-Bbs-01 strain, with a CFU of 2 × 10⁻⁶. 6 Group 2 was inoculated with 500 μL of DG-Bbs-01 strain, with a CFU of 2 × 10⁶. 9 Group 3 was inoculated with 500 μL of DG-Bbs-02 strain, with a CFU of 2 × 10⁶. 6 / mL; Group 4 was inoculated with 500 μL of DG-Bbs-02 strain, with a CFU of 2 × 10⁶. 9 Group 5 was inoculated with 500 μL of DG-Bbs-03 strain, with a CFU of 2 × 10⁶. 6 / mL; Group 6 was inoculated with 500 μL of DG-Bbs-03 strain, with a CFU of 2 × 10⁶. 9 / mL; Group 7 was inoculated with an equal volume of PBS as a control group.

[0062] Fresh single colonies were inoculated into 3 mL of 10% NBS-TSB-YE liquid medium and incubated at 37°C for 24 h. Seed culture was then inoculated 1:50 into 10 mL of 10% NBS-TSB-YE liquid medium and incubated at 37°C for 8-9 h until the logarithmic growth phase (OD600 = 1.2-1.5). The bacterial culture was collected and washed twice with twice the volume of PBS. The CFU of the bacterial culture was adjusted to 2 × 10⁻⁶ with PBS. 6 / mL or 2×10 9 500 μL of bacterial suspension was administered intranasally to each dog at a rate of / mL, and the dogs were observed for 14 days. Clinical symptoms were scored using a scoring system; higher scores indicated more severe symptoms.

[0063] The results are shown in Tables 4 and 5. The experimental dogs immunized with strain DG-Bbs-02 were inoculated with 2 × 10⁻⁶ CFU of bacterial culture. 9Symptoms such as sneezing, coughing, nasal and eye discharge, and fever appeared when the inoculation volume was / mL, with a lower severity and frequency compared to the DG-Bbs-01 strain; however, the CFU of the inoculated bacterial solution was 2×10 6 At a concentration of 100 μL, no respiratory symptoms were observed in the experimental dogs, indicating that the virulence of the DG-Bbs-02 strain was weakened, but the degree of virulence was affected by the inoculation dose.

[0064] In experimental dogs immunized with the DG-Bbs-03 strain, regardless of the CFU level of the bacterial inoculation (2 × 10⁻⁶),... 6 / mL or 2×10 9 / mL, none of them had symptoms such as cough, runny nose, eye discharge, or persistent high fever, and the DG-Bbs-03 strain was identified as a weakly virulent Bordetella bronchiseptica.

[0065] The DG-Bbs-02 and DG-Bbs-03 strains were submitted to the China Center for Type Culture Collection for preservation.

[0066] Table 4: Clinical Symptom Scoring Table for Experimental Dogs Inoculated with DG-Bbs-01, DG-Bbs-02, and DG-Bbs-03 Strains Table 5: Body temperature (°C) of experimental dogs inoculated with strains DG-Bbs-01, DG-Bbs-02, and DG-Bbs-03. Example 4: Verification of the mechanism of virulence attenuation of the attenuated strain DG-Bbs-03 of Bordetella bronchiseptica Bordetella bacillus primarily colonizes the ciliated epithelium of the host's respiratory tract, forming a chronic infection. Initially, it attaches to the cilia through the action of various virulence factors. Subsequently, the cilia are destroyed, leading to the failure of the mucociliary clearance mechanism, which further promotes bacterial colonization and persistence. After colonization, it releases toxins, causing local and systemic inflammatory responses. The virulence factors involved include: filamentous hemagglutinin (FHA), agglutinogens (AGGs), pertactin (PRN), dermonecrotic toxin (DNT), adenylyl cyclase hemolysin (AC-Hly), tracheal cytotoxin, and fimbriae (Fim). Fimriae are filamentous polymeric proteins expressed on the cell surface of Bordetella bacillus. Fim2, Fim3, FimA, FimB, FimC, FimD, fimN, FimXThese structures are collectively composed of various components. They participate in host cell adhesion and colonization of the respiratory tract. In Bordetella bronchiseptica... FimA, FimB, FimC, FimD Forming a fimbriae operon, located in fhaB , fhaC Between genes, the operon responsible for secreting and assembling pili is crucial for cell growth and colonization. Pili play a key role in the early stages of Bordetella bronchiseptica infection by mediating the adhesion of respiratory epithelial cells. Studies have shown that mutants lacking pili exhibit reduced adhesion and colonization abilities, demonstrating the importance of these structures in bacterial pathogenesis.

[0067] Due to the attenuated strain of Bordetella bronchiseptica, DG-Bbs-02 fimD Mutant gene and mutant gene of strain DG-Bbs-03 fimB, fimD Located within the fim BCD operon, which is responsible for the secretion and assembly of fimbriae, it is therefore considered... fimD The gene inserts 5 bases GCTCT between positions 201-202 bp. fimB The insertion of a single G base between 188 and 189 bp in the gene results in the fimbriae operon. fimBCD The inactivation of bacteria affects their colonization and adhesion abilities.

[0068] 1. This invention uses a conjugation transfer method to manipulate the fimbriae operons of strain DG-Bbs-01. fimBCD Knockout is performed at the following sites: fimBCD The target gene segments were 214-1778 bp. Specifically, primer pairs Larm-up-F and Larm-up-down were used to amplify the upstream region of the knockout fragment, and primer pairs Larm-down-F and Larm-down-R were used to amplify the downstream region of the knockout fragment. The two homologous arms were constructed into a suicide plasmid, and *E. coli* was transformed. The correctly sequenced strain was used as the donor strain for the conjugation transfer experiment, and DG-Bbs-01 was used as the recipient strain. In the conjugation transfer experiment, the donor, recipient, and helper strains were co-incubated in a specific ratio. After screening with gentamicin resistance and sucrose plates, the target knockout strain was obtained. Primer pairs fimBCD-F and fimBCD-R were used for identification, and the successfully knocked-out strain amplified a 719 bp band. (Reference: Role of *Bordetella bronchiseptica* Fimbriae in Tracheal Colonization and Development of a Humoral Immune Response) (Tables 6 and 7).

[0069] fimBCD Gene knockout vector primers: Larm-up-F: cataaatgtaaagcaagcttGACGGCACGCTCGTGATTAC (SEQ ID NO: 9); Larm-up-R: ccgcagCTTCGCCTCGGCATTGCCGT (SEQ ID NO: 10); Larm-down-F: TGCCGAGGCGAAGCTGCGGGTGGTTGGTGACCGAGGCGAAT (SEQ ID NO: 11); Larm-down-R: ttaattaaggtaccgaattcGTAGCTGCGCCCATGGGTGA (SEQ ID NO: 12).

[0070] fimBCD Gene identification primer sequences: fimBCD-F: 5'-TCCTGCCCATCGTTGCGATAGTTGCGA-3' (SEQ ID NO: 13); fimBCD-R: 5'-ACGTACGGGACGACCCTGCGCTATCTG-3' (SEQ ID NO: 14).

[0071] The PCR products were subjected to 1% agarose gel electrophoresis and then recovered from the gel. The recovered products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing, and the results are as follows: Figure 2 As shown, the strain with the deletion was named DG-Bbs-04.

[0072] Table 6: fimBCD Gene PCR identification system Table 7: fimBCD Gene PCR identification procedure 2. Further respiratory inoculation experiments were conducted on healthy 2-month-old experimental dogs using DG-Bbs-03 and DG-Bbs-04 strains. The specific method was as follows: The experimental dogs were divided into 3 groups, with 2 dogs in each of groups 1 and 2, and 1 dog in group 3. Group 1 was inoculated with DG-Bbs-03 strain, group 2 with DG-Bbs-04 strain, and group 3 was inoculated with PBS as a control group.

[0073] Fresh single colonies were inoculated into 3 mL of 10% NBS-TSB-YE liquid medium and incubated at 37°C for 24 h. Seed culture was then inoculated 1:50 into 10 mL of 10% NBS-TSB-YE liquid medium and incubated at 37°C for 8-9 h until the logarithmic growth phase (OD600 = 1.2-1.5). The collected bacterial culture was washed twice with twice the volume of PBS, and the CFU of the bacterial culture was adjusted to 2 × 10⁻⁶ with PBS. 9 / mL, 500 μL of bacterial solution was inoculated into the nose of each dog, and the dogs were observed for 14 days.

[0074] The results are shown in Table 8. The experimental dogs immunized with both DG-Bbs-03 and DG-Bbs-04 strains showed no symptoms such as coughing, runny nose, eye discharge, or persistent fever. Therefore, the DG-Bbs-03 strain was determined to be the cause of infection. fimBCD Gene inactivation led to a significant reduction in virulence, further confirming that strain DG-Bbs-03 is a weakened strain of Bordetella bronchiseptica. Strain DG-Bbs-04 has been submitted to the China Center for Type Culture Collection for preservation.

[0075] Table 8: Clinical Symptom Scoring Sheet for Experimental Dogs Inoculated with DG-Bbs-03 and DG-Bbs-04 Strains Example 5: Identification of the genetic stability of attenuated strains of Bordetella bronchiseptica, DG-Bbs-02 and DG-Bbs-03. The attenuated Bordetella bronchiseptica strains DG-Bbs-02 and DG-Bbs-03 selected in this invention were removed from a -80℃ freezer and activated onto 10% NBS-TSA-YE agar plates. They were incubated at 37℃ for 48 h. After single colonies grew, a single colony was picked and streaked onto a 10% NBS-TSA-YE agar plate and incubated at 37℃ for 48 h. The colonies on this plate were considered the first generation strain. This process was repeated 50 times, with detailed observation of colony morphology, size, and growth rate at each generation. Gram staining was performed on strains from generations 1, 10, 20, 30, 40, and 50. fimB , fimD Gene sequencing and PCR identification systems and procedures are shown in Tables 9 and 10.

[0076] fimB Gene amplification primer sequences: fimB-F: 5'-CGGCGAAGGCAAGGCTCATCGCGAGAATC-3' (SEQ ID NO: 15); fimB-R: 5'-GCTTGATACATGCAAAGCATCGATAGCTACG-3' (SEQ ID NO: 16).

[0077] fimD Gene amplification primer sequences: fimD-F: 5'-AACGCGGTAATGCCGCTATCCCACTC-3' (SEQ ID NO: 17); fimD-R: 5'-TCGTCATCACGGGTACGCGCGTGATC-3' (SEQ ID NO: 18).

[0078] The PCR products were recovered by 1% agarose gel electrophoresis and then sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.

[0079] Table 9 : fimB, fimD Gene PCR identification system Table 10: fimB, fimD Gene PCR identification procedure The results are as follows Figures 3 - 5 As shown. The colony morphology, size, and growth rate of the attenuated strains of *Bordetella bronchiseptica* DG-Bbs-02 and DG-Bbs-03 remained unchanged across generations, retaining the characteristics of slow growth and small colonies. PCR amplification of strain DG-Bbs-02... fimD Gene sequencing and PCR amplification of strain DG-Bbs-03 fimD , fimB Gene sequencing revealed that each generation retained the original genetic characteristics of the DG-Bbs-02 strain. fimD Five bases, GCTCT, were inserted between 201 and 202 bp in the gene of strain DG-Bbs-03. fimD The gene inserts 5 bases GCTCT between positions 201-202 bp. fimB The gene has a single G base inserted between 188-189 bp. This indicates that the attenuated Bordetella bronchiseptica strains DG-Bbs-02 and DG-Bbs-03 screened in this invention can stably inherit the inserted gene fragment without any reversion to virulence.

[0080] Example 6: Identification of exogenous nucleic acid from attenuated strains of Bordetella bronchiseptica, DG-Bbs-02 and DG-Bbs-03 Single colonies of strains DG-Bbs-02 and DG-Bbs-03 were inoculated into 15 mL of 10% NBS-TSB-YE liquid medium and cultured at 37°C and 200 rpm for 24 h. Bacterial cells were collected, and plasmids were extracted using the Novizan plasmid extraction kit. 150 ng of plasmid was then subjected to 1% agarose gel electrophoresis.

[0081] The results showed that strains DG-Bbs-02 and DG-Bbs-03 did not contain plasmids. Figure 6 This indicates that the attenuated strains of Bordetella bronchiseptica, DG-Bbs-02 and DG-Bbs-03, have no exogenous nucleic acid and a clear genetic background.

[0082] Example 7: Preparation of attenuated live vaccine from Bordetella bronchiseptica Seed cultures of *Bordetella bronchiseptica* strains DG-Bbs-02 and DG-Bbs-03 were inoculated into small volumes of 10% NBS-TSB-YE liquid medium (with 100 μg / mL streptomycin (Str) and 50 μg / mL ampicillin (Amp) added), and cultured at 37°C and 200 rpm for 22-24 h. The culture was then scaled up to a 1:50 ratio in a fermenter and cultured at 37°C and 200-600 rpm for 24 h. Samples were harvested, and viable counts were determined (using the Chinese Veterinary Pharmacopoeia 2020, Appendix 3405). The samples were then mixed with a lyophilization stabilizer and dispensed into sterile vials. The samples were lyophilized according to the prescribed procedure to maintain activity, and the viable counts of the lyophilized vaccine composition were also determined. This completes the preparation of the *Bordetella bronchiseptica* attenuated live vaccine.

[0083] The specific steps of the above procedure are as follows: 1. Preparation and detection of bacterial culture (1) Activation: The attenuated strains of Bordetella bronchiseptica, DG-Bbs-02 and DG-Bbs-03, were activated on 10% NBS-TSA-YE solid plates (containing 100 μg / mL streptomycin and 50 μg / mL ampicillin) and cultured at 37℃ for 48 h. (2) Primary seed culture: Pick a single colony and inoculate it into 10 mL of 10% NBS-TSB-YE liquid medium (containing 100 μg / mL streptomycin and 50 μg / mL ampicillin), and incubate at 37℃ and 200 rpm for 24 h; (3) Secondary seed culture: Inoculate the seed culture at a ratio of 1:50 into 100 mL of fresh 10% NBS-TSB-YE liquid medium and incubate at 37℃ and 200 rpm for 12-18 h to allow OD to develop. 600=2.5±1.0, the culture medium was sterilized by filtration using a 0.22 μm pore size filter.

[0084] 2. Fermentation production Fermentation: Prepare 3 L of TSB-NA liquid medium (5 L fermenter), inoculate the seed culture 1:50 into 3 L of fresh TSB-NA liquid medium, and incubate at 37℃ for 24 h; Fermentation parameters: Temperature: 37℃±0.2; pH: 7.0±0.2, maintained by using 500 mL of 50% phosphoric acid in a sterile glass bottle / pipeline. Stirring: 200 rpm-500 rpm, the equipment is set to automatically adjust to maintain a constant dissolved oxygen level; Ventilation: Adjust to maintain DO = 40%; Dissolved oxygen (DO): DO = 40%; Feeding: 25% yeast extract, cultured to OD. 600 When the α=2.0±0.2, feed at a rate of 40 mL / h; Harvest: Samples were taken from the fermenter after 24 hours of cultivation to detect OD. 600 The CFU was then measured and plated. The fermentation culture was transferred to sterile centrifuge tubes and harvested by centrifugation.

[0085] 3. Freeze-dried vaccines (1) Prepare freeze-drying stabilizer: 3.6% sucrose, 1.8% gelatin, 0.72% urea, 0.46% sodium chloride, 0.072% L-glutamate, 0.066% sodium dihydrogen phosphate, 0.011% potassium dihydrogen phosphate, and 0.011% potassium chloride. Filter the mixture with a 0.22 μm pore size filter to remove impurities. (2) Mixing: Mix the culture with the stabilizer. The CFU of the DG-Bbs-02 strain mixture needs to be adjusted to 2-3 × 10⁻⁶. 6 Adjust the CFU / mL of the DG-Bbs-03 strain mixture to 3-5 × 10⁻⁶ CFU / mL. 9 CFU / mL; (3) Freeze-drying: After mixing the culture and stabilizer for 24 h, dispense 1.1 mL of the mixture into each vial and place it in a -80℃ freezer overnight. Start the freeze-drying program according to the freeze-drying cycle parameters. Sampling and inspection: Three bottles of freeze-dried vaccine were randomly selected, and the CFU of the samples before and after freeze-drying were tested to calculate the loss rate.

[0086] The results showed that the antigen content of the attenuated live bronchogenic vaccine of Bordetella bronchiseptica of the present invention was not less than 10. 6The vaccine composition, with a concentration of CFU / mL per vial, exhibits low antigen loss after lyophilization and is free from microbial contamination. One batch of the vaccine composition was selected for immunogenicity testing in experimental dogs.

[0087] Example 8: Safety testing of Bordetella bronchiseptica attenuated live vaccine Twenty experimental dogs were divided into seven groups: groups 1-6 each contained three dogs, and group 7 contained two dogs. Groups 1-3 were each intranasally inoculated with 10 doses of bacteria containing 2-3 × 10⁻⁶ bacteria. 6 2-3×10 7 2-3×10 8 CFU / mL / dose of DG-Bbs-02 strain freeze-dried vaccine; Groups 3-4 were administered 10 doses intranasally with a bacterial count of 3-5×10⁻⁶. 7 3-5×10 8 3-5×10 9 The DG-Bbs-03 strain freeze-dried vaccine was administered at CFU / mL / dose; the seventh group received an equal volume stabilizer intranasally, and the clinical symptoms of the experimental dogs were observed for 14 days.

[0088] The results are shown in Tables 11-12. The bacterial content of 10 inoculated doses was 2-3 × 10⁻⁶. 6 CFU / mL, 2-3×10 7 Experimental dogs receiving the DG-Bbs-02 strain freeze-dried vaccine at CFU / mL showed no symptoms of ocular or nasal discharge, coughing, or sneezing, while dogs vaccinated with 10 doses had a bacterial count of 2-3 × 10⁻⁶. 8 Experimental dogs receiving the DG-Bbs-02 strain freeze-dried vaccine at CFU / mL showed mild respiratory symptoms. This indicates that the safety of the DG-Bbs-02 strain in dogs depends on the inoculation concentration. Furthermore, all experimental dogs receiving an overdose of the DG-Bbs-03 strain freeze-dried vaccine showed no symptoms such as ocular or nasal discharge, coughing, sneezing, or fever, indicating that the DG-Bbs-03 strain vaccine of this invention is safe for dogs.

[0089] Table 11: Clinical Symptom Scoring Table for Experimental Dogs Inoculated with Different Bacterial Concentrations of DG-Bbs-02 Strain Table 12: Clinical symptom scoring table for experimental dogs inoculated with different bacterial concentrations of DG-Bbs-03 strain Example 9: Efficacy test of Bordetella bronchiseptica attenuated live vaccine 1. Immunopotency test of Bordetella bronchiseptica attenuated live vaccine Twenty-three male and female Beagle puppies, aged six weeks, were housed in an isolation facility and vaccinated at eight weeks of age. They were divided into five groups: groups 1-4 each contained five puppies, and group 5 contained three puppies. Group 1: Intranasal injection of 500 µL 2-3 × 10 6 CFU / mL DG-Bbs-02 attenuated strain freeze-dried vaccine, Group 2: Intranasal injection of 500 µL 2-3 × 10 7 CFU / mL DG-Bbs-02 attenuated live virus freeze-dried vaccine, Group 3: 500 µL intranasally, 3-5 × 10 8 CFU / mL DG-Bbs-03 attenuated live virus freeze-dried vaccine, Group 4: 500 µL intranasally, 3-5 × 10 9 CFU / mL DG-Bbs-03 attenuated strain freeze-dried vaccine, Group 5: 500 µL of stabilizer administered intranasally.

[0090] Before vaccination, deep nasopharyngeal swabs and serum agglutination titers were collected from the experimental dogs to confirm they were free of Bordetella bronchiseptica infection. After vaccination, the five groups of dogs were isolated in separate facilities to avoid cross-infection and were housed under identical conditions. The dogs' clinical symptoms were closely monitored after vaccination, including weight, ocular and nasal discharge, body temperature, lethargy, coughing, sneezing, and difficulty breathing, and scored accordingly. Blood samples were collected intravenously on days 0, 7, 14, and 20, and serum was separated to determine serum agglutination titers.

[0091] Table 13: Clinical symptoms in experimental dogs vaccinated with Bordetella bronchiseptica attenuated live vaccine Table 14: Serum agglutination titers of experimental dogs vaccinated with Bordetella bronchiseptica live attenuated vaccine The results are shown in Tables 13 and 14. Observations showed that the experimental dogs vaccinated with the DG-Bbs-02 and DG-Bbs-03 attenuated freeze-dried vaccines of this invention had normal appetite, no eye or nasal discharge, normal body temperature, and no drowsiness, coughing, sneezing, or difficulty breathing. Furthermore, after vaccination with the DG-Bbs-02 and DG-Bbs-03 attenuated freeze-dried vaccines of this invention, the serum agglutination titer of the experimental dogs increased, indicating that the vaccines of this invention have good immunogenicity and can induce immune efficacy in the experimental dogs.

[0092] 2. Testing the protective efficacy of attenuated live vaccine against Bordetella bronchiseptica Twenty days after immunizing experimental dogs with a live attenuated Bordetella bronchiseptica vaccine, the dogs were challenged with a virulent strain of Bordetella bronchiseptica via aerosol. The virulent strain had a CFU of 5 × 10⁻⁶. 8 / mL, the challenge dose was 20 mL, and the challenge time was 15 min. The specific method was as follows: 25 mL of the virulent strain was added to the nebulizer, and when about 20 mL of bacterial solution was aerosolized, the dog stayed in the chamber for another 5 minutes. The remaining 5 mL of bacterial solution was discarded, and the experimental dog was transferred back to its daily isolation area. Clinical symptoms and body temperature were observed for 14 days.

[0093] Table 15: Clinical Symptom Scoring Sheet for Experimental Dogs Challenged with Highly Virulent Bordetella Bronchiseptica Table 16: Body temperature (°C) of experimental dogs inoculated with strains DG-Bbs-02 and DG-Bbs-03 Table 17: Results of Protective Efficacy Tests for Bordetella Bronchiseptica Attenuated Live Vaccine The results are shown in Tables 15-17. Observations revealed that the control group dogs exhibited elevated body temperature, coughing, sneezing, and nasal and ocular discharge, which persisted for a prolonged period (Tables 15 and 16). In contrast, the experimental dogs vaccinated with the attenuated live vaccine against *Bordetella bronchiseptica* of this invention provided 100% protection when challenged with a virulent strain of *Bordetella bronchiseptica* (Table 17). This demonstrates that vaccination with the vaccine of this invention can stimulate the body to produce high-titer, specific antibodies against *Bordetella bronchiseptica*.

[0094] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A live attenuated strain of Bordetella bronchiseptica, characterized in that, The attenuated strain of *Bordetella bronchiseptica* is *Bordetella bronchiseptica* (… Bordetella bronchiseptica The attenuated strain of *Bordetella bronchiseptica* with insertion or deletion mutations; the fimbrial operon-related genes of the attenuated strain of *Bordetella bronchiseptica* contain insertion or deletion mutations; the fimbrial operon-related genes include fimB Gene, fimD Gene, fimBCD At least one of the gene clusters; the insertion or deletion mutation results in a relative decrease in the virulence of the strain while maintaining high immunogenicity.

2. The attenuated strain of Bordetella bronchiseptica as described in claim 1, characterized in that, The mutation is fimD A base insertion mutation was performed on the gene, and the resulting strain was named DG-Bbs-02. It was deposited at the China Center for Type Culture Collection (CCTCC) on November 3, 2025, with accession number CCTCC NO: M 20252420. The DG-Bbs-02 strain... fimD The nucleotide sequence of the gene is shown in SEQ ID NO:

3.

3. The attenuated strain of Bordetella bronchiseptica as described in claim 1, characterized in that, The mutations include fimB Genes and fimD A base insertion mutation was performed on the gene, and the resulting strain was named DG-Bbs-03. It was deposited at the China Center for Type Culture Collection (CCTCC) on November 3, 2025, with accession number CCTCC NO: M 20252421. The DG-Bbs-03 strain... fimD The nucleotide sequence of the gene is shown in SEQ ID NO:

3. fimB The nucleotide sequence of the gene is shown in SEQ ID NO:

4.

4. The attenuated strain of Bordetella bronchiseptica as described in claim 1, characterized in that, The mutations include fimBCD The gene cluster deletion mutation resulted in a strain named DG-Bbs-04, which was deposited at the China Center for Type Culture Collection (CCTCC) on November 3, 2025, with accession number CCTCC NO: M 20252422. The DG-Bbs-04 strain... fimBCD The gene nucleotide sequence is shown in SEQ ID NO:

6.

5. A method for constructing a attenuated strain of *Bordetella bronchiseptica* according to any one of claims 1-4, characterized in that, The steps include: using Bordetella bronchiseptica Bordetella bronchiseptica Using the bacterium as the starting bacterium, strains with weakened virulence were screened through continuous passages to obtain the attenuated strain of *Bordetella bronchiseptica*; the fimbrial operon-related genes of the attenuated strain of *Bordetella bronchiseptica* contained insertion or deletion mutations; or, by knocking out... fimBCD The gene yielded the attenuated strain of Bordetella bronchiseptica.

6. The use of the attenuated strain of Bordetella bronchiseptica or its passaged culture as described in any one of claims 1-4 in the preparation of an attenuated Bordetella bronchiseptica vaccine.

7. The use of the attenuated strain of Bordetella bronchiseptica or its passaged culture as described in any one of claims 1-4 in the preparation of a medicament or preparation for the prevention or mitigation of Bordetella bronchiseptica infection and the diseases caused therefrom.

8. The application as described in claim 7, characterized in that, The drug or preparation is intended for use in dogs or cats.

9. A live attenuated vaccine against Bordetella bronchiseptica, characterized in that, The vaccine comprises the attenuated strain of Bordetella bronchiseptica as described in any one of claims 1-4 or its passaged culture, and pharmaceutically acceptable excipients.

10. The attenuated live vaccine against Bordetella bronchiseptica as described in claim 9, characterized in that, The *Bordetella bronchiseptica* attenuated live vaccine contains ≥1×10⁻⁶ *Bordetella bronchiseptica* strains. 6 CFU / Toufen.

Citation Information

Patent Citations

  • Canine bordetella bronchiseptica attenuated strain vaccine composition and preparation method thereof

    CN116350763A