Mustard gas immunotoxicity evaluation method based on Foxp3 promoter methylation

By detecting the methylation level of the Foxp3 promoter modified by the DNA methyltransferase Dnmt3b, the shortcomings in the evaluation of immunotoxicity after mustard gas poisoning were addressed, enabling early warning and diagnosis of immune dysfunction and providing an effective basis for clinical intervention and treatment.

CN121852528APending Publication Date: 2026-04-14THE NAVAL MEDICAL UNIV OF PLA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511997325.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-27
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing technologies lack effective methods for early warning, monitoring, and diagnosis to assess the immunotoxicity of mustard gas poisoning, especially for evaluating immune dysfunction.

Method used

Methylation of the Foxp3 promoter modified by the DNA methyltransferase Dnmt3b was used as a biomarker for mustard gas immunotoxicity. The methylation levels of six CpG sites in the Foxp3 promoter were detected and evaluated using specific primers.

Benefits of technology

It enables early warning and diagnosis of immunotoxicity after mustard gas poisoning, detects immune system abnormalities before clinical symptoms appear, provides early intervention opportunities, and assesses the efficacy of drug treatment and predicts prognosis by dynamically monitoring the methylation level of the Foxp3 promoter region.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852528A_ABST
    Figure CN121852528A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, provides a mustard gas immunotoxicity evaluation method based on Foxp3 promoter methylation, and evaluates the application effect of the Foxp3 promoter methylation level in mustard gas immunotoxicity evaluation in combination with in-vitro cell experiments and in-vivo animal experiments. Results show that Treg cell deficiency is a main reason for tissue damage and inflammation caused by mustard gas poisoning, cell fate and functions of the Treg cell deficiency are mainly regulated and controlled by Foxp3 transcription factors, mustard gas can cause increase of the DNA methylation level of Foxp3 gene loci, DNA hypermethylation of Foxp3 promoters is crucial to Treg cell differentiation inhibition, Th17 / Treg imbalance and systemic inflammation caused by mustard gas exposure, and the Treg cell deficiency is a main reason for tissue damage and inflammation caused by mustard gas poisoning. The methylation level of the Foxp3 promoter can be used as a marker of a mustard gas immunotoxicity evaluation method.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to a method for evaluating the immunotoxicity of mustard gas, specifically a method for evaluating the immunotoxicity of mustard gas based on Foxp3 promoter methylation. Background Technology

[0002] In addition to acute damage to the skin, eyes, and respiratory system, the harm caused by mustard gas exposure often results in immune dysfunction years later, characterized by chronic inflammation and multi-organ damage. These immunotoxicities, once developed, can persist for decades. However, current technologies for early warning, monitoring, and diagnosis of mustard gas poisoning are very limited, especially regarding the lack of effective methods for evaluating whether mustard gas poisoning will induce immunotoxicity.

[0003] Mustard gas exposure can induce long-term epigenetic changes such as DNA methylation and histone modifications. These epigenetic pathways can participate in the pathogenesis of inflammatory diseases by affecting the function of immune cells, and therefore these indicators can be used to evaluate mustard gas immunotoxicity. However, the specific types of epigenetic modifications associated with mustard gas immunotoxicity and the characteristic modification sites on chromatin are still unclear, hindering the development and application of related technologies.

[0004] In summary, this invention provides a method for evaluating the immunotoxicity of mustard gas by using methylation of the Foxp3 promoter modified by the DNA methyltransferase Dnmt3b as a marker for the evaluation of mustard gas immunotoxicity. Summary of the Invention

[0005] The purpose of this invention is to establish a mustard gas immunotoxicity evaluation method based on Foxp3 promoter methylation. The methylation of the Foxp3 promoter, which is modified by DNA methyltransferase Dnmt3b, is used as a marker for mustard gas immunotoxicity evaluation, providing a new approach and means for mustard gas immunotoxicity evaluation, so as to solve the problems of early warning, monitoring and diagnosis of immune dysfunction caused by mustard gas poisoning.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows:

[0007] This invention provides a method for evaluating the immunotoxicity of mustard gas based on Foxp3 promoter methylation. The method involves detecting the methylation levels of six CpG sites in the Foxp3 promoter modified by the DNA methyltransferase Dnmt3b. These six CpG sites are:

[0008] CpG1: GRCm39(chrX: 7,445,714-7,445,715)、

[0009] CpG2: GRCm39(chrX: 7,445,844- 7,445,845),

[0010] CpG3: GRCm39(chrX: 7,445,853-7,445,854),

[0011] CpG4: GRCm39(chrX: 7,445,862-7,445,863)、

[0012] CpG5: GRCm39(chrX: 7,445,865-7,445,866)、

[0013] CpG6: GRCm39(chrX: 7,445,880-7,445,881).

[0014] This invention also provides a set of primers for detecting the methylation level of the Foxp3 promoter modified by the DNA methyltransferase Dnmt3b. The primers include a forward primer and a reverse primer. The forward primer is: TTTAGATGATTTGTAAAGGGTAAA, and the reverse primer is: AATCAACCTAACTTATAAAAAACTA.

[0015] The present invention also provides the application of the above-mentioned primers in evaluating the immunotoxicity of mustard gas.

[0016] The present invention also provides the application of the above-mentioned evaluation method in the diagnosis of mustard gas immunotoxicity.

[0017] The present invention also provides a mustard gas immunotoxicity diagnostic model, wherein the model comprises lymphocytes obtained from peripheral blood as test samples, and the methylation level of the Foxp3 promoter modified by DNA methyltransferase Dnmt3b in the lymphocytes is detected.

[0018] The present invention also provides the application of the above-mentioned diagnostic model in the assessment of mustard gas immunotoxicity.

[0019] The present invention also provides the application of the above-mentioned evaluation method in screening drugs for treating mustard gas poisoning.

[0020] Preferably, the drug is used to reduce the methylation level of the Foxp3 promoter, disrupt the binding of DNA methyltransferase Dnmt3b to the Foxp3 promoter, and promote the proliferation and differentiation of Treg cells.

[0021] Preferably, the drug comprises a Foxp3 promoter methylation inhibitor and a medically approved excipient.

[0022] Preferably, the drug comprises various acceptable dosage forms, such as injections, pills, capsules, granules, tablets, or oral liquids.

[0023] The beneficial effects of this invention are:

[0024] This invention is the first to discover and verify that elevated methylation levels at six CpG sites in the Foxp3 promoter region are the basis for mustard gas immunotoxicity, and reveals the specific types of epigenetic modifications and characteristic chromatin modification sites associated with mustard gas immunotoxicity.

[0025] This invention evaluates the application effect of Foxp3 promoter methylation level in mustard gas immunotoxicity assessment through in vitro cell experiments and in vivo animal experiments, using the DNA methylation level of the Foxp3 promoter modified by DNA methyltransferase Dnmt3b as an evaluation marker. The results show that high DNA methylation at the six CpG sites of the Foxp3 promoter is crucial for the inhibition of Treg cell differentiation, Th17 / Treg imbalance, and systemic inflammation induced by mustard gas exposure. The Foxp3 promoter methylation level can be used as a marker for the evaluation of mustard gas immunotoxicity, solving the problem that there is no effective evaluation method for whether mustard gas poisoning will induce immunotoxicity.

[0026] To address the shortcomings in early warning, monitoring, and diagnostic technologies for immune dysfunction caused by mustard gas poisoning, this invention utilizes lymphocytes obtained from peripheral blood as detection samples. This allows for the detection of immune system abnormalities before the onset of clinical symptoms, enabling early warning of mustard gas immunotoxicity and gaining valuable time for early clinical intervention and treatment. Furthermore, by dynamically monitoring the methylation level of the Foxp3 promoter region, it can also be used to evaluate the effectiveness of drug treatment and predict prognosis. Attached Figure Description

[0027] Figure 1In this invention, mustard gas (SM) induces multi-organ inflammation by inhibiting Treg function (A represents exposure to 12 mg / kg). B shows the weight changes in SM-exposed mice and solvent control group (n=3); C shows the flow cytometry analysis of Th1, Th2, Th17, and Treg cells in spleen lymphocytes of SM-exposed or control mice on day 7 post-exposure; D shows the quantification of Th1, Th2, Th17, and Treg cells in the spleen (n=5); E shows the quantification of Treg cells in resident lymphocytes of small intestine, lung, and liver tissues (n=5); E shows the experimental protocol for iTreg infusion: CD4+ T cells from CD45.1+ mice were polarized into iTreg cells and transferred to SM-exposed recipient mice (CD45.2+); F shows the flow cytometry analysis of CD45.1+ cells in different groups of Foxp3+ cells; G shows the flow cytometry analysis and quantification of Treg and Th17 cells in the spleen after iTreg infusion (n=3); H shows the weight changes in different groups of mice (n=3); I shows the histopathological HE staining of small intestine and lung tissue in different groups (day 7 post-exposure); Scale bar represents 100. μm; ***P<0.001, within-group comparison);

[0028] Figure 2 In this invention, SM promotes methylation of the Foxp3 locus via Dnmt3b (A shows the methylation status of the Foxp3 promoter and CNS region in Th0 cells cultured for 3 days; each circle represents a CpG site, with solid circles indicating methylated CpG and hollow circles indicating demethylated CpG; each row represents an independent sequencing result; for the Foxp3 promoter, the 6 circles in each row represent the methylation detection results of CpG1~CpG6 sites respectively; B shows the methylation status of the Foxp3 promoter and CNS region in iTreg cells cultured for 3 days; C shows the enrichment level analysis of Dnmt3b binding in the Foxp3 promoter and CNS region in Th0 cells 24 hours after SM exposure (n=3), with IgG used as a control; ***P<0.001, within-group comparison).

[0029] Figure 3This invention demonstrates that conditional knockout of Dnmt3b improved the systemic inflammatory phenotype following SM poisoning (A shows the weight changes in WT and Dnmt3b-cKO mice (n=3); B shows the flow cytometry analysis and quantification of the Treg cell ratio in splenic lymphocytes of WT and Dnmt3b-cKO mice (n=5); C shows the histopathological HE staining results of the small intestine, liver, and lungs of WT and Dnmt3b-cKO mice (day 7 post-exposure); the scale bar represents 100 μm; D shows that Dnmt3b gene knockout eliminated SM-induced Foxp3 promoter methylation in iTreg cells, with the six circles in each row representing the methylation detection results at CpG1~CpG6 sites; *P<0.05, ***P<0.001, intergroup comparison).

[0030] Figure 4 This invention demonstrates that altering the methylation level of the Foxp3 promoter can reshape the fate of Treg cells (A: Flow cytometry analysis of Foxp3+ cells in WT and Dnmt3b-cKO iTreg cells cultured for 3 days under Treg polarization conditions (n=5); B: Flow cytometry analysis of IL-17A+ cells in each group cultured for 3 days under Th17 polarization conditions (n=5); C: Methylation status of the Foxp3 promoter in iTreg cells of different treatment groups, with 6 circles in each row representing the methylation detection results of CpG1~CpG6 sites; D: Flow cytometry analysis of Foxp3+ cells in iTreg cells of the control group and SM-exposed group after treatment with DMSO or 40 nM A939572 (n=4); ***P<0.001, intergroup comparison).

[0031] Figure 5 This is the result of the alignment of the Foxp3 promoter gene sequence in the human and mouse genomes in this invention. Detailed Implementation

[0032] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0033] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0034] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0035] Example

[0036] Using in vitro cell experiments and in vivo animal experiments, the DNA methylation level of the Foxp3 promoter modified by DNA methyltransferase Dnmt3b was used as an evaluation marker to evaluate the application effect of Foxp3 promoter methylation level in the immunotoxicity evaluation of mustard gas.

[0037] 1 Experimental Methods

[0038] 1.1 T cell culture and mustard gas exposure

[0039] CD4+ T cells were purified from the spleen using a mouse naïve CD4+ T cell isolation kit (Stemcell). The purified CD4+ T cells were stimulated with 2 μg / mL anti-mouse CD3 and 2 μg / mL anti-mouse CD28, and cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, 50 µM 2-mercaptoethanol, 100 U / mL penicillin, and 100 μg / mL streptomycin to obtain Th0 cells. Th17 and iTreg cells were cultured under the following conditions: Th17 differentiation conditions: 20 ng / mL IL-6, 3 ng / mL h-TGF-β1, 5 μg / mL anti-IFNγ, and 5 μg / mL anti-IL4; iTreg cell differentiation conditions: 10 ng / mL IL-2, 15 ng / mL h-TGF-β1, 5 μg / mL anti-IFNγ, and 5 μg / mL anti-IL4. For in vitro cell culture experiments, SM was diluted to a stock concentration of 55.8 mM in DMSO. The stock solution was then diluted to 1 μM with RPMI 1640 medium. SM was applied at the 12-hour time point and washed with fresh medium after 1 hour of exposure. A939572 (40 nM) was added at the 16-hour time point. Cells were collected on day 3 for further analysis. Mycoplasma testing was performed weekly using a rapid mycoplasma detection kit (Procell LifeScience & Technology).

[0040] 1.2 Methylation Analysis Using Bisulfite Sequencing

[0041] Genomic DNA was purified from Th0 and iTreg cells using the Blood and Cell Culture DNA Midi Kit (Qiagen). Following the manufacturer's instructions, the genomic DNA was transformed with bisulfite using the EpiArt DNA Methylation Bisulfite Kit (Vazyme). Subsequently, the transformed genomic DNA was amplified by PCR using Rapid Taq Master Mix (Vazyme). The primers used to amplify the Foxp3 promoter and its CNS region CpG sites are as follows:

[0042] Promoter forward primer: TTTAGATTTGTAAAGGGTAAA

[0043] Reverse primer for promoter: AATCAACCTAACTTATAAAAAACTA;

[0044] CNS0 forward primer: GATAAGAAAAGGGATTTTTTGAGGTTTA

[0045] CNS0 reverse primer: CTAACCCCATATTTATAATTCCCAAC;

[0046] CNS1 forward primer: ATGGGAGTTAGATTGTTTGGAATAATTTA

[0047] CNS1 reverse primer: TAACTAAATAAATAACCCACTTTCCCAC;

[0048] CNS2 forward primer: AATTTTGGGTTTTTTTGGTATTTAAGAAAG

[0049] CNS2 reverse primer: CAACCTAAACTTAACCAAATTTTTCTAC;

[0050] CNS3 forward primer: GGTTTTTGGTTTATTTTTAGGAGTTTTG

[0051] CNS3 reverse primer: AAAACCCATAAACCACTTCCTATAC.

[0052] After purification by 2% agarose gel electrophoresis, the PCR products were ligated and transformed into DH5α competent cells using the TOPO TA cloning kit (Yeasen). Single clones were picked and then sequenced using Sanger sequencing.

[0053] 1.3 Chromatin Immunoprecipitation Quantitative PCR Detection

[0054] The collection and processing of Th0 and iTreg cells were performed according to the procedures outlined in the Enzymatic Chromatin IP Kit from Cell Signaling Technology. Chromatin immunoprecipitation experiments were conducted using either anti-Dnmt3b antibody (Cell Signaling Technology) or normal rabbit IgG antibody (Cell Signaling Technology). qPCR was performed using ChamQ SYBR qPCR Master Mix (Vazyme), and the primer sequences are as follows:

[0055] Foxp3 promoter forward primer: CCCACCCTGCAATTATCAGCACAC,

[0056] Reverse primer: GCTTGGGAAACTGCCACATTATCA;

[0057] Foxp3 CNS0 forward primer: CCTTATCGCTGATCTAGCAGCGCAC,

[0058] Reverse primer: CAATTGTTTTGGTAGCTGGCCCCATG;

[0059] Foxp3 CNS1 forward primer: TCTGGAACAACCTAGCCTCAAC,

[0060] Reverse primer: TCCTCAGAAAGATCCTCTGAGG;

[0061] Foxp3 CNS2 forward primer: GCCAGTGGACGTCACCTACC,

[0062] Reverse primer: TTGGGCTTCATCGGCAACAAGGA;

[0063] Foxp3 CNS3 forward primer: CCGGGGCCCAGAATGGGGT,

[0064] Reverse primer: GGCCCTGCAATATCTGCATAAGTCAG.

[0065] 1.4 Establishment of a mouse model of mustard gas exposure

[0066] (1) Mustard gas exposure mouse model

[0067] For animal experiments, SM was mixed with propylene glycol to obtain a stock solution of 26.75 mg / mL. The stock solution was then diluted with PBS to the desired concentration, and propylene glycol of the same concentration was used as a control solution. A systemic exposure model was established in 6-8 week old mice by tail vein injection of 12 mg / kg SM, with all animals injected at a dose of 0.1 mL / 20 g.

[0068] (2) Dnmt3b-cKO mice

[0069] Suzhou Cyagen Biotech Co., Ltd. was commissioned to construct knockout mice on CD4+ T cells using the Cre-LoxP system. Dnmt3b-flox mice (catalog number: S-CKO-02075) were obtained by inserting loxP sites flanking exons 3 and 4 of the Dnmt3b gene locus in C57BL / 6J mice (the mRNA sequence was not a multiple of 3, and knockout caused premature termination of Dnmt3b transcription). Dnmt3b-flox mice were then crossbred with CD4-Cre mice until homozygous to obtain CD4+ cell-specific Dnmt3b conditional knockout mice.

[0070] 1.5 Flow cytometry

[0071] Single-cell suspensions were prepared from tissue samples or cultured in vitro by centrifugation. For surface staining, antibodies diluted with PBS were added and incubated at room temperature for 20 minutes. For intracellular staining, cells were fixed with 4% paraformaldehyde and then stained with specific antibodies diluted with 1×Perm / Wash buffer (BD Biosciences). Foxp3 staining was performed using Foxp3 transcription factor staining buffer (eBioscience) according to the manufacturer's instructions. Flow cytometry analysis was performed using a CytoFLEX flow cytometer (Beckman) after staining, and data were analyzed and plotted using FlowJo software (Tree Star).

[0072] 1.6 Histopathological H&E staining

[0073] Small intestine, lung, and liver were extracted from mice exposed to mustard gas for 7 days. The samples were fixed in 4% paraformaldehyde, dehydrated with ethanol, embedded in paraffin, sectioned, and stained with hematoxylin and eosin.

[0074] 1.7 Data Analysis

[0075] Data were analyzed using SPSS 23.0 software with unpaired Student's t-test. Data are expressed as mean ± SD, or as mean ± standard deviation. P < 0.05 was considered statistically significant.

[0076] 2. Experimental Results

[0077] 2.1 Mustard gas immunotoxicity manifests as systemic inflammation caused by the inhibition of Treg cells.

[0078] To investigate the effects of mustard gas on Treg cell fate and function, a systemic mustard gas exposure animal model was established by intravenous injection of mustard gas at a dose of 12 mg / kg into C57BL / 6J mice. Animals exposed to mustard gas gradually lost weight over one week. Figure 1 A), and 7 days after poisoning, inflammation developed in multiple organs including the small intestine, lungs, and liver. Figure 1 I). Next, the proportions of different subsets of CD4+ T cells in the spleen of mice exposed to mustard gas were examined, and it was found that the proportions of Th1 and Th17 cells increased, while the proportion of Treg cells decreased ( Figure 1 (BC in the middle). In mice poisoned by mustard gas, a consistent decrease in the ratio of Treg cells in the lungs, small intestine, and liver was also observed. Figure 1 D).

[0079] To further determine the relationship between Treg cell deficiency and multi-organ inflammation in mustard gas-exposed mice, initial CD4+ T cells from CD45.1+ mice were induced and cultured into Treg cells (iTreg) in vitro, and the iTregs (CD45.1+) were transferred into mustard gas-exposed mice (CD45.2+). Figure 1 E). Flow cytometry analysis of CD4+ T cells in the spleen of recipient mice showed that the proportion of total Treg cells increased in mice poisoned by mustard gas after infusion of CD45.1+ Treg cells. Figure 1 The proportion of FG cells was not affected, while the proportion of Th17 cells remained unaffected, indicating that the transferred iTreg cells could reverse the inhibitory effect of mustard gas. Further investigation revealed that Treg cell transfer could rescue mustard gas-induced weight loss (FG). Figure 1 Increased inflammatory infiltration observed in the small intestine and lungs of mice (H) and ( Figure 1 I). These results indicate that Treg cell deficiency is a major cause of tissue damage and inflammation induced by mustard gas poisoning.

[0080] 2.2 Mustard gas can increase the DNA methylation level at the Foxp3 locus.

[0081] Foxp3 is a core transcription factor that controls the fate and function of Treg cells. Foxp3 expression is controlled by its promoter region and enhancers CNS0, CNS1, CNS2, and CNS3, each of which plays a different role in the development, stability, and function of Treg cells. The methylation of CpG sites at the Foxp3 locus in CD4+ T cells cultured in vitro under different conditions was detected by sulfite sequencing. The results showed that after mustard gas exposure, the methylation of six CpG sites in the promoter region of Th0 (α-CD3 / CD28) cells and iTreg cells significantly increased (the six sites were CpG1: GRCm39 (chrX: 7,445,714-7,445,715), CpG2: GRCm39 (chrX: 7,445,844-7,445,845), CpG3: GRCm39 (chrX: 7,445,853-7,445,854), CpG4: GRCm39 (chrX: 7,445,862-7,445,863), CpG5: GRCm39 (chrX: 7,445,862-7,445,863), CpG5: GRCm39 (chrX: 7,445,862-7,445,863), CpG6 ... (chrX: 7,445,865-7,445,866), CpG6: GRCm39 (chrX: 7,445,880-7,445,881)). Conversely, the CpG methylation levels at CNS0, CNS1, CNS2, and CNS3 loci at the Foxp3 locus did not change significantly in mustard gas-treated cells. Figure 2 The AB in the figure indicates that mustard gas can specifically induce an increase in DNA methylation levels in the Foxp3 promoter region.

[0082] The DNA methyltransferase Dnmt3b is involved in DNA methylation modification and has recently been considered to be related to epigenetic regulation of cell reprogramming and differentiation. To investigate whether Foxp3 methylation modification is mediated by Dnmt3b, ChIP-qPCR analysis was used. It was found that Dnmt3b in CD4+ T cells binds to the Foxp3 promoter region but not to CNS elements. Figure 2 C). Furthermore, 24 hours after mustard gas exposure, the binding of Dnmt3b in the Foxp3 promoter region further increased ( Figure 2 C).

[0083] By crossing Dnmt3b-flox mice with CD4-Cre mice, CD4+ cell-specific Dnmt3b knockout mice (Dnmt3b-cKO mice) were obtained. We found that Dnmt3b knockout improved the systemic inflammatory phenotype induced by mustard gas, manifested as weight gain and improved histopathology of the small intestine, liver, and lungs; after mustard gas exposure, compared with the WT group, the ratio of Treg cells in the spleen of Dnmt3b-cKO mice was also significantly increased. Figure 3 (AC in the middle). Meanwhile, after Dnmt3b knockout, mustard gas exposure failed to induce a significant increase in Foxp3 promoter methylation levels in iTreg cells ( Figure 3 D). These results indicate that the level of Dnmt3b-involved Foxp3 promoter methylation modification is closely related to Treg deficiency and inflammatory phenotype in mustard gas-exposed mice.

[0084] Furthermore, compared to the WT group, Dnmt3b-deficient CD4+ T cells showed enhanced ability to differentiate into Tregs in vitro under mustard gas exposure, but reduced ability to differentiate into Th17 cells. Figure 4 (AB in the text). Furthermore, incubation with the small molecule inhibitor A939572 can attenuate mustard gas-induced hypermethylation of the Foxp3 promoter region ( ). Figure 4 C), while partially rescuing the inhibitory effect of mustard gas on Treg differentiation ( Figure 4 D). These experimental data collectively demonstrate that DNA hypermethylation of the Foxp3 promoter is crucial for mustard gas exposure-induced Treg cell differentiation inhibition and Th17 / Treg imbalance.

[0085] Figure 5 This invention presents the results of sequence alignment of the Foxp3 promoter in the human and mouse genomes. The results show that the Foxp3 promoter regions in mice and humans have a sequence identity of up to 87.3%, demonstrating that its function is evolutionarily conserved. The CpG1, CpG3, CpG5, and CpG6 sites are also present in the human Foxp3 promoter. Therefore, for patients with mustard gas poisoning, the DNA methylation level of the Foxp3 promoter modified by the DNA methyltransferase Dnmt3b can be used as a marker for the immunotoxicity evaluation of mustard gas.

[0086] In summary, in vitro cell experiments and animal studies have shown that Treg cell deficiency is the main cause of tissue damage and inflammation induced by mustard gas poisoning. Foxp3 is a core transcription factor controlling Treg cell fate and function, and mustard gas can increase the DNA methylation level at the Foxp3 locus. Hypermethylation of the Foxp3 promoter DNA is crucial for the inhibition of Treg cell differentiation and Th17 / Treg imbalance induced by mustard gas exposure. Furthermore, the Foxp3 promoter region gene sequence is highly conserved in both humans and mice (87.3% sequence identity), possessing key DNA methylation modification sites such as CpG1, CpG3, CpG5, and CpG6. Therefore, the DNA methylation level of the Foxp3 promoter, modified by the DNA methyltransferase Dnmt3b, can serve as a biomarker for evaluating the immunotoxicity of mustard gas. For the detection process, lymphocytes from the patient's peripheral blood can be used as the detection target for mustard gas poisoning. The DNA methylation level of the Foxp3 promoter modified by the DNA methyltransferase Dnmt3b in the lymphocytes can be analyzed. The binding region of the primers used for detection is a highly evolutionarily conserved sequence, and it can also be matched universally for genomic DNA extracted from patient samples.

[0087] The above-described embodiments are merely preferred embodiments of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. A method for evaluating the immunotoxicity of mustard gas based on Foxp3 promoter methylation, characterized in that, The evaluation method involves detecting the methylation levels of six CpG sites in the Foxp3 promoter modified by the DNA methyltransferase Dnmt3b. These six CpG sites are: CpG1: GRCm39(chrX: 7,445,714-7,445,715)、 CpG2: GRCm39(chrX: 7,445,844- 7,445,845), CpG3: GRCm39(chrX: 7,445,853-7,445,854), CpG4: GRCm39(chrX: 7,445,862-7,445,863)、 CpG5: GRCm39(chrX: 7,445,865-7,445,866)、 CpG6: GRCm39(chrX: 7,445,880-7,445,881).

2. A set of primers for detecting the methylation level of the Foxp3 promoter modified by the DNA methyltransferase Dnmt3b, characterized in that, The primers include a forward primer and a reverse primer. The forward primer is: TTTAGATGATTTGTAAAGGGTAAA, and the reverse primer is: AATCAACCTAACTTATAAAAAACTA.

3. The use of the primers as described in claim 2 in evaluating mustard gas immunotoxicity.

4. The application of the evaluation method as described in claim 1 in the diagnosis of mustard gas immunotoxicity.

5. A mustard gas immunotoxicity diagnostic model, characterized in that, The model uses lymphocytes obtained from peripheral blood as test samples to detect the methylation level of six CpG sites in the Foxp3 promoter modified by the DNA methyltransferase Dnmt3b in lymphocytes.

6. The application of the diagnostic model as described in claim 5 in the assessment of mustard gas immunotoxicity.

7. The application of the evaluation method as described in claim 1 in screening drugs for treating mustard gas poisoning.

8. The application according to claim 7, characterized in that, The drug is used to reduce the methylation level of the Foxp3 promoter, disrupt the binding of DNA methyltransferase Dnmt3b to the Foxp3 promoter, and promote the proliferation and differentiation of Treg cells.

9. The application according to claim 7, characterized in that, The drug includes a Foxp3 promoter methylation inhibitor and medically approved excipients.

10. The application according to claim 7, characterized in that, The drug includes various acceptable dosage forms, such as injections, pills, capsules, granules, tablets, or oral liquids.