Rapid detection method for echinococcus granulosus based on RPA-CRISPR / Cas
By using the RPA-CRISPR/Cas system to specifically cleave target genes under isothermal conditions, the problem of insufficient sensitivity and high complexity in the detection of Echinococcus granulosus in existing technologies has been solved, achieving rapid detection with high specificity and sensitivity, which is suitable for primary healthcare institutions and on-site quarantine.
Patent Information
- Application Number
- CN202610175209.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-06
- Publication Date
- 2026-05-01
AI Technical Summary
Existing methods for detecting Echinococcus granulosus disease suffer from insufficient sensitivity, high false positive rates, complex operation, and the need for specialized equipment, which cannot meet the needs of primary healthcare institutions and on-site quarantine.
The RPA-CRISPR/Cas system was used to design sgRNA to guide the Cas12a protein to specifically cleave the target gene under isothermal conditions, and combined with a fluorescent reporter probe to achieve rapid and accurate detection, including RPA amplification and CRISPR/Cas reaction.
It achieves highly specific and sensitive detection of Echinococcus granulosus, enabling rapid and easy on-site differentiation of Echinococcus granulosus from other parasites. It is suitable for primary healthcare institutions and on-site quarantine, improving the efficiency of early identification and diagnosis.
Smart Images

Figure CN121951069A_ABST
Abstract
Description
A rapid detection method for Echinococcus granulosus based on RPA-CRISPR / Cas Technical Field
[0001] This invention relates to the field of molecular diagnostic technology, specifically to a rapid detection method for Echinococcus granulosus based on the combination of recombinase polymerase amplification (RPA) and clustered regularly spaced short palindromic repeats / CRISPR-related proteins (CRISPR / Cas), which is applicable to the clinical diagnosis, livestock quarantine and epidemiological investigation of Echinococcus granulosus. Background Technology
[0002] Echinococcosis granulosus is a zoonotic parasitic disease caused by the larvae (echinococcosis larvae) of the tapeworm Echinococcus granulosus. It is widespread globally, with a higher incidence in livestock-developed regions of my country, such as Northwest and Southwest China. Echinococci primarily parasitize the liver (approximately 70%), lungs (approximately 20%), and other organs in humans. Early stages are asymptomatic, but later stages can lead to serious complications such as anaphylactic shock and secondary infections due to cyst rupture, even endangering life.
[0003] Currently, detection methods for echinococcosis have significant limitations. Imaging examinations (CT, ultrasound, MRI) can only identify mature cysts >1 cm in diameter, lacking sufficient sensitivity for early, small cysts (<0.5 cm), and cannot distinguish between echinococcosis larvae and other parasitic cysts (such as multilocular echinococcosis larvae). Serological tests (ELISA, Western blotting) rely on the specificity of echinococcosis antigens, are prone to cross-reactivity with other parasites, and have a false positive rate as high as 15%-20%, and cannot detect asymptomatic infections. Conventional PCR testing requires expensive real-time quantitative PCR instruments, and the reaction requires a temperature cycle of "denaturation-annealing-extension" (95℃, 60℃, 72℃), which is complex, time-consuming (2-3 hours), and requires professional personnel, failing to meet the needs of primary healthcare institutions or on-site quarantine. Therefore, there is an urgent need to develop a rapid and accurate detection method suitable for on-site use to fill the gaps in existing detection technologies. Summary of the Invention
[0004] This invention addresses the shortcomings of existing methods for detecting Echinococcus granulosus by providing a rapid detection method based on RPA-CRISPR / Cas, achieving high specificity, high sensitivity, and isothermal rapid detection of Echinococcus granulosus, thus meeting the needs of clinical diagnosis and on-site quarantine.
[0005] The purpose of this invention is to provide a rapid detection method for Echinococcus granulosus based on RPA-CRISPR / Cas. The method includes the following steps: S1. Extracting DNA from the sample to be tested; S2. RPA amplification: configuring an RPA reaction system and amplifying the product using the RPA method; S3. CRISPR / Cas system reaction detection: taking the above amplification product, adding a fluorescent reporter probe, Cas12a, and sgRNA, performing a CRISPR reaction detection, and reading the detection signal.
[0006] The package includes the Cas12a protein (LbCas12a), the RPA primer combination F-5'-GGTCGGTTCGATGTGCTTTTGGATCTGTTAG-3', R-5'-ACTTTAAACCCACTGACCAACTCTCTTTCAG-3', and the sgRNA with the sequence UAAUUUCUACUAAGUGUAGAUAGCCUCUCCAUAAUCAAAUGGCG. It also includes a fluorescent reporter probe with the sequence 5'-TTATT-3', and RPA amplification reagents containing RPA enzyme and magnesium acetate.
[0007] The RPA amplification reaction system includes buffer, ddH2O, upstream and downstream primers, RPA enzyme lyophilized powder, template DNA, and magnesium acetate; the RPA amplification reaction conditions are: 39℃ for 20 min. The CRISPR / Cas system reaction system includes: 10×LbCas12a Reaction Buffer, LbCas12a, template, fluorescent reporter probe, and sgRNA; the CRISPR / Cas system reaction conditions are: 37℃ for 30 min.
[0008] The components of the RPA amplification reaction system were prepared in the following proportions: 29.5 μL buffer, 2.5 μL 280 mM magnesium acetate, 2.4 μL 10 μM upstream primer, 2.4 μL 10 μM downstream primer, 3 μL DNA template, and RPA enzyme lyophilized powder.
[0009] The reaction system of the CRISPR / Cas system was prepared in the following proportions: 2 μL of RPA reaction product, 2 μL of 10×LbCas12a Reaction Buffer, 1 μL of 1 μM LbCas12a, 1 μL of 10 μM fluorescent reporter probe, and 1 μL of 1 μM sgRNA, with ddH2O added to a final volume of 20 μL. The reaction conditions were: qPCR program set to 37℃ for 30 min, with FAM channel fluorescence signal collected every 30 s using a real-time quantitative PCR instrument.
[0010] Recombinase polymerase amplification (RPA) technology, as an isothermal nucleic acid amplification technique, can complete target gene amplification within 15-30 minutes under isothermal conditions of 37-42℃, without the need for complex temperature control equipment. The CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats, CRISPR, Cas protein) system, especially the Cas12a protein, possesses highly specific sequence recognition capabilities and "trans-cutting" activity, enabling non-specific cleavage of single-stranded DNA (ssDNA) after recognizing the target sequence. Combined with a fluorescent reporter probe, it allows for the visual detection of the target. The combined use of these two technologies achieves integrated detection of "isothermal amplification + specific cleavage + rapid reading," significantly improving the specificity, sensitivity, and convenience of the detection.
[0011] This invention targets Echinococcus granulosus and develops a rapid detection method for Echinococcus granulosus based on RPA technology, CRISPR, and the CRISPR-related protein system—CRISPR / Cas12. By designing sgRNA (single-stranded guide RNA) sequences, the method guides the Cas12 bound to it to cleave specific gene sites, thereby further increasing the specificity and sensitivity of the detection on the basis of RPA. It has extremely high detection sensitivity, can be carried out under isothermal conditions, and does not require complex instruments and equipment.
[0012] This invention establishes a specific method for the combined RPA-CRISPR detection of Echinococcus granulosus, possessing high sensitivity and strong specificity. It can rapidly and accurately distinguish Echinococcus granulosus from its closely related species and other common parasites in the field, achieving high specificity, high sensitivity, and isothermal rapid detection of Echinococcus granulosus infection. This method is simple to operate, has a short detection cycle, and requires no complex equipment, making it particularly suitable for primary healthcare institutions and on-site quarantine procedures. It can significantly improve the efficiency of early identification and diagnosis of Echinococcus granulosus infection. The establishment of this technology provides a reliable technical means for the clinical diagnosis, epidemiological investigation, and rapid on-site screening of Echinococcus granulosus infection, effectively meeting the urgent needs of clinical diagnosis and on-site quarantine. It has significant practical application value in promoting the improvement of parasitic disease prevention and control capabilities and ensuring public health security. Attached Figure Description
[0013] Figure 1 shows the sgRNA primer design sites in Example 1, where the black boxes represent the sgRNA design sites and the black ellipses represent PAM.
[0014] Figure 2 shows the specificity verification results of the Echinococcus granulosus RPA-CRISPR system in Example 1, where A is the fluorescence growth rate of the entire reaction, B is the fluorescence growth curve of the entire reaction, and C is a photo taken by a blue light gel cutter after the reaction is completed.
[0015] Figure 3 shows the sensitivity detection results of the Echinococcus granulosus RPA-CRISPR system in Example 1, where A is the fluorescence intensity curve of different plasmid concentrations and B is a photograph taken under a portable blue light gel cutter after the reaction. Detailed Implementation
[0016] The present invention will be further described below with reference to this example, but this does not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. The reagents and instruments used in the following examples can all be purchased commercially. Examples
[0017] I. Experimental Materials and Main Reagents 1. Experimental Materials
[0018] 2. Main Reagents: RPA Amplification Kit: TwistAmp Basic Kit (TwistDX Inc., catalog number: TABAS03KIT); Cas12a Protein: GenCRISPR LbCas12a Nuclease (Nanjing GenScript Biotech Co., Ltd., catalog number: Z03753-100); sgRNA and Fluorescent Reporter Probe: Synthesized by Beijing Aoke Dingsheng Biotechnology Co., Ltd.; DNA Extraction Kit: SPARKeasy Whole Blood / Tissue / Cell Genomic DNA Rapid Extraction Kit (Shandong Cisco Biotechnology Co., Ltd., catalog number: AA0901-A); PCR Amplification Kit: 2×Spark Taq PCR Master Mix (with dye) (Shandong Cisco Biotechnology Co., Ltd., catalog number: AF0102-B).
[0019] 3. Main instruments: Real-time PCR instrument; portable blue light gel cutter; constant temperature metal bath.
[0020] II. Nucleic Acid Extraction and Primer Design 1. DNA Extraction Serum / Plasma Samples: Use a column-based DNA extraction kit; Tissue Samples (Liver / Lung Cyst Tissue, Livestock Muscle Tissue): Take 100 mg of tissue, grind it into powder in liquid nitrogen, and then extract it using a column-based DNA extraction kit, following the instructions. The final elution volume is 20-50 μL; Fecal Samples: Use a fecal DNA extraction kit to remove inhibitors from the feces before extracting DNA.
[0021] 2. Nucleic acid sequence preparation: The DNA of Echinococcus granulosus in Table 1 was amplified to obtain the ND1 partial sequence. The amplification primer sequences were ND1-F: 5'-GGTCGGTTCGATGTGCTTTTGGATCTGTTAG-3'; ND1-R: 5'-ACTTTAAACCCACTGACCAACTCTCTTTCAG-3'.
[0022] The partial sequence of Echinococcus granulosus ND1 obtained by amplification sequencing is as follows: GGTCGGTTCGATGTGCTTTTGGATCTGTTAGGTTTGAGGCTTGTTTTATGTGTGTGGTGATTTTTTGTGCTTTGTGTAGTTGTAGGTATAATTTAATTGATTTTTATTATAATTGTTGATTAAGTTTGTTATTATTTCCATTAATTTATGTGTTATTTTTAATATGTATATTGTGTGAAACTAATCGTACGCCATTTGATTATGGAGAGGCTGAAAGAGAGTTGGTCAGTGGGTTTAAAGT3. Design of crRNA primers: Find the target sequence containing the CRISPR-Cas12a recognition sequence (PAM) TTTN. Based on the PAM location, design sgRNA primers on the differentially expressed regions using CRISPR software (http: / / crispor.tefor.net / ). The spacer sequence of the designed sgRNA was analyzed for coverage and specificity using NCBI BLAST. The sgRNA sequence is UAAUUUCUACUAAGUGUAGAUAGCCUCUCCAUAAUCAAAUGGCG. The alignment results showed that the designed sgRNA spacer sequence had 100% coverage within the tested species and good specificity.
[0023] 4. Template preparation: Using the sample DNA in Table 1 as a template, PCR amplification was performed using ND1-F / R according to the recommended system in the Cisco reagent instructions to obtain high-concentration products. The specific amplification system is shown in Table 2, and the corresponding PCR program is shown in Table 3. After cloning and expression, the plasmid was extracted.
[0024]
[0025] 5. RPA Amplification: Using the plasmid from step "4. Template Preparation" as a template, the *Echinococcus granulosus* ND1 gene fragment was amplified by RPA technology: RPA reaction system (50 μL): 25 μL RPA buffer, 2.5 μL 280 mM magnesium acetate, 2.4 μL 10 μM upstream primer F, 2.4 μL 10 μM downstream primer R, 3 μL template, 1 part of RPA enzyme lyophilized powder, and ddH2O to make up to 50 μL; the reaction system was incubated in a 39℃ constant temperature box for 20 min to obtain the RPA amplification product (containing the *Echinococcus granulosus* ND1 gene specific fragment).
[0026] The RPA buffer formulation is as follows: Tris-HCl (pH 7.6-8.0, 25℃) 50mM, potassium acetate 50mM, PEG35000 (w / v) 5.5%, BSA 0.1mg / ml, DTT 1mM, dNTPs (each type, dATP / dCTP / dGTP / dTTP) 0.2mM, creatine phosphate 40mM, creatine kinase 1× working concentration (approximately 0.5-1U / μL), and nuclease-free purified water.
[0027] 6. CRISPR detection: After measuring the plasmid concentration as described in "4. Template Preparation", dilute it 10-fold. 3 10 2 10, 10 0 10 - 1 The plasmid (copies / μL) and negative template were used to prepare the CRISPR reaction system according to the system in Table 4.
[0028]
[0029] The qPCR instrument was programmed at 37℃ for 30 min, with FAM channel fluorescence signals collected every 30 s. The changes in the fluorescence signal curve reflected the progress of the reaction. After the reaction was completed, the reaction tubes were placed on a portable blue light gel cutter to observe the fluorescence.
[0030] III. Specificity Detection of Echinococcus granulosus RPA-CRISPR System: Using the DNA from the 10 samples listed in Table 1 as templates, RPA amplification was performed on the DNA using the selected RPA primers F / R. The RPA reaction system and conditions were the same as those described in Section II, "Nucleic Acid Extraction and Primer Design." The RPA reaction products were used to prepare the CRISPR system shown in Table 4 and placed in a qPCR instrument. The qPCR program was set to 37℃ for 30 min, and the FAM channel fluorescence signal was collected once per cycle.
[0031] The results (Figure 2) show that only the *Echinococcus granulosus* sample exhibited fluorescence, while the other samples did not. This indicates that the detection method established in this experiment has good specificity and can effectively distinguish the target species.
[0032] IV. Sensitivity Detection of the RPA-CRISPR System for Echinococcus granulosus: After amplifying the extracted DNA from sample S1, a plasmid was constructed. The plasmid was then extracted and serially diluted 10-fold. 3 10 2 10 1 10 0 10 -1 A total of 5 concentrations were tested, following the reaction system and methods described in Section III, "Specific Detection of Echinococcus granulosus RPA-CRISPR System".
[0033] As shown in Figure 3, the RPA-CRISPR system for Echinococcus granulosus of the present invention can detect single copy numbers.
Claims
1. A rapid detection method for Echinococcus granulosus based on RPA-CRISPR / Cas, characterized in that... The method includes the following steps: S1. Extracting DNA from the sample to be tested; S2. RPA amplification: configuring an RPA reaction system and amplifying the product using the RPA method; S3. CRISPR / Cas system reaction detection: taking the above amplification product, adding a fluorescent reporter probe, Cas12a, and sgRNA, performing a CRISPR reaction detection, and reading the detection signal; wherein, the Cas12a protein is LbCas12a, and the RPA primer combination is F-5'-GGTCGGTTCGATGTGCTTTTGGATCTGTTAG-3', R-5'-ACT The protocol includes TTAAACCCACTGACCAACTCTCTTTCAG-3', and sgRNA with the sequence UAAUUUCUACUAAGUGUAGAUAGCCUCUCCAUAAUCAAAUGGCG. It also includes a fluorescent reporter probe with the sequence 5'-TTATT-3', and RPA amplification reagents containing RPA enzyme and magnesium acetate. The RPA amplification reaction system includes RPA buffer, ddH2O, forward and reverse primers, RPA enzyme lyophilized powder, template DNA, and magnesium acetate. The RPA amplification reaction conditions are: 39℃ for 20 seconds. The CRISPR / Cas system reaction system comprises: 10×LbCas12a Reaction Buffer, LbCas12a, template, fluorescent reporter probe, and sgRNA; the CRISPR / Cas system reaction conditions are: 37℃ for 30 min; the RPA amplification reaction system is prepared according to the following proportions: RPA buffer 29.5 μL, 280 mM magnesium acetate 2.5 μL, 10 μM upstream primer 2.4 μL, 10 μM downstream primer 2.4 μL, DNA template 3 μL, and RPA enzyme lyophilized powder; the CRISPR / Cas system reaction system is prepared according to the following proportions: RPA reaction product 2 μL, 10×LbCas12a Reaction Buffer 2 μL, 1 μM LbCas12a 1 μL, 10 μM fluorescent reporter probe 1 μL, and 1 μM sgRNA 1 μL, with ddH2O added to bring the volume to 20. μL; the reaction conditions were set to 37℃ for 30 min on the qPCR instrument, and the FAM channel fluorescence signal was collected every 30 s using a real-time quantitative PCR instrument.