Preparation method of ratio type electrochemical luminescence biosensor, sensor and application of sensor in detection of escherichia coli O157: H7

Abstract

The invention discloses a preparation method of a ratio type electrochemical luminescence biosensor, the sensor and application of the sensor in detection of escherichia coli O157: H7, and relates to the technical field of nano materials and biological detection. The sensor provided by the invention comprises an Aptamer-Templet double-strand body, a phi29 polymerase, a Nb.BbvCI nicking enzyme, a probe 1 and a probe 2, wherein the probe 1 and the probe 2 are connected with each other; the method comprises the following steps: specifically recognizing surface protein of escherichia coli O157: H7, releasing a Templet chain, releasing a Trigger chain and opening a hairpin structure of a probe 1 under the assistance of polymerase and cutting enzyme, and opening a hairpin structure of a probe 2 by the opened probe 1, so that self-assembly of the probe 1 and the probe 2 is realized, and a detectable object is obtained; the detection limit of the sensor to escherichia coli O157: H7 is as low as 1 CFU / mL, and the sensor is wide in linear range, high in stability, suitable for multiple samples, high in specificity and easy and convenient to use and operate.

Description

Technical Field

[0001] This invention relates to the field of nanomaterials and biodetection technology, specifically to a method for preparing a ratiometric electrochemiluminescence biosensor, the sensor itself, and its application in detecting Escherichia coli O157:H7. Background Technology

[0002] Escherichia coli O157:H7 is a highly pathogenic foodborne bacterium that poses a serious threat to public health. Escherichia coli O157:H7 is a major serotype of enterohemorrhagic Escherichia coli (EHEC). It produces potent Shiga toxin, damaging intestinal and vascular endothelial cells, thereby causing disease. Its core characteristic is an extremely low infectious dose; approximately 50-200 live bacteria are sufficient to cause illness. Infected individuals may experience abdominal cramps and watery stools, progressing to bloody stools (hemorrhagic colitis) within 24 hours. Fever is usually absent or present only as a low-grade fever. Approximately 5%-10% of infected individuals (especially children and the elderly) may develop hemolytic uremic syndrome, characterized by acute renal failure, thrombocytopenia, and hemolytic anemia, with a high mortality rate. It is primarily transmitted through foodborne routes. Cattle are the main natural host, and undercooked beef (especially ground beef), unpasteurized dairy products, contaminated fruits and vegetables, and water sources are common sources of infection.

[0003] Traditional methods such as culture and PCR are time-consuming and complex, thus limiting their clinical applicability and making it difficult to meet the needs of rapid on-site screening. ECL technology, due to its high sensitivity, low background noise, and ease of rapid detection, has become a research hotspot, with various innovative sensor designs emerging in recent years. The core idea is to improve performance through novel materials and signal amplification strategies. Aptamer sensing analysis uses aptamers that specifically bind to bacteria as recognition elements. It is a class of methods that quantitatively detect bacteria based on changes in measurable signals caused by aptamer binding, captured by relevant instruments. Currently, aptamer-based bacterial sensing analysis methods mainly include colorimetry, fluorescence, chemiluminescence, and electrochemical methods.

[0004] Aptamer-based colorimetric detection methods primarily utilize color-changing nanomaterials or substrates that exhibit color development under the action of specific enzymes as colorimetric agents. The aptamer specifically binds to the target, causing a color change, thereby enabling qualitative or quantitative detection of the target. Hotza et al. constructed a colorimetric method based on aptamer-coupled gold nanoparticles (AuNPs) for the detection of *S. typhimurium*. The method achieves quantitative detection of bacteria by measuring the aggregation degree of AuNPs using UV-Vis absorption spectroscopy, with a LOD of 1 × 10⁻⁶. 3CFU / mL. Aptamer-based fluorescence detection methods label aptamers at both ends as detection signals. When the target binds to the aptamer, changes in fluorescence polarization or intensity occur, allowing for quantitative detection of bacteria based on these differences in fluorescence signals. Wang et al. used fluorescent groups and magnetic nanoparticles to label aptamers separately, and after magnetic separation, achieved quantitative detection of *S. typhimurium* based on fluorescence signals, with a linear range of 10⁻⁶ CFU / mL. 1 ~10 6 The concentration of CFU / mL was [CFU / mL], with a LOD of 25 CFU / mL. Furthermore, chemiluminescent factors were labeled onto the aptamer sequence, and the target was quantitatively detected by detecting the chemiluminescent signal. For example, Lee et al. constructed a chemiluminescent detection method for E. coli O157:H7 using the E. coli O157:H7 aptamer, graphene oxide (GO) / iron nanocomposite materials, and guanine chemiluminescent reagent, with a linear range of 10 [CFU / mL]. 4 ~10 7 CFU / mL, LOD 4.5×10 3 CFU / mL. Aptamer-electrochemical integration: By immobilizing the aptamer and electrochemically active element on the electrode, quantitative detection of the target is achieved based on changes in the electrochemical signal after the aptamer binds to the target. Li et al. constructed an aptamer-modified nanoporous electrochemical sensor for the quantitative detection of Listeria monocytogenes, with a linear range of 10⁻⁶ CFU / mL. 2 ~1.25×10 3 CFU / mL, LOD is 10 2 CFU / mL.

[0005] Aptamer sensing has developed rapidly in recent years and is widely used in the detection of bacteria such as E. coli O157:H7. This method has advantages such as high sensitivity, good specificity, simple operation, and fast analysis speed. Combined with miniaturized detection devices, it can achieve rapid on-site detection, thus showing broad application prospects. However, existing detection methods still have problems such as insufficient detection limits, the need to strengthen anti-interference capabilities, and insufficient detection stability. Summary of the Invention

[0006] The purpose of this invention is to provide a method for preparing a ratiometric electrochemiluminescence biosensor, the sensor itself, and its application in detecting Escherichia coli O157:H7, in order to solve the problems mentioned in the background art.

[0007] To achieve the above objectives, the present invention provides the following technical solution: a method for preparing a ratiometric electrochemiluminescence biosensor, the sensor comprising Aptamer-Templet duplex, phi29 polymerase, Nb.BbvCI nicking enzyme, probe 1 and probe 2;

[0008] The preparation methods for Aptamer-Templet duplexes, probe 1, and probe 2 include:

[0009] The Templet chain and Aptamer chain are mixed and annealed to obtain the Aptamer-Templet duplex;

[0010] After annealing hairpin DNA H1 with an amino group modified at the 5' end, probe 1 was prepared by coupling it to the surface of PCN-224 via amide bonds.

[0011] Hairpin DNA with an amino group modified at the 5' end and a ferrocene group modified at the 3' end was annealed with H2 and then added to Zr-DPA solution to be coupled to the Zr-DPA surface via amide bonds to obtain probe 2.

[0012] In this structure, except for a mismatched base in the middle, all the bases of the Aptamer chain are complementary to a base segment of the Temple chain containing the nicking recognition sequence 5'-CCTCAGC-3'. The mismatched bases are used to make the nicking recognition sequence incompletely complementary, avoiding direct triggering of the Nb.BbvCI nicking enzyme. The Aptamer in the Aptamer-Templet duplex is used to specifically recognize the surface protein of E. coli O157:H7 and release the Temple chain. In the sequence on one side of the 3' end of the nicking recognition sequence, a base segment is complementary to a base segment at the 3' end of the Temple chain to form a hairpin structure. The phi29 polymerase is used to elongate the 3' end of the hairpin structure Temple chain. When the nicking recognition sequence becomes a duplex, it triggers the Nb.BbvCI nicking enzyme to generate a Trigger chain.

[0013] The entire Trigger strand is complementary to a segment of the hairpin DNA H1 in the middle to open its hairpin structure. A segment of the middle hairpin DNA H1 is complementary to a segment of the middle hairpin DNA H2. The sticky end of the opened hairpin DNA H1 will open the hairpin structure of the hairpin DNA H2, thereby realizing the self-assembly of probe 1 and probe 2.

[0014] Preferably, before the hairpin DNA H1 and hairpin DNA H2 are coupled to the surfaces of PCN-224 and Zr-DPA via amide bonds, the PCN-224 and Zr-DPA particles are washed with PBS, centrifuged, and resuspended in PBS solutions containing EDC and NHS for activation. The reaction conditions for amide bond coupling are shaking in the dark until the reaction is complete.

[0015] Preferably, the annealing temperature for all the above annealing treatments is 95°C, annealing for 5 minutes, and then cooling to below 40°C for 1-2 hours after annealing.

[0016] Preferably, in the above sensor, the molar ratio of Aptamer-Templet double strand, probe 1 and probe 2 is 1:1:1.

[0017] Preferably, the above-mentioned PCN-224 and Zr-DPA are synthesized by a hydrothermal method, specifically including the following steps:

[0018] TCPP, ZrOCl2•8H2O, and benzoic acid were dissolved in sufficient DMF in a certain proportion. The mixture was heated in an oil bath at 90°C for 5 hours. After cooling to room temperature, a purple solution was collected, centrifuged, washed three times with DMF, and dried under vacuum at 60°C to obtain PCN-224 powder.

[0019] DPA, ZrOCl2•8H2O, and benzoic acid were dissolved in sufficient DMF according to the specified ratio. The mixture was heated in an oil bath at 100°C for 40 minutes. After cooling to room temperature, the resulting light yellow solution was collected, centrifuged, washed three times with DMF, and dried under vacuum at 60°C to obtain Zr-DPA powder.

[0020] Preferably, from the 5' end to the 3' end, the sequence of hairpin DNA H1 with an amino group modified at the 5' end is NH2-AGCTATGCAGGCAGCCACACACTCATCCTCATGTGTGTGAGGATGAGTG; hairpin DNA with an amino group modified at the 5' end and a ferrocene group modified at the 3' end. The sequence of H2 is NH2-TTTTTTTTTTCATCCTCACACACATGAGGATGAGTGCCTCATGTGTGT-Fc; the sequence of the Temple chain is GCCACACACTCATCCTCAGCACCCATACACGCACCTCACCACGACCAGTGAGGTGCG; the sequence of the Temple' chain after the hairpin-structured Temple chain is elongated by phi29 polymerase is GCCACACACTCATCCTCAGCACCCATACACGCACCTCACCACGACCAGTGAGGTGCGTGTATGGGTGCTGAGGATGAGTGTGTGGC; the sequence of the Trigger chain released by the Temple' chain under the action of Nb.BbvCI nicking enzyme is TGAGGATGAGTGTGTGGC; the sequence of the Aptamer chain is TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGGC.

[0021] Preferably, the preparation process of the probe 1 includes dropping PCN-224 onto a polished glassy carbon electrode, drying it, adding the activation solution, removing the droplet after activation, adding hairpin DNA H1, incubating it, removing the droplet, adding BSA solution to block the unreacted sites on the surface of the nanoparticles, and then removing the droplet.

[0022] Preferably, when using the above sensor, after incubating the Aptamer-Templet duplex with the sample to be tested, the supernatant is collected by centrifugation and mixed with phi29 polymerase, Nb.BbvCI nicking enzyme, and dNTPs for incubation. The mixture is then dropped onto a glassy carbon electrode on which probe 1 has been prepared. After incubation for a certain period of time, probe 2 is dropped onto the glassy carbon electrode. After incubation, the droplets are removed, and the electrochemiluminescence intensity is detected.

[0023] Another technical solution provided by the present invention: a sensor prepared by the above-described preparation method.

[0024] Another technical solution provided by the present invention is the application of the above-mentioned sensor in the detection of Escherichia coli O157:H7.

[0025] Preferably, in the above application, an electrochemiluminescence workstation is used to detect the electrochemiluminescence intensity; the electrolyte is a 0.1M PBS solution with pH=7.4, containing 0.05M K2S2O8 and 0.05M DABCO; the scanning voltage range is -1.3 to 0.9V, and the photomultiplier tube is 800V.

[0026] Compared with the prior art, the beneficial effects of the present invention are:

[0027] This ratiometric electrochemiluminescence biosensor significantly enhances the signal difference between the anode and cathode through cascade amplification via cyclic enzymatic digestion and catalytic self-assembly, achieving a detection limit as low as 1 CFU / mL and a linear range as wide as 10⁻⁶. 0 -10 7 CFU / mL; High stability, precise DNA assembly ensures signal uniformity, suitable for detection of complex biological samples such as serum, milk, orange juice, and lake water; High specificity, aptamers serve as recognition elements, combined with precise assembly of Aptamer-Templet double strands and cyclic enzyme digestion amplification, specifically recognizing E. coli O157:H7, avoiding interference from non-target bacteria; Simple operation, combining nucleic acid self-assembly and electrochemiluminescence detection, the process is relatively simple; In addition, since probe 1 and probe 2 release trigger chains after assembly, their quantity only increases and never decreases. Attached Figure Description

[0028] Figure 1This is a schematic diagram illustrating the construction principle of a cyclic enzymatic digestion amplification cascade catalytic self-assembly ECL sensor. It shows that E. coli O157: H7 triggers the aptamer to release the templet chain, which in turn generates a large number of trigger chains under the action of phi29 polymerase and Nb. BbvCI nicking enzyme. This induces H1 and H2 to undergo a catalytic self-assembly reaction, resulting in the reduction and expansion of the distance between the groups, thus realizing the change in the ratio of electrochemiluminescence between the anode and cathode.

[0029] Figure 2 To verify the DNA assembly process using non-denaturing polyacrylamide gel electrophoresis, including the formation of Aptamer-Templet double helix structure, templet elongation and nicking, trigger chain cycling, and trigger chain-triggered H1 and H2 catalytic self-assembly processes.

[0030] Figure 3 Transmission electron microscopy (TEM), energy dispersive spectroscopy (EDS), and ultraviolet absorption spectroscopy characterization of PCN-224 and Zr-DPA nanoparticles showed that they were uniform in size and regular in shape.

[0031] Figure 4 cv, EIS, and ECL strength during the step-by-step assembly process of the ECL sensor;

[0032] Figure 5 Figures A and B show that the ECL sensor has excellent selectivity for E. coli O157:H7, with high anodic ECL signal and low cathode signal only appearing when E. coli O157:H7 is present. Figures C and D show the detection and analysis of E. coli O157:H7 in actual samples (serum, milk, orange juice, and lake water), demonstrating the feasibility and stability of the ECL sensor in different environments. Figures E and F show the stability verification results of the ECL sensor, with continuous scanning detection showing stable signal and small relative standard deviation.

[0033] Figure 6 The response spectra and linear relationships of the ECL sensor to different concentrations of E. coli O157:H7 are shown, indicating a good linear correlation between the ECL signal intensity and the logarithm of the E. coli O157:H7 concentration. (Left column) Figure 6 The buffer solutions for A, C, and E are 0.1M PBS solutions, as shown in the right column. Figure 6 The buffer solutions for B, D, and F are 10% serum. Detailed Implementation

[0034] The sensor mechanism of this invention is explained as follows:

[0035] DNA functionalized layer: DNA strands, including hairpin probes (H1, H2), are immobilized on the surfaces of PCN-224 and Zr-DPA via EDC / NHS coupling reaction.

[0036] Aptamer-Templet double-stranded structure: a molecular switch for trigger signal amplification.

[0037] Locked state: A stable double-stranded structure is formed by annealing the Aptamer and Temple chains. The 3' end of the Temple chain is complementary to the middle part and can form a hairpin structure. However, after forming a double strand with Aptamer, the complementary part in the middle is locked by the Aptamer chain through base complementary pairing, and cannot form non-specific polymerization. In addition, the nicking active sites on the Temple chain are mismatched with the Aptamer, that is, some are complementary and the other part is unpaired, in order to avoid directly triggering nicking.

[0038] Unlocking mechanism: When E. coli O157:H7 is present, Aptamer recognizes its surface protein and releases a Templet chain (containing the 5'-CCTCAGC-3' sequence). The Templet bends itself to form a hairpin. Due to the exposure of the 5' end, under the action of phi29 polymerase, the Templet will extend along 5'→3' according to the base sequence corresponding to the sticky end and bind to it. When the CCTAGC sequence is completed into a double strand after extension, it triggers Nb.BbvCI nicking enzyme to break the hydrogen bond between the A and G bases. Subsequently, during the continued extension process of phi29 polymerase, a complete Trigger chain is released. The Trigger chain gradually increases, realizing the cyclic amplification of the Trigger chain.

[0039] Self-assembly process: After the trigger chain is released, it binds to probe 1 on the glassy carbon electrode, exposing new sticky ends that autonomously bind to probe 2 and release the trigger chain, thus achieving cyclic amplification.

[0040] Aptamer-specific binding

[0041] We screened aptamers with extremely high affinity for the surface protein of E. coli O157:H7. Their sequences contain two stem-loop structures: one for binding to the surface protein of E. coli O157:H7, and the other for releasing the trigger chain after binding, ensuring that the subsequent reaction is triggered only in the presence of E. coli O157:H7.

[0042] The aptamer sequence was optimized using the exponentially enriched ligand systemic evolution technique (SELEX) to achieve a cross-binding rate of <0.1% for E. coli O157:H7 sensitive strain and a binding rate of <0.05% for Gram-negative bacteria such as Staphylococcus aureus.

[0043] The following embodiments further illustrate the content of the present invention. However, the following embodiments are only some optional implementations of the present invention and should not be regarded as an absolute limitation of this application. In addition, some well-known knowledge in the art is not described in detail in the following embodiments (such as the fact that DNA binding requires the assistance of Mg ions, the specific process of DNA annealing reaction, etc.), which will not cause misunderstanding to those skilled in the art.

[0044] The raw materials, reagents, and instruments used in the following examples are as follows:

[0045] Nanomaterial Synthesis Reagents

[0046] PCN-224 / Zr-DPA Preparation

[0047] 4,4'-(anthracene-9,10-diyl)dibenzoic acid (DPA), meso-tetra(4-carboxyphenyl)porphyrin (TCPP), zirconium oxychloride octahydrate (ZrOCl2·8H2O), zirconium chloride (ZrCl4), benzoic acid (BA), N,N-dimethylformamide (DMF), and 1,4-diazidobicyclo[2.2.2]octane (DABCO) were purchased from Aladdin.

[0048] N-hydroxysuccinimide (NHS) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) were purchased from Adamas-beta. Anhydrous ethanol was purchased from General-Reagent.

[0049] Nucleic acid assembly and modification reagents

[0050] DNA sequences: Temple chain, Temple' chain (the sequence after the Temple chain is extended by phi29 polymerase), Aptamer chain (aptamer), hairpin DNA H1, hairpin DNA H2, Trigger chain. The DNA sequences to be synthesized were all commissioned to Shanghai Sangon Biotech. The specific sequences are shown in Table 1 below. Some sequences contain amino or ferrocene modifications (such as H1 and H2 containing NH2 labeling).

[0051] Table 1 DNA Sequence

[0052]

[0053] As shown in Table 1, the nicking recognition sequence CCTAGC is located at bases 14 to 20 of the 5' end of the Temple; several bases at the 3' end of the Temple are complementary to a segment of bases in the middle; several bases at the 3' end of the hairpin DNA H1 are complementary to a segment of bases in the middle; several bases at the 3' end of the hairpin DNA H2 are complementary to a segment of bases in the middle; the Trigger strand is complementary to a segment of bases in the middle of the hairpin DNA H1, and the middle of the hairpin DNA H1 is complementary to the middle of the hairpin DNA H2; except for a mismatched base segment in the middle, all other bases of the Aptamer strand are complementary to a segment of bases in the Temple strand containing the nicking recognition sequence 5'-CCTCAGC-3'. The mismatched bases are used to make the nicking recognition sequence incompletely complementary, avoiding direct triggering of the Nb.BbvCI nicking enzyme. Specifically, the GA at positions 32 and 33 of the 5' end of the Aptamer strand is a mismatched base. Aptamer is used to recognize proteins on the surface of E. coli O157:H7 and bind to them to release a templet chain. The templet chain then binds to phi29 polymerase and Nb. BbvCI nicking enzyme to generate a trigger chain.

[0054] Phy29 polymerase: final concentration 0.1 U / µL, used to extend the 3' end of a templet hair clip, purchased from New England Biolabs.

[0055] dNTPs: Purchased from Shanghai Sangon Biotech as raw materials for DNA sequence extension.

[0056] Nb.BbvCI nicking enzyme: final concentration 0.25 U / μL, used to cleave the elongated template of phi29 polymerase along the A and G bases of CCTCAGC, purchased from New England Biolabs.

[0057] DNA coupling and activation

[0058] 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC): 20 mM, to activate amino groups on the surface of nanoparticles, purchased from Sigma-Aldrich. N-Hydroxybutadieneimide (NHS): 10 mM, to synergistically couple DNA with EDC, purchased from Sigma-Aldrich. MES buffer: 10 mM, pH 5.5, for the coupling reaction of DNA and nanoparticles, purchased from Sigma-Aldrich. Tris-HCl buffer: 40 mM, pH 8.0, for DNA annealing, purchased from Shanghai Sangon Biotech. Magnesium chloride (MgCl2): 100 mM, to promote DNA strand binding, purchased from Sigma-Aldrich.

[0059] ECL signal source and co-reactant system

[0060] PCN-224: 1 mg / mL, used as an ECL reporter molecule. DMF: Analytical grade, used for nanoparticle synthesis and washing, purchased from Sinopharm Group. Phosphate-buffered saline (PBS): 10 mM, pH 7.4, used for sample dilution and washing. 100 mL of 0.1 M PBS includes 0.24 g potassium dihydrogen phosphate, 1.44 g disodium hydrogen phosphate, 8 g sodium chloride, and 0.2 g potassium chloride. Potassium dihydrogen phosphate was purchased from Sinopharm Group, disodium hydrogen phosphate from Aladdin, and sodium chloride and potassium chloride from GENRAL-REAGENTS.

[0061] Sample processing and quality control reagents

[0062] Bovine serum albumin (BSA): 0.1% w / v, used to block unreacted sites on the surface of nanoparticles, purchased from Sigma-Aldrich.

[0063] Instrument-compatible reagents

[0064] Gel electrophoresis related:

[0065] Polyacrylamide: 6% concentration, used for the preparation of non-denaturing PAGE gels, purchased from Shanghai Sangon Biotech. GelRed dye: 1× concentration, used for DNA electrophoresis staining, purchased from Biotium. TAE buffer: 1× concentration, pH 8.0, used for electrophoretic separation, purchased from Shanghai Sangon Biotech.

[0066] Spectral detection:

[0067] Electrochemical workstation: MPI-B type multi-parameter chemiluminescence analysis and testing system, multi-functional chemiluminescence detector and electrochemical analyzer, electrochemical workstation CHI760E.

[0068] Ultrapure water: resistivity ≥18.2 MΩ・cm, used for reagent preparation and instrument cleaning, prepared by an ultrapure water purification system (Hefei Shengjue Technology SJ-CS-1).

[0069] Example 1

[0070] Step 1: Preparation of PCN-224

[0071] 10 mg TCPP, 30 mg ZrOCl2·8H2O and 280 mg benzoic acid were dissolved in 10 mL DMF, heated in an oil bath at 90 °C for 5 h, and after cooling to room temperature, a purple solution was collected. The solution was centrifuged, washed three times with DMF, and dried under vacuum at 60 °C to obtain PCN-224 powder.

[0072] Step 2: Preparation of Zr-DPA

[0073] 20.9 mg DPA, 10 mg ZrOCl2·8H2O and 100 mg benzoic acid were dissolved in 20 mL DMF, heated in an oil bath at 100 °C for 40 min, cooled to room temperature, and the resulting light yellow solution was collected, centrifuged, washed three times with DMF, and dried under vacuum at 60 °C to obtain Zr-DPA powder.

[0074] Step 3: Preparation of DNA Functionalized Probes

[0075] Probe 1 (PCN-224-H1):

[0076] Anneal 10 μM H1 at 95 °C for 5 min in a constant temperature metal bath, and then slowly cool down after annealing. Weigh PCN-224 particles and prepare a solution containing 20 mM EDC and 10 mM NHS at 1 mg / mL. Add the solution to a polished GCE, let it stand and dry, then add 10 μL of 3 µM hairpin DNA (H1) and incubate at 37 °C for 30 min in a biological incubator to couple H1 to the surface of the nanoparticles via amide bonds.

[0077] Probe 2 (Zr-DPA-H2):

[0078] Anneal 10 µM H2 at 95 °C for 5 min in a constant temperature metal bath. After annealing, slowly cool down and weigh Zr-DPA particles. Perform the same operation as in the preparation of probe 1. Add EDC / NHS for activation and incubate with H2 at 37 °C for 30 min in a biological incubator to couple H2 to the surface of the nanoparticles via amide bonds.

[0079] Results Test

[0080] Transmission electron microscopy (TEM) observation: PCN-224 particles are approximately 100 nm in diameter, spherical in shape, and uniformly dispersed. Figure 3 A). Zr-DPA particles are approximately 100 nm in diameter, described as spherical, and uniformly dispersed. Figure 3 B).

[0081] Energy-dispersive X-ray spectroscopy (EDS) analysis: Elemental composition: C (%), O (%), Zr (%), confirming the successful synthesis of PCN-224. Elemental distribution: C, O, and Zr signals are uniformly distributed. Figure 3 C).

[0082] X-ray diffraction analysis: Figure 3 Figure D shows the XRD patterns of Zr-DPA and PCN-224, proving their successful synthesis.

[0083] Fourier transform infrared spectroscopy analysis: Figure 3E indicates that the C–O peak value is 1419 cm⁻¹ when synthesized as Zr-DPA. -1 Zr was displayed 4+ The coordination of the DPA-containing carboxyl group is shown. C-OH (1257 cm⁻¹) -1 The asymmetric vibration absorption intensity of ) decreased significantly and C=O (1656cm) -1 The group in PCN-224 is relative to the group in the TCPP ligand. Furthermore, 663 cm -1 The presence of Zr-O bonds corresponding to characteristic vibration peaks indicates that Zr... 6+ The coordination between TCPP and −COOH groups further confirms the successful preparation of the PCN-224 sample.

[0084] Ultraviolet-Vis spectroscopy analysis: Figure 3 F and G are the UV absorption characteristic peaks of Zr-DPA and PCN-224, respectively, proving their successful synthesis.

[0085] Example 2

[0086] Sample preprocessing

[0087] Bacterial sample (PBS buffer): Take 100 µL of sample and spike with E. coli O157:H7 at a concentration of 1 x 10⁻⁶. 7 Centrifuge at 12000 rpm for 10 minutes at CFU / mL, and collect the supernatant for later use.

[0088] Environmental samples (e.g., wastewater): Take 100 µL of sample and spike with E. coli O157:H7 at a concentration of 1 x 10⁻⁶. 7 CFU / mL was filtered through a 0.22 μm filter membrane to remove large particulate impurities, diluted 10 times with PBS, and the pH was adjusted to 7.4.

[0089] Aptamer-Templet structure preparation

[0090] Mix Aptamer (100 µM, 10 µL), Temple (100 µM, 10 µL), and 10 mM Mg 2+ Anneal at 95℃ for 5 minutes, then slowly cool down to below 40℃ over 1-2 hours to form a stable double-chain structure.

[0091] Construction of Trigger Chain Release and Cyclic Enzymatic Digestion Amplification Reaction System

[0092] E. coli O157:H7 recognition: 50 µL of pretreated bacterial sample and 10 µL of 10 mM Aptamer-Templet duplex were mixed and incubated in a 37°C metal bath for 120 minutes, gently inverting every 30 minutes to avoid precipitation. Centrifugation was performed, and the supernatant was collected to obtain the released templet chain (containing the CCTAGC sequence). 10 mM Mg was added. 2+ 0.1 U / μL phi29 polymerase, 0.25 U / μL Nb.BbvCI nicking enzyme, 4 μM dNTP, and 40 mM TAE buffer were added and incubated at 37°C for 2 h in a biological incubator. The Nb.BbvCI nicking enzyme can cyclically nick the elongated template chains of phi29 polymerase to achieve cyclic amplification and obtain a template reaction solution containing a large number of trigger chains.

[0093] Nanoparticle self-assembly

[0094] The Trigger chain was gradually mixed with Probe 1 and Probe 2 at a volume ratio of 1:1:1, and 10 mM Mg was added. 2+ Solution.

[0095] The trigger chain recognizes the sticky end on probe 1, opens the hairpin structure of probe 1, and exposes a new sticky end, thereby continuing to recognize probe 2 and release the trigger chain. The released trigger chain continues to participate in the reaction, recognizing the sticky end of probe 1 and opening its hairpin structure.

[0096] Experimental results

[0097] observe Figure 2 The formation of the Aptamer-Templet double-stranded structure and the trigger chain cycling process were verified. Compared with channels 1 and 2, a new band appeared in channel 7 and its position was higher than both, proving that the Aptamer and Templet chains successfully bound to form a double-stranded structure. Observation of channels 7-9 revealed that the bands migrated slightly downwards, which is due to the influence of proteins such as phi29 polymerase and Nb.BbvCI nicking enzyme on the band position. Comparison of channels 4 and 10 revealed that a band with a slightly higher migration rate than the double-stranded structure in channel 4 appeared below channel 10, indicating that the DNA reaction produced a trigger chain, which could bind to the hairpin structure of probe 1 as expected. Channels 11-13 verified whether probe 1 and probe 2 could self-assemble in the presence or absence of the trigger chain. The results showed that probe 1 and probe 2 could not self-assemble when the trigger chain was absent. Only when the analyte was present would cyclic enzymatic digestion occur to generate the trigger chain, thereby initiating the self-assembly of probe 1 and probe 2.

[0098] Example 3

[0099] Construction and Testing of ECL Sensors

[0100] Construction of sensor key points

[0101] Method: Take 6 polished GCE samples and label them sequentially:

[0102] a:GCE is not modified in any way;

[0103] b: Add 10 μL of 1 mg / mL PCN-224 solution to GCE and allow it to stand and dry;

[0104] c: Add 10 μL of 1 mg / mL PCN-224 solution to GCE, dry it, add 10 μL of solution containing 20 mM EDC and 10 mM NHS, remove the drop after 15 min, add 10 μL of 3 μM hairpin DNA H1, incubate at 37°C in a biological incubator for 30 min, and then remove the drop.

[0105] d: Add 10 μL of 1 mg / mL PCN-224 solution to GCE, dry it, add 10 μL of solution containing 20 mM EDC and 10 mM NHS, remove the drop after 15 min, add 10 μL of 3 μM hairpin DNA H1, incubate at 37°C in a biological incubator for 30 min, remove the drop, add 3 μL of 0.1% wt BSA solution, remove the drop after 15 min;

[0106] e: Add 10 μL of 1 mg / mL PCN-224 solution to the GCE, dry it, then add 10 μL of a solution containing 20 mM EDC and 10 mM NHS. After 15 min, remove the droplets. Add 10 μL of 3 μM hairpin DNA H1, incubate at 37°C for 30 min, then remove the droplets. Add 3 μL of 0.1% wt BSA solution, and remove the droplets after 15 min. Separately, take Temple chain, phi29 polymerase, Nb.BbvCI nicking enzyme, and dNTPs, and adjust the volume to make the final volume of the above mixed solution 10 μL, with final concentrations of 3 μM, 0.1 U / μL, 0.25 U / μL, and 4 μM, respectively. Incubate for 2 h. Then, add the above solution to the GCE treated above and incubate at 37°C for 30 min.

[0107] f: Add 10 μL of 1 mg / mL PCN-224 solution to the GCE, dry it, then add 10 μL of a solution containing 20 mM EDC and 10 mM NHS. After 15 min, remove the droplet, add 10 μL of 3 μM hairpin DNA H1, incubate at 37°C for 30 min, remove the droplet, and add 3 μL of 0.1% wt% After 15 min of BSA solution preparation, the droplets were discarded. Separately, Temple chain, phi29 polymerase, Nb.BbvCI nicking enzyme, and dNTPs were prepared and diluted to a final volume of 10 μL, with final concentrations of 3 μM, 0.1 U / μL, 0.25 U / μL, and 4 μM, respectively. The mixture was incubated for 2 h. Then, the solution was added dropwise to the treated GCE and incubated at 37°C for 30 min. Finally, 10 μL of the prepared 3 μM probe 2 was added dropwise to the GCE obtained after step e, and incubated at 37°C for 30 min. The droplets were then discarded.

[0108] The electrodes that have undergone the above treatment are placed in an electrolytic cell to detect the ECL signal.

[0109] Parameter settings: Photomultiplier tube 800V, voltage range -1.3 to 0.9V, co-reactant system includes 0.1M PBS solution, 0.05M K2S2O8, and 0.05M DABCO.

[0110] The intensity of the electrochemiluminescence signal at the anode and cathode was detected using the software provided with the electrochemical workstation.

[0111] CV and EIS curve data acquisition

[0112] Take the GCE treated with the above af and place it in an electrolytic cell. Use an electrochemical workstation and supporting software to detect and record the cv and EIS curves.

[0113] The solution in the electrolytic cell consists of 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, and 0.1 M potassium chloride.

[0114] Experimental results: such as Figure 4 As shown in A and B, since a has not undergone any modification, the current is the largest and the impedance is the smallest; as the materials and DNA are gradually modified, the total impedance of the system gradually increases and the current gradually decreases (curve af).

[0115] like Figure 4 As shown in C and D, the background signal of the system is extremely low when it is not modified (curve a). With the modification of PCN-224, the system shows an ECL cathode signal (curve b). The ECL intensity does not differ significantly when the modification is performed later (curve ce). When probe 2 is modified on it, the cathode ECL intensity of the system is greatly reduced, and a strong anode ECL signal appears at the same time (curve f).

[0116] Example 4

[0117] Linear equation verification

[0118] Method: Take 8 PCR tubes, label them sequentially, and add 1 mL of 1x10⁻¹ PCR solution to each tube. 0 ~1x10 7 (CFU / mL) E. coli O157: H7, then add (1 mL, 10 mM) Aptamer-Templet duplex to each tube, incubate together for 1 h, centrifuge and take the supernatant to obtain the Temple chain, then process according to the method in Example 3f, the treatment conditions of the 8 samples are kept the same except for the bacterial concentration, and the ECL signal intensity is recorded.

[0119] Experimental results:

[0120] Figure 6 As shown in A, C, and E, the ECL signal intensity in PBS buffer solution showed a good correlation with the concentration of E. coli O157:H7. In the quantitative study, at 10... 0 ~10 7 Within a wide linear range of CFU / mL, the ECL signal intensity (y) exhibits a linear relationship with the logarithm of bacterial concentration (lgC): y = 0.2 * lgC - 0.454 (R0). 2 =0.99948), and the sensor detection limit (LOD) is 1 CFU / mL. Figure 6 As shown in B, D, and F, in 10% serum, the ECL signal intensity showed a good correlation with the concentration of E. coli O157:H7. In the quantitative study, in 10% serum... 0 ~10 7 Within a wide linear range of CFU / mL, the ECL signal intensity (y) exhibits a linear relationship with the logarithm of bacterial concentration (lgC): y = 0.23104 * lgC - 0.63072 (R0). 2 =0.99967), compared to existing ECL sensor systems, this platform exhibits a lower detection limit and a wider dynamic monitoring range.

[0121] Example 5

[0122] Stability verification

[0123] Method: Add 1 mL of 10 mM Aptamer-Templet double strand to (1 mL, 10 mM) Aptamer-Templet double strand. 7 After co-incubating with CFU / mL E. coli O157: H7 for 1 h, the supernatant was collected by centrifugation to obtain the Temple chain. The sample was then processed according to the method in Example 3, and the ECL signal intensity was recorded for 15 consecutive scans.

[0124] Experimental results: such as Figure 5 As shown in E and F, after 15 consecutive scans of the voltage range, the ECL signal strength remained basically consistent, with a relative deviation (RSD) of 2.59%, which effectively demonstrates that the number of scans has little impact on the sensor.

[0125] Example 6

[0126] 1. Actual sample testing

[0127] To verify the detection performance of the ratiometric electrochemiluminescence biosensor based on enzyme digestion cycle amplification and catalytic hairpin self-assembly in complex real-world samples, spiked experiments were conducted using four representative matrices: serum, milk, orange juice, and lake water. The specific steps and results are as follows:

[0128] Sample types and preprocessing:

[0129] Serum samples: Take 10% fetal bovine serum, ultrafilter and centrifuge at 10 kDa (14,000 rpm, 10 minutes) to remove large molecular proteins, and dilute with PBS to a concentration of 1% (to reduce matrix interference).

[0130] Milk sample: Commercially available whole milk was diluted 1:10 and filtered through a 0.22 μm filter membrane to remove fat particles.

[0131] Orange juice sample: Take commercially available orange juice, centrifuge at high speed (12,000 rpm, 5 minutes) to remove orange pulp, and keep the supernatant for later use.

[0132] Lake water samples: Lake water was collected, filtered through double-layer gauze, and the pH was adjusted to 7.4 with PBS and diluted 20 times to reduce ionic strength.

[0133] The above four samples, as well as the blank sample with 0.1M PBS buffer, were all spiked to a final concentration of 10. 7 E. coli O157:H7 CFU / mL;

[0134] 2. Specific recognition of E. coli O157:H7

[0135] Methods: Six blank samples were prepared using 0.1M PBS buffer. Four non-target bacteria were prepared: Gram-positive bacteria *S. enteritidis* and *B. subtilis*, and Gram-negative bacteria *MRSA* and *S. typhimurium*, as well as the detection bacterium *E. coli* O157:H7. Five standard strains were added separately to each of the five samples. The last sample was a mixture of all five standard strains. The final concentration of each strain in the six samples was 10 μL.7 CFU / mL;

[0136] Detection procedure: Take 1 mL of each of the 11 spiked samples, add (1 mL, 10 mM) Aptamerr-Templet double strand, process them according to Example 5, and then perform ECL signal detection and record the data according to Example 3.

[0137] Test results

[0138] ECL signal strength: such as Figure 5 As shown in Figures A and B, among the six samples, only the E. coli O157:H7 and mixed samples showed higher anodic ECL signals and lower cathodic ECL signals, while the ECL signals in the remaining samples were consistent with those in the blank sample. This indicates that the ECL biosensor has excellent specificity and selectivity for E. coli O157:H7. Figure 5 As shown in C and D, the ECL biosensor exhibits significant consistency across a variety of real-world samples, including milk, orange juice, lake water, 10% serum, and PBS buffer, highlighting its superior anti-interference capabilities and environmental stability.

[0139] The above embodiments demonstrate that the ECL sensor of the present invention (including Aptamer, Temple, phi29 polymerase, Nb.BbvCI nicking enzyme, probe 1, and probe 2) not only has an extremely low detection limit for E. coli O157:H7 in samples, but also 10 0 ~10 7 The sensor exhibits a wide linear range of CFU / mL, and its detection limit is significantly superior to existing methods mentioned in the background section. Furthermore, the sensor demonstrates excellent anti-interference capabilities and good selectivity in complex matrices of real samples. In addition, the sensor exhibits excellent stability and reproducibility, demonstrating reliable application performance in practical detection scenarios.

[0140] The above are merely preferred embodiments of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. For example, although the Aptamer-Templet double strand, probe 1, and probe 2 of the ECL sensor in the embodiments are all in equimolar ratio, this is only for the best effect; slightly more or less can also be used. Although the final concentrations of phi29 polymerase and Nb.BbvCI nicking enzyme are 0.1 U / µL and 0.25 U / µL, respectively, their polymerization and nicking efficiencies are high, and the dosage can be adjusted appropriately. The cooling of the annealing treatment can also be adjusted appropriately, for example, cooling to room temperature by 1°C / 30s. Therefore, the scope of protection of the present invention should be determined by the scope defined in the claims.

[0141] Any aspects of this invention not described in detail are well-known to those skilled in the art.

Claims

1. A method for preparing a ratiometric electrochemiluminescence biosensor, characterized in that: The sensor includes Aptamer-Templet duplex, phi29 polymerase, Nb.BbvCI nickase, probe 1, and probe 2; The preparation methods for Aptamer-Templet duplexes, probe 1, and probe 2 include: The Templet chain and Aptamer chain are mixed and annealed to obtain the Aptamer-Templet duplex; After annealing hairpin DNA H1 with an amino group modified at the 5' end, probe 1 was prepared by coupling it to the surface of PCN-224 via amide bonds. Hairpin DNA with an amino group modified at the 5' end and a ferrocene group modified at the 3' end was annealed with H2 and then added to Zr-DPA solution to be coupled to the Zr-DPA surface via amide bonds to obtain probe 2. In this structure, except for a mismatched base in the middle, all the bases of the Aptamer chain are complementary to a base segment of the Temple chain containing the nicking recognition sequence 5'-CCTCAGC-3'. The mismatched bases are used to make the nicking recognition sequence incompletely complementary, avoiding direct triggering of the Nb.BbvCI nicking enzyme. The Aptamer in the Aptamer-Templet duplex is used to specifically recognize the surface protein of E. coli O157:H7 and release the Temple chain. In the sequence on one side of the 3' end of the nicking recognition sequence, a base segment is complementary to a base segment at the 3' end of the Temple chain to form a hairpin structure. The phi29 polymerase is used to elongate the 3' end of the hairpin structure Temple chain. When the nicking recognition sequence becomes a duplex, it triggers the Nb.BbvCI nicking enzyme to generate a Trigger chain. The entire Trigger strand is complementary to a segment of the hairpin DNA H1 in the middle to open its hairpin structure. A segment of the middle hairpin DNA H1 is complementary to a segment of the middle hairpin DNA H2. The sticky end of the opened hairpin DNA H1 will open the hairpin structure of the hairpin DNA H2, thereby realizing the self-assembly of probe 1 and probe 2.

2. The method for preparing a ratiometric electrochemiluminescence biosensor according to claim 1, characterized in that: Before hairpin DNA H1 and hairpin DNA H2 are coupled to the surfaces of PCN-224 and Zr-DPA via amide bonds, the PCN-224 and Zr-DPA particles are washed with PBS, centrifuged, and then resuspended in PBS solutions containing EDC and NHS for activation. The reaction conditions for amide bond coupling are shaking in the dark until the reaction is complete.

3. The method for preparing a ratiometric electrochemiluminescence biosensor according to claim 1, characterized in that: The annealing temperature is 95°C, and the annealing time is 5 minutes. After the annealing, the temperature is reduced to below 40°C for 1-2 hours.

4. The method for preparing a ratiometric electrochemiluminescence biosensor according to claim 1, characterized in that: In the sensor, the molar ratio of Aptamer-Templet double strand, probe 1, and probe 2 is 1:1:

1.

5. The method for preparing a ratiometric electrochemiluminescence biosensor according to claim 1, characterized in that, The PCN-224 and Zr-DPA are synthesized by a hydrothermal method, specifically including the following steps: TCPP, ZrOCl2•8H2O, and benzoic acid were dissolved in sufficient DMF in a certain proportion. The mixture was heated in an oil bath at 90°C for 5 hours. After cooling to room temperature, a purple solution was collected, centrifuged, washed three times with DMF, and dried under vacuum at 60°C to obtain PCN-224 powder. DPA, ZrOCl2•8H2O, and benzoic acid were dissolved in sufficient DMF according to the specified ratio. The mixture was heated in an oil bath at 100°C for 40 minutes. After cooling to room temperature, the resulting light yellow solution was collected, centrifuged, washed three times with DMF, and dried under vacuum at 60°C to obtain Zr-DPA powder.

6. The method for preparing a ratiometric electrochemiluminescence biosensor according to claim 1, characterized in that: From the 5' end to the 3' end, the sequence of hairpin DNA H1 with an amino group modified at the 5' end is NH2-AGCTATGCAGGCAGCCACACACTCATCCTCATGTGTGTGAGGATGAGTG; the sequence of hairpin DNA H2 with an amino group modified at the 5' end and a ferrocene group modified at the 3' end is NH2-TTTTTTTTTTCATCCTCACACACATGAGGATGAGTGCCTCATGTGTGT-Fc. The sequence of the Templet chain is GCCACACACTCATCCTCAGCACCCATACACGCACCTCACCACGACCAGTGAGGTGCG; the sequence of the Temple' chain, which is elongated by the hairpin-structured Temple chain under the action of phi29 polymerase, is GCCACACACTCATCCTCAGCACCCATACACGCACCTCACCACGACCAGTGAGGTGCGTGTATGGGTGCTGAGGATGAGTGTGTGGC; the sequence of the Trigger chain released by the Temple' chain under the action of Nb.BbvCI nicking enzyme is TGAGGATGAGTGTGTGGC; the sequence of the Aptamer chain is TGGTCGTGGTGAGGTGCGTGTATGGGTGGTGGATGAGTGTGTGGC.

7. The method for preparing a ratiometric electrochemiluminescence biosensor according to claim 2, characterized in that: The preparation process of probe 1 includes dropping PCN-224 onto a polished glassy carbon electrode, drying it, adding the activation solution, removing the droplet after activation, adding hairpin DNA H1, incubating it, removing the droplet, adding BSA solution to block unreacted sites on the surface of the nanoparticles, and then removing the droplet. When using the sensor, after incubating the Aptamer-Templet duplex with the sample to be tested, the supernatant is collected by centrifugation and mixed with phi29 polymerase, Nb.BbvCI nicking enzyme, and dNTPs for incubation. The mixture is then dropped onto a glassy carbon electrode on which probe 1 has been prepared. After incubation for a certain period of time, probe 2 is dropped onto the glassy carbon electrode. After incubation, the droplets are removed, and the electrochemiluminescence intensity is detected.

8. A sensor prepared by the method according to any one of claims 1 to 7.

9. The application of the sensor as described in claim 8 in the detection of Escherichia coli O157:H7.

10. The application according to claim 9, characterized in that: Electrochemiluminescence intensity was detected using an electrochemiluminescence workstation; the electrolyte was 0.1M PBS solution, pH=7.4, containing 0.05M K2S2O8 and 0.05M DABCO; the scanning voltage range was -1.3 to 0.9V, and the photomultiplier tube was 800V.

Images