Method for detecting intact, viable pathogens in a sample

By combining specific immunomagnetic beads with a microfluidic chip, using membrane-impermeable dyes to suppress nucleic acid signals from inactive pathogens, and combining this with isothermal nucleic acid amplification technology, the problems of missing activity assessment and limited detection throughput in existing pathogen detection technologies have been solved, enabling rapid and sensitive pathogen detection.

CN122128470APending Publication Date: 2026-06-02STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
Filing Date
2026-02-04
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing pathogen detection technologies cannot effectively distinguish between live and non-live pathogens, leading to false positive results and diagnostic delays. Furthermore, they have low throughput, complex and time-consuming processes, making it difficult to achieve rapid diagnosis and on-site application.

Method used

By combining specific immunomagnetic beads with microfluidic chips, pathogens are specifically captured by antibodies, and membrane-impermeable dyes are used to inhibit the nucleic acid signals of inactive pathogens. Combined with isothermal nucleic acid amplification technology, rapid and sensitive pathogen detection is achieved.

Benefits of technology

It enables efficient, rapid, and automated detection of live pathogens, improving detection sensitivity and throughput, and is suitable for resource-limited field environments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention relates to the field of biotechnology and discloses a method for detecting intact, live pathogens in samples. The invention provides a rapid detection method for intact, live pathogens based on specific immunomagnetic beads and microfluidic chips, and constructs an automated, multiplexed detection system. Its core lies in combining three key steps—"specific capture of intact pathogens," "active signal screening," and "rapid and sensitive detection"—with a microfluidic chip technology platform. This transforms the protein signal of antigen-antibody binding into a nucleic acid amplification signal, improving sensitivity and enabling direct, rapid, and accurate identification of infectious live pathogens from complex samples, thus demonstrating broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a method for detecting intact active pathogens in a sample. BACKGROUND

[0002] Currently, pathogen detection technologies mainly develop around two core strategies: nucleic acid detection and antigen / antibody detection, but these mainstream methods all have the fundamental defect of judging the "activity" and "infectivity" of pathogens.

[0003] Nucleic acid detection technology (PCR, isothermal amplification): with high sensitivity, it takes the characteristic gene fragment of the pathogen as the target. However, this method cannot distinguish whether the nucleic acid is derived from living microorganisms, dead bacteria lysate fragments, or long-term stable free nucleic acid in the environment. After the patient recovers or the environment is disinfected, the residual nucleic acid can cause "false positive" results for a long time, seriously affecting the accurate assessment of current infection and transmission risk.

[0004] Antigen detection technology: through the capture of specific proteins on the surface of pathogens for detection, although it is simple and fast to operate, it cannot confirm the integrity and physiological activity of the pathogen structure. Degraded protein fragments can also produce positive signals.

[0005] Cell culture method: as the "gold standard" for judging microbial activity, it confirms its infectivity by observing the growth of pathogens in cultured cells or culture medium. However, this method is time-consuming (several days to several weeks), complex to operate, and has low throughput, and many pathogens are difficult to culture in vitro, which cannot meet the needs of rapid diagnosis in clinical practice and public health emergency response.

[0006] The existing technology at least has the following core pain points: Lack of activity judgment: mainstream molecular diagnostic methods (nucleic acid, antigen) cannot effectively distinguish between active pathogens with infectivity and residual substances without infectivity, leading to interference in clinical decision-making and waste of public health resources.

[0007] Detection throughput is limited: most high-sensitivity methods (such as qPCR) are usually targeted at a single or a few pathogens, and in the face of similar symptoms but diverse pathogens in clinical situations (such as respiratory tract infections, diarrhea), it is easy to cause missed detection and delayed diagnosis.

[0008] Complex process and time-consuming: from sample processing, nucleic acid extraction to amplification detection, the steps are tedious and require professional operation. Cell culture method is too time-consuming and cannot be used for rapid diagnosis.

[0009] Lack of integrated platform: the existing technology that combines enrichment, activity identification, and amplification detection is often composed of multiple independent devices and non-consecutive steps, which is cumbersome and difficult to achieve "sample in, result out" on-site and automated application.

[0010] Limited application scenarios: Existing technologies are highly dependent on laboratory environments and instruments, making them difficult to deploy effectively in scenarios with limited resources or requiring rapid response, such as primary healthcare institutions, field epidemiological investigations, and port quarantine. Summary of the Invention

[0011] The purpose of this invention is to provide a method for detecting intact, live pathogens in a sample.

[0012] To achieve the objectives of this invention, in a first aspect, the invention provides a method for detecting intact, live pathogens in a sample (including non-disease diagnostic and therapeutic purposes), comprising the following steps: (1) The sample to be tested is brought into contact with specific immunomagnetic beads to form a magnetic bead-pathogen complex; wherein the specific immunomagnetic beads are coupled with a capture antibody that can specifically bind to the surface antigen of the pathogen; (2) Treat the magnetic bead-pathogen complex with a membrane-impermeable nucleic acid intercalation dye and activate the dye to inhibit the amplification of nucleic acids from pathogens with damaged membrane structures in subsequent steps; (3) The magnetic bead-pathogen complex treated in step (2) is lysed to release the nucleic acid in the intact active pathogen; (4) The released nucleic acid is amplified and detected to determine whether the intact active pathogen exists in the sample to be tested.

[0013] Furthermore, step (4) employs isothermal nucleic acid amplification technology (such as RAA) for amplification and detection.

[0014] Furthermore, the membrane-impermeable nucleic acid intercalation dye in step (2) is a photoactivated dye, and activating the dye includes irradiating the dye with light.

[0015] Preferably, the photoactivated dye is propidium azide (PMAxx).

[0016] Furthermore, the method is used to detect multiple pathogens simultaneously by using multiple specific immunomagnetic beads coupled with capture antibodies against different pathogens, and by using multiple sets of amplification primers and / or probes against the nucleic acids of different pathogens in step (4).

[0017] In one specific embodiment of the present invention, the pathogens are adenovirus type 3 and Mycoplasma pneumoniae. The capture antibody corresponding to adenovirus type 3 is monoclonal antibody 01 (purchased from Jiangsu Ningpu Medical Technology Co., Ltd., batch number: 22110301), and the capture antibody corresponding to Mycoplasma pneumoniae is monoclonal antibody 02 (purchased from Jiangsu Ningpu Medical Technology Co., Ltd., batch number: 24052201).

[0018] Preferably, the RAA primer and probe sequences used for amplifying adenovirus type 3 are (5′-3′): Adv-3-F:ATTCCGGCACAGCTTACAATTCACTCGCTCC; Adv-3-R: TCAGTAGTGGTAATGTCTTTCCCAATTTGC; AdV3-P:ACAATGCAGTAACTACCACCACAAACACA[FAM-dT][THF][BHQ-dT]GGCATTGCTTCCAT[C3-spacer].

[0019] Preferably, the RAA primer and probe sequences used for amplifying Mycoplasma pneumoniae are (5′-3′): MP-F: CAACGCACCCTACTTCCACAATAACCC; MP-R:GTGAGCTTATTGGACCAGTTGTATAACCTGT MP-P: AGCCCTGAGAGGACAAGAACGGTAAGGA[FAM-dT]G[THF][BHQ-dT]GCCAAATACATCTA[C3-spacer].

[0020] In a second aspect, the present invention provides a system for detecting intact, live pathogens in a sample, comprising: (a) Specific immunomagnetic beads for binding with pathogens in a sample to form a magnetic bead-pathogen complex; wherein the specific immunomagnetic beads are coupled with a capture antibody capable of specifically binding to the surface antigen of the pathogen; (b) Membrane-impermeable nucleic acid intercalating dyes, used to selectively enter pathogens with damaged membrane structures and bind to their nucleic acids; (c) An activation device for activating the dye to inhibit nucleic acid amplification of pathogens with damaged membrane structures; and, (d) A microfluidic chip, wherein the microfluidic chip integrates a pyrolysis unit, a reaction unit and a detection unit; The lysis unit is used to lyse the intact active pathogen in the magnetic bead-pathogen complex to release nucleic acid. A reaction unit for amplifying the released nucleic acid; The detection unit is used to detect the amplification products.

[0021] Furthermore, the microfluidic chip has a disk-shaped structure, the reaction unit includes one or more fan-shaped reaction chambers, and the reaction unit is pre-filled with lyophilized isothermal nucleic acid amplification reagents.

[0022] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: This invention provides a complete rapid detection method for live pathogens based on specific immunomagnetic beads and microfluidic chips, and constructs an automated, multiplexed detection system. Its core lies in combining three key links—"complete pathogen-specific capture," "active signal screening," and "rapid and sensitive detection"—with a microfluidic chip technology platform. This transforms the protein signal of antigen-antibody binding into a nucleic acid amplification signal, improving sensitivity, thereby enabling direct, rapid, and accurate identification of infectious live pathogens from complex samples, and has broad application prospects.

[0023] (i) Highly efficient and specific front-end enrichment based on immunomagnetic separation In the sample pretreatment stage, immunomagnetic beads (such as protein A beads) with high-affinity and high-specificity monoclonal antibodies conjugated to their surfaces are introduced.

[0024] After the magnetic beads are mixed with the sample, the antibodies on their surface specifically bind to the antigenic epitopes on the surface of the target pathogen, forming "magnetic bead-pathogen" complexes (SIMBs). Under the influence of an external magnetic field, these complexes are rapidly enriched and separated from other sample matrices (such as cell debris, inhibitors, and free nucleic acids). This step not only significantly improves detection sensitivity (especially for low-load samples) but also purifies the target analyte, laying a clean reaction foundation for subsequent steps. Most importantly, the antibodies capture intact pathogen particles with complete surface structures, locking onto the target from the very first step.

[0025] (II) Active signal gating and selective inhibition based on PMAxx After enrichment with magnetic beads, propidium azide (PMAxx) dye is introduced for treatment, followed by photoactivation.

[0026] PMAxx is a membrane-impermeable photoreactive dye. It can penetrate dead pathogens with compromised membrane integrity and embed itself in their DNA / RNA. Under strong light irradiation, PMAxx is photoactivated, undergoing irreversible covalent cross-linking with nucleic acids, thereby completely inhibiting the signal of these nucleic acids in subsequent amplification reactions. For live pathogens with intact membrane structures, PMAxx cannot penetrate, and their internal nucleic acids remain unaffected. This step acts as a "molecular switch," selectively eliminating the background signal of dead bacteria / free nucleic acids at a chemical level before nucleic acid release, ensuring that the final detection signal originates only from intact live pathogens.

[0027] (III) Automation of Nucleic Acid Extraction and Amplification Based on Microfluidic Chips with RAA Isothermal Amplification A multilayer polymer microfluidic chip was designed and constructed, which integrates microvalve, micropump, mixing chamber, separation chamber, reaction chamber and detection chamber.

[0028] Microfluidic technology miniaturizes and integrates macroscopic sample processing, reagent reactions, and detection steps onto a chip. This microfluidic chip integrates RAA technology, enabling rapid detection of intact MP and Adv-3 particles. After specific immune capture via SIMBs, intact virus or bacterial particles are separated by magnetic separation. Fluid movement within the chip is driven by negative pressure, facilitating the transfer of analytes to designated RAA reaction chambers for amplification and detection. Under isothermal conditions, the antigen-antibody interaction between SIMBs and intact pathogen particles is converted into nucleic acid amplification signals, significantly improving detection sensitivity. Based on intact particle recognition, this system enables rapid simultaneous detection of single or dual pathogens. During chip fabrication, lyophilized RAA reagents for each target are pre-loaded and sealed in independent detection chambers. The number and types of targets can be customized according to diagnostic needs. RAA technology utilizes recombinases, single-stranded DNA-binding proteins, and strand-displacement DNA polymerases to achieve rapid (5-20 minutes) efficient exponential amplification of nucleic acid targets at isothermal conditions (typically 37-42°C), eliminating the need for complex thermal cycling modules (PCR instruments). This significantly reduces the system's power consumption and thermal control complexity, making it ideal for integration with microfluidic chips for portable or field-based detection devices. Amplified products can be monitored in real time via a fluorescence detection module integrated at the bottom of the chip's reaction chamber.

[0029] (iv) Flexible design supporting multiple detection Dual detection is achieved through two pathways: 1) Preparation of specific immunomagnetic beads: screening for antibodies with high affinity and conjugating them with protein A magnetic beads; 2) Reaction solution multiplexing: using multiple sets of RAA primers targeting different targets in the reaction chamber.

[0030] This design breaks through the limitation of traditional methods that only detect a single target in a single test, enabling the identification of two or more possible pathogens in a single test, thus improving diagnostic efficiency and coverage, and is especially suitable for infectious diseases with complex etiologies. Attached Figure Description

[0031] Figure 1 This is a schematic diagram of the SIMBs preparation process in a preferred embodiment of the present invention.

[0032] Figure 2 The results of the sensitivity and specificity study of the microfluidic system in a preferred embodiment of the present invention are shown.

[0033] Figure 3 The results of optimizing the single-detection PMAxx concentration and the amount of magnetic beads added are shown in the preferred embodiment of the present invention.

[0034] Figure 4 This is the result of optimizing single-detection exposure and incubation time in a preferred embodiment of the present invention.

[0035] Figure 5 This is the optimized result of dual detection in a preferred embodiment of the present invention.

[0036] Figure 6 Clinical sample chip test results in a preferred embodiment of the present invention. Detailed Implementation

[0037] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0038] Example 1: A Complete Rapid Detection Method for Active Pathogens Based on Specific Immunomagnetic Beads and Microfluidic Chips 1. Preparation of specific immunomagnetic beads Antibody concentrations were determined using a BCA protein assay kit. Quantitative amounts of adenovirus type 3 (Adv-3) monoclonal antibody 01 and Mycoplasma pneumoniae (MP) monoclonal antibody 02 were diluted to a working antibody concentration of 40 μg / mL, immediately placed on ice for use, and stored at -80°C for extended periods. Monoclonal antibodies 01 and 02 were purchased from Jiangsu Ningpu Medical Technology Co., Ltd., with batch numbers 22110301 and 24052201, respectively.

[0039] Protein A magnetic beads (purchased from Bailige Biotechnology (Shanghai) Co., Ltd., batch number: D0602-AX) were vortexed for 1 minute to ensure homogeneity. Then, 100 μL of the fully suspended magnetic beads were transferred to a 2 mL round-bottom tube. The magnetic beads were washed three times with an appropriate amount of PBS, and magnetic separation was performed for 2 minutes using a magnetic rack to remove the supernatant. Subsequently, 500 μL of antibody working solution was added dropwise and thoroughly mixed with the magnetic beads. The mixture was placed on a vortex mixer and incubated at room temperature at medium speed for 1 hour. After incubation, the magnetic beads were removed by magnetic separation, the supernatant was discarded, and the specific immunomagnetic beads were resuspended in 100 μL of PBS and stored at 4°C. Figure 1 ).

[0040] 2. Establishment of the PMAxx-SIMBs Real-Time RAA Method This method first enriches target pathogen particles with SIMBs to achieve specific antigen-antibody binding, then uses experimental concentrations of PMAxx to suppress free nucleic acid signals, and finally converts protein signals into nucleic acid signals for nucleic acid amplification.

[0041] RAA is a novel isothermal nucleic acid amplification technique that does not require the use of thermostable enzymes or thermal cycling instruments. This technique can amplify the target sequence within 5-30 minutes under isothermal conditions of 37-42℃, enabling rapid detection of intact pathogen particles. It also has low technical complexity and minimal requirements for equipment and personnel.

[0042] The complete genome sequences of Adv-3 and MP were obtained from the National Center for Biotechnology Information (NCBI) database (https: / / www.ncbi.nlm.nih.gov / ). Conserved regions were identified, and specific RAA primers and TaqMan probes were designed. The sequences of the primers and probes are shown in Table 1 (SEQ ID NO: 1-6).

[0043] Table 1. Primer and probe sequences for Adv-3 and MPRAA (5′-3′)

[0044] The system consists of lyophilized buffer beads, premixed primer-probe lyophilized beads, and nucleic acid template. The reaction was incubated at 37°C for 30 minutes under isothermal conditions, and the fluorescence signal was monitored in real time to determine the amplification results.

[0045] 3. Simulated sample preparation and pathogen capture Inactivated antigen standards of Adv-3 and MP were quantified, and simulated samples were prepared with PBS containing 1 mM CaCl2 and thoroughly mixed. Then, 25 μL of pre-prepared and homogenized SIMBs were added to the simulated samples to form protein A magnetic beads-specific antibody-antigen complexes. Next, 40 μL of PMAxx working solution (final concentration 5 mM) was added under light-protected conditions. The mixture was gently incubated in the dark for 10 minutes, then irradiated under a PMA-Lite™ LED photolysis device for 20 minutes. After magnetic bead separation, the supernatant was discarded. The magnetic beads were resuspended in 800 μL of lysis buffer, and 15 μL of carboxyl magnetic beads were added to promote nucleic acid extraction. The mixture was briefly vortexed and allowed to stand for 2 minutes, followed by magnetic bead separation again, and the supernatant was discarded. The mixture was washed sequentially with 250 μL of wash buffer 1, 250 μL of wash buffer 2, and 150 μL of elution buffer. Finally, the nucleic acids were eluted and collected for nucleic acid amplification fluorescence detection.

[0046] 4. Dual-target capture of MP and Adv-3 For dual-target capture, a mixed simulated sample containing two inactivated standards was first prepared. Then, 25 μL of MP-SIMBs and Adv-3-SIMBs were added, respectively. All subsequent steps were the same as the single-target capture method described above (see sensitivity details). Figure 2 ).

[0047] 5. Optimization of detection parameters: Determining the optimal parameters. The inhibitory effect of PMAxx on free nucleic acid amplification at six concentrations (0 μM, 10 μM, 50 μM, 100 μM and 200 μM) was detected.

[0048] To optimize single-target capture, the addition volume of SIMBs was tested at three levels (25 μL, 50 μL, and 75 μL) to determine the optimal amount of magnetic beads. By testing four exposure times (5, 10, 15, and 20 minutes), the exposure time for PMAxx activation was optimized while keeping the incubation time constant at 10 minutes. Subsequently, the incubation time (5, 10, 15, and 20 minutes) was optimized under the selected optimal exposure conditions. The final optimal reaction conditions were determined to be: 200 μM PMAxx and 25 μL SIMBs, a combination of 15 minutes of exposure and 5 minutes of incubation, which effectively inhibited free nucleic acids (…). Figure 3 and Figure 4 ).

[0049] For dual-target capture optimization, the magnetic bead addition volumes of MP-SIMBs and Adv-3-SIMBs were tested at four levels (15, 20, 25, and 30 μL), corresponding to total bead volumes of 30, 40, 50, and 60 μL for each reaction. The results showed that under dual detection conditions, the following combination of ingredients achieved optimal inhibition of free nucleic acids: 200 μM PMAxx, 50 μL total immunomagnetic beads, 5 minutes incubation, and 15 minutes exposure, reaching the plateau threshold time (…). Figure 5 ).

[0050] 6. Chip Design The microfluidic chip provided by this invention is equipped with a dedicated storage unit for storing test samples, buffer solutions, and mineral oil, and features customizable reaction chambers. This design enables automated nucleic acid extraction and detection within 45 minutes. The disk-shaped chip structure ensures efficient bead mixing and maximum nucleic acid recovery, while the fan-shaped detection chamber layout achieves uniform sample distribution, improving experimental reproducibility. The physical isolation design of each reaction chamber allows for independent reactions and minimizes cross-contamination.

[0051] 7. Testing capability assessment and clinical validation This study obtained oropharyngeal swab samples from the Fengtai District Center for Disease Control and Prevention, totaling 26 samples (including positive and negative specimens). These included 16 Adv-3 (CT value range 17.34-43.27) samples and 10 measles-mumps virus (MP) mixed virus (MP) samples (CT value range 21.39-43.26), with infection status confirmed by PCR testing. All sample collection followed local ethical guidelines, and informed consent was obtained from participants or their guardians. Swab samples were immediately placed in viral transport media and stored at -80°C until further processing.

[0052] After SIMB capture, PMAxx dark incubation, and photoactivation, magnetic separation was performed, and the supernatant was discarded. Magnetic beads were resuspended in lysis buffer and incubated for 2 minutes, then placed on a magnetic rack for 1 minute to ensure complete adsorption. The supernatant, along with pre-filled buffer and mineral oil, was sequentially injected into the "S," "B," and "O" ports of the chip. The chip-loaded device was inserted into a POCT device, and scanning the barcode triggered automated nucleic acid extraction and detection. Shear forces within the device promoted thorough mixing with the lyophilized beads.

[0053] (1) Performance evaluation of microfluidic devices To evaluate the sensitivity of the developed microfluidic detection system, MP samples were tested at three concentration levels: 5 × 10⁻⁶. 3 1 × 10 3 and 5 × 10 2 CFU / mL. Meanwhile, Adv-3 samples were tested at two concentrations—50 and 5 TCID. 50 / mL. All test concentrations produced clear fluorescence amplification curves, indicating that the system maintains strong detection capability and high analytical sensitivity even at low analyte concentrations. Figure 2 ,ae).

[0054] To further evaluate the performance of dual detection, a mixed sample containing two pathogens was evaluated: Adv-3 (50 TCID50). 50 / mL) and MP (1 × 10 3 The combination of CFU / mL and Adv-3 (50 TCID) 50 / mL) and MP (5 × 10 2 A combination of CFU / mL. For example... Figure 2 As shown in (f, g), all combinations produced positive fluorescence amplification curves for both targets, indicating that the system can simultaneously detect multiple pathogens without signal interference.

[0055] To assess specificity, potential cross-reactivity was evaluated by adding respiratory syncytial virus (RSV), influenza A virus (IAV), influenza B virus (IBV), and parainfluenza virus (PIV). No fluorescence signals were generated in any of the control samples, indicating that the system did not exhibit significant cross-reactivity under the test conditions and possessed high target specificity.

[0056] In summary, the microfluidic platform achieved 5×10 in single-target mode. 2 The limit of detection for MP at CFU / mL and 5 TCID 50 The detection limit for Adv-3 was achieved at 50 TCID⁻¹ / mL. In dual-target mode, Adv-3 concentrations as low as 50 TCID⁻¹ were successfully achieved. 50 / mL and MP concentration 1 × 10 3 Simultaneous detection of CFU / mL.

[0057] The above results demonstrate that the microfluidic system exhibits excellent sensitivity and specificity in both single-sample and multiplex detection modes, highlighting its potential for rapid detection of intact particles of various pathogens in clinical applications.

[0058] (2) Diagnostic performance of SIMBs-microfluidic systems in clinical samples To evaluate the performance of this novel POCT device, we performed PCR testing on 26 clinical samples, using a Ct value ≥42 as the cutoff for a negative result. Based on this criterion, the cohort included 6 MP-positive and 4 MP-negative samples, and 10 Adv-3-positive and 6 Adv-3-negative samples. Using PCR as the gold standard, all samples were divided into infected and non-infected groups. We compared the results of the POCT device and antigen-based lateral flow assay (LFA) with the PCR results to determine their sensitivity, specificity, and overall concordance. Figure 6 ).

[0059] This invention provides preliminary evidence supporting the robust performance of the developed POCT device. For MP and Adv-3, the detection results were completely consistent with PCR. In clinical specimen evaluation, POCT demonstrated 100% sensitivity and specificity, with both positive and negative predictive values ​​of 100%. The kappa coefficient was 1.0, indicating excellent concordance between the device and the reference PCR detection method. Subsequently, we compared the performance of POCT with LFA using 26 clinical pharyngeal swab specimens. Analysis showed that for MP, POCT achieved 100% sensitivity (6 / 6; 95% CI, 60.97–100) and 100% specificity (4 / 4; 95% CI, 50.01–100), while LFA had a sensitivity of 83.3% (5 / 6; 95% CI, 43.65–99.15), a specificity of 100% (4 / 4; 95% CI, 51.01–100), and an upper limit of detection (CT) of 32.55. For Adv-3, POCT showed sensitivity and specificity of 100% (10 / 10; 95% CI, 72.25–100) and 100% (6 / 6; 95% CI, 60.97–100), respectively, while LFA showed sensitivity of 70.0% (7 / 10; 95% CI, 39.68–89.22) and specificity of 100% (6 / 6; 95% CI, 60.97–100), with an upper limit of detection (CT) of 32.38. Table 2 shows that the sample pretreatment integrated microfluidic chip system provided by this invention has extremely high sensitivity and specificity, and its detection results are highly consistent with PCR, with significantly higher sensitivity than traditional LFA.

[0060] Table 2 Clinical Sample Test Results

[0061] Based on this invention, future research will focus on designing multiple sets of targeted, specific immunomagnetic beads to expand from dual detection to multiplex or even high-throughput detection without changing the core hardware or testing procedures. Meanwhile, ongoing research is focusing on integrating pretreatment steps into POCT instruments to achieve fully automated point-of-care detection of intact pathogen particles. Therefore, the dual detection of MP and Adv-3 demonstrated in this invention marks the successful establishment of this technological path. Ultimately, this will lead to the development of a fully automated, multiplex "diagnostic toolkit" capable of determining infection status. This platform-based strategy provides rapid response and flexibility, offering unique advantages in applications such as infectivity assessment, virus inactivation efficacy evaluation, and pathogen integrity monitoring.

[0062] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for detecting intact, live pathogens in a sample, characterized in that, Includes the following steps: (1) The sample to be tested is brought into contact with specific immunomagnetic beads to form a magnetic bead-pathogen complex; wherein the specific immunomagnetic beads are coupled with a capture antibody that can specifically bind to the surface antigen of the pathogen; (2) Treat the magnetic bead-pathogen complex with a membrane-impermeable nucleic acid intercalation dye and activate the dye to inhibit the amplification of nucleic acids from pathogens with damaged membrane structures in subsequent steps; (3) The magnetic bead-pathogen complex treated in step (2) is lysed to release the nucleic acid in the intact active pathogen; (4) The released nucleic acid is amplified and detected to determine whether the intact active pathogen exists in the sample to be tested; The method described is not for disease diagnosis and treatment purposes.

2. The method according to claim 1, characterized in that, Step (4) Amplification and detection are performed using isothermal nucleic acid amplification technology; Preferably, the isothermal nucleic acid amplification technology is RAA.

3. The method according to claim 1, characterized in that, The membrane-impermeable nucleic acid intercalation dye in step (2) is a photoactivated dye, and activating the dye includes irradiating the dye with light.

4. The method according to claim 4, characterized in that, The photoactivated dye is propidium azide.

5. The method according to any one of claims 1-4, characterized in that, The method is used to detect multiple pathogens simultaneously by using multiple specific immunomagnetic beads coupled with capture antibodies against different pathogens, and by using multiple sets of amplification primers and / or probes against the nucleic acids of different pathogens in step (4).

6. The method according to claim 5, characterized in that, The pathogens are adenovirus type 3 and Mycoplasma pneumoniae. The capture antibody for adenovirus type 3 is monoclonal antibody 01, purchased from Jiangsu Ningpu Medical Technology Co., Ltd., batch number: 22110301; the capture antibody for Mycoplasma pneumoniae is monoclonal antibody 02, purchased from Jiangsu Ningpu Medical Technology Co., Ltd., batch number: 24052201.

7. The method according to claim 6, characterized in that, The RAA primer and probe sequences used for amplifying adenovirus type 3 are (5′-3′): Adv-3-F:ATTCCGGCACAGCTTACAATTCACTCGCTCC; Adv-3-R: TCAGTAGTGGTAATGTCTTTCCCAATTTGC; AdV3-P:ACAATGCAGTAACTACCACCACAAACACA[FAM-dT][THF][BHQ-dT]GGCATTGCTTCCAT[C3-spacer]; and / or, The RAA primer and probe sequences used for amplifying Mycoplasma pneumoniae are (5′-3′): MP-F: CAACGCACCCTACTTCCACAATAACCC; MP-R:GTGAGCTTATTGGACCAGTTGTATAACCTGT MP-P: AGCCCTGAGAGGACAAGAACGGTAAGGA[FAM-dT]G[THF][BHQ-dT]GCCAAATACATCTA[C3-spacer].

8. A system for detecting intact, live pathogens in a sample, characterized in that, include: (a) Specific immunomagnetic beads for binding with pathogens in a sample to form a magnetic bead-pathogen complex; wherein the specific immunomagnetic beads are coupled with a capture antibody capable of specifically binding to the surface antigen of the pathogen; (b) Membrane-impermeable nucleic acid intercalating dyes, used to selectively enter pathogens with damaged membrane structures and bind to their nucleic acids; (c) An activation device for activating the dye to inhibit nucleic acid amplification of pathogens with damaged membrane structures; and, (d) A microfluidic chip, wherein the microfluidic chip integrates a pyrolysis unit, a reaction unit and a detection unit; The lysis unit is used to lyse the intact active pathogen in the magnetic bead-pathogen complex to release nucleic acid. A reaction unit for amplifying the released nucleic acid; The detection unit is used to detect the amplification products.

9. The system according to claim 8, characterized in that, The microfluidic chip has a disk-shaped structure, and the reaction unit contains one or more fan-shaped reaction chambers, and the reaction unit is pre-filled with lyophilized isothermal nucleic acid amplification reagents.