A strain of Zygosaccharomyces rouxii DL-WSY01 and its application

Abstract

This invention discloses a strain of Zygosaccharomyces rouxii, DL-WSY01, and its applications, belonging to the field of food biotechnology. This invention provides a strain of Zygosaccharomyces rouxii, DL-WSY01, with accession number CGMCC No. 25335. The DL-WSY01 strain exhibits rapid growth and excellent fermentation performance; it is also tolerant to the gastrointestinal environment, demonstrating good probiotic properties; it is sensitive to common fungal antibiotics, non-hemolytic, and exhibits good safety; it effectively tolerates high salt, acid, and ethanol; it possesses antioxidant properties; it can produce high levels of ethanol; it can also produce high levels of flavor compounds and has biogenic amine degradation capabilities. Therefore, this strain, as a starter culture, can ensure the safety and flavor quality of fermented foods such as fermented soybean paste and soybean paste, and significantly improve the nutritional value of fermented foods.

Description

Technical Field

[0001] This invention relates to a strain of *Rhodotorula roux* (…). Zygosaccharomyces rouxii DL-WSY01 and its applications belong to the field of food biotechnology. Background Technology

[0002] Fermented foods such as fermented soybean paste, soybean paste, soy sauce, and fermented black beans are beloved by consumers for their unique color, aroma, flavor, and appearance. These products generally use natural fermentation processes, but to ensure food safety, the amount of sodium chloride added usually exceeds 15%. Studies show that high salt concentrations significantly reduce the content of aroma compounds in fermented soybean paste.

[0003] Fermented foods, as an important component of traditional foods, occupy a vital position in the food industry. During fermentation, the metabolic activities of microorganisms not only affect the flavor and quality of the product but also directly relate to its safety. In recent years, with consumers' increasing demands for the quality of fermented foods, how to improve their flavor and quality while ensuring their safety has become a focus of industry attention. Ethanol, as a core element in the flavor and quality of fermented condiments such as fermented soybean paste, soybean paste, soy sauce, and fermented black beans, has a significant impact on the flavor of soy sauce due to its unique aroma. It can also combine with acidic substances to generate various flavor compounds and their precursors, playing a crucial role in the formation of soy sauce's color and flavor, as well as improving its quality. Simultaneously, ethanol has antibacterial properties, effectively inhibiting the growth of some harmful bacteria; the higher the ethanol concentration, the better the antibacterial effect, extending the shelf life of condiments. However, the high sodium chloride content hinders the application of brewing yeast in high-salt fermented foods.

[0004] Meanwhile, fermented foods such as fermented soybean paste, soybean paste, soy sauce, and fermented black beans rely on open fermentation by environmental microorganisms. The rich protein content in raw materials such as soybeans and broad beans easily leads to excessive levels of biogenic amines in these fermented foods. Biogenic amines are low-molecular-weight nitrogenous basic compounds produced by amino acid decarboxylation, aldehyde / ketone reductive amination, or transamination. Moderate intake is beneficial, but excessive accumulation (such as histamine and tyramine) can cause headaches, vomiting, and even anaphylactic shock. Common risky amines include tryptamine, β-phenylethylamine, putrescine, cadaverine, histamine, tyramine, spermidine, and spermine.

[0005] Existing research indicates that *Zygosacchariformis* exhibits strong adaptability to high-salt conditions, effectively enhancing the aroma complexity of fermented foods. Patent CN118931745A describes the application of *Zygosacchariformis* ZB442 in high-salt, low-temperature soy sauce fermentation, which enriches the aroma and improves the quality of the soy sauce. Simultaneously, this strain can produce aromatic fusel oils and other aromatic byproducts, significantly contributing to the flavor formation of fermented foods. Patent CN113481112A describes the combined use of *Zygosacchariformis* and *Tetracoccus halophilus* to reduce the content of biogenic amines in soy sauce, thereby improving product safety. CN118931745A also describes *Zygosacchariformis* as producing high levels of tartaric acid, malic acid, succinic acid, and ethanol, increasing the total acidity of soy sauce.

[0006] However, existing research on Zygosacchariformis in saline fermented foods has only demonstrated single functional characteristics of the strains, such as the ability to produce esters, degrade biogenic amines, or produce organic acids. More importantly, existing Zygosacchariformis strains struggle to adapt to the complex, multi-stress environments in fermented foods such as fermented soybean paste, soybean paste, soy sauce, and fermented black beans, and find it difficult to maintain stable metabolic activity under the combined stress of high salt, high acid, and ethanol.

[0007] To address the aforementioned issues, developing a strain of *Zygosacchariformis* with multiple advantages, including strong ethanol production capacity, high salt tolerance, ability to increase the content of esters and alcohols in fermented foods, and a certain capacity for biogenic amine degradation, is of great significance for improving the quality and safety of fermented foods. Summary of the Invention

[0008] To address the shortcomings of the existing technology, this invention aims to provide a strain of *Zygosacchariformis* with high salt tolerance, high ethanol and flavor compound production, and biogenic amine degradation capabilities. Zygosaccharomyces rouxii DL-WSY01 aims to solve the technical problem that the lack of a yeast agent that combines high salt tolerance, ethanol and other flavor substances production, and biogenic amine reduction has limited the development of the industry.

[0009] The first technical solution provided by this invention is a strain of *Leucobryonius ruvifolius* ( Zygosaccharomyces rouxii DL-WSY01 was deposited on July 18, 2022, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 25335.

[0010] The *Zygosaccharomyces rouxii* DL-WSY01 involved in this invention was collected from fermented soybean samples from Pixian County, Sichuan Province. The depositary address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0011] In one embodiment, the *Zygosacchariformis* DL-WSY01 was isolated from a fermented soybean paste sample from Pixian County, Sichuan Province, and the nucleotide sequence of its 26S rRNA is shown in SEQ ID No. 1.

[0012] The second technical solution provided by the present invention is a microbial preparation containing the *Zygosacchariformis* DL-WSY01 described in the first technical solution.

[0013] In one embodiment, the concentration of the *Zygosaccharomyces rouxii* DL-WSY01 in the microbial preparation is not less than 1 × 10⁻⁶. 6 CFU / mL or 1×10 6 CFU / mg.

[0014] The third technical solution provided by the present invention is a fermentation agent containing the *Zygosaccharomyces rouxii* DL-WSY01 described in the first technical solution or the microbial preparation described in the second technical solution.

[0015] In one embodiment, the concentration of the *Zygosaccharomyces rouxii* DL-WSY01 in the fermentation agent is not less than 1 × 10⁻⁶. 6 CFU / mL or 1×10 6 CFU / mg.

[0016] In one embodiment, the *Zygosaccharomyces rouxii* DL-WSY01 in the microbial preparation or the fermentation agent is present in live form.

[0017] In one embodiment, the microbial preparation or the fermentation agent may also contain a freeze-drying protectant.

[0018] In one embodiment, the microbial preparation or the fermentation agent may also contain a spray drying protectant.

[0019] In one embodiment, the microbial preparation or fermentation agent is a liquid microbial agent, fermentation agent, or a solid microbial agent, fermentation agent.

[0020] This invention provides a method for preparing the bacterial agent or the fermentation agent, the method comprising the steps of culturing *Zygosacchariformis* DL-WSY01 to obtain bacterial suspension: picking a single colony of *Zygosacchariformis* DL-WSY01 and inoculating it into 10 mL of YPD medium, and culturing it aerobically at 28-30℃ and 200-250 rpm for 24 h to obtain bacterial suspension A; then taking 500 μL of bacterial suspension A and inoculating it into 50 mL of YPD medium, and culturing it aerobically at 28-30℃ and 200-250 rpm for 24 h to obtain bacterial suspension B; then taking 10 mL of bacterial suspension B and inoculating it into 1000 mL of YPD medium, and culturing it aerobically at 28-30℃ and 200-250 rpm for 24 h to obtain bacterial suspension C; centrifuging bacterial suspension C at 8000 rpm for 10 min and collecting the bacterial cells; diluting the *Zygosacchariformis* DL-WSY01 bacterial cells with a 0.9% sodium chloride aqueous solution to prepare 10 9 -10 10 CFU / mL bacterial suspension.

[0021] In one embodiment, the culture is carried out at 28 °C.

[0022] In one embodiment, the culture medium used for cultivation includes, but is not limited to, commonly used yeast culture media such as YPD medium and nutrient broth medium.

[0023] In one embodiment, the 10 obtained above 9 ~10 10 CFU / mL bacterial suspensions can be prepared directly or with the addition of excipients permitted in the field of microbial preparations to produce liquid bacterial agents or fermentation agents. Alternatively, bacterial cells in the bacterial suspension can be collected and mixed with excipients permitted in the field of microbial preparations, such as freeze-drying protectants and spray-drying protectants, and then prepared as fermentation agents by vacuum freeze-drying or spray-drying.

[0024] The fourth technical solution provided by this invention is the application of the *Zygosacchariformis* DL-WSY01 described in the first technical solution, the microbial preparation described in the second technical solution, or the fermentation agent described in the third technical solution in the preparation of food.

[0025] In one embodiment, the food includes fermented food.

[0026] In one embodiment, the fermented food is preferably a fermented condiment; most preferably fermented soybean paste, broad bean paste, fermented bean curd, soy sauce, fish sauce, or shrimp paste.

[0027] The fifth technical solution provided by the present invention is the application of the *Zygosacchariformis* DL-WSY01 described in the first technical solution, the microbial preparation described in the second technical solution, or the fermentation agent described in the third technical solution in increasing the content of aroma substances in food.

[0028] In one embodiment, the food includes fermented food.

[0029] In one embodiment, the fermented food is preferably a fermented condiment; most preferably fermented soybean paste, broad bean paste, fermented bean curd, soy sauce, fish sauce, shrimp paste, or fermented black beans.

[0030] In one embodiment, the flavoring substances in the enhanced fermented food include one or more of ethanol, phenylethanol, ethyl acetate, ethyl isovalerate, butyl acetate, ethyl palmitate, and ethyl linoleate.

[0031] The sixth technical solution provided by the present invention is the application of the *Zygosacchariformis* DL-WSY01 described in the first technical solution, the microbial preparation described in the second technical solution, or the fermentation agent described in the third technical solution in reducing the content of biogenic amines in food.

[0032] In one embodiment, the food includes fermented food.

[0033] In one embodiment, the fermented food is preferably a fermented condiment; most preferably fermented soybean paste, broad bean paste, fermented bean curd, soy sauce, fish sauce, shrimp paste, or fermented black beans.

[0034] In one embodiment, the reduced biogenic amines in the fermented food include one or more of tryptophan, β-phenylethylamine, putrescine, cadaverine, histamine, tyramine, spermidine, and spermine.

[0035] The present invention also provides a method for preparing fermented food, wherein the method comprises adding the *Zygosacchariformis* DL-WSY01 described in the first technical solution, the microbial preparation described in the second technical solution, or the fermenting agent described in the third technical solution during the food fermentation process.

[0036] In one embodiment, the amount of *Zygosaccharomyces rouxii* DL-WSY01 added is 10. 6 ~10 9 CFU / kg or 10 6 ~10 9 CFU / L.

[0037] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a strain of *Leucobryonia roux* (…). Zygosaccharomyces rouxiiDL-WSY01, isolated from high-salt dilute fermented soy sauce, has the following characteristics: (1) Zygosacchari leucovori DL-WSY01 grows well under 25% NaCl concentration, pH 2 conditions and 9% ethanol concentration, is resistant to high salt, acid, and ethanol. (2) Zygosacchari leucovori DL-WSY01 can tolerate the gastrointestinal environment and has excellent probiotic properties. (3) Zygosacchari leucovori DL-WSY01 can produce high levels of ethanol in YPD liquid medium containing 18% NaCl, reaching 6.77 g / L. (4) Zygosacchari leucovori DL-WSY01 has good antioxidant properties, with a DPPH scavenging rate of 85.05% and an ABTS scavenging rate of 72.28%. (5) Zygosacchari leucovori DL-WSY01 is sensitive to common fungal antibiotics, does not hemolyze, and has good safety. (6) Strain DL-WSY01 can produce ethanol during the fermentation of high-salt foods. (7) Strain DL-WSY01 can produce high concentrations of flavor substances during fermentation. (8) Strain DL-WSY01 has the function of biogenic amine degradation. Based on the above excellent characteristics of strain DL-WSY01, this strain can ensure the food safety and flavor quality of fermented food, shorten the fermentation cycle, and significantly improve the nutritional value of fermented food when used as a starter culture.

[0038] Preservation of biological materials The present invention provides *Lourdesca rouxii* (a type of yeast). Zygosaccharomyces rouxii DL-WSY01, taxonomically named *Zygosaccharomyces rouxii*. Zygosaccharomyces rouxii It was deposited on July 18, 2022, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 25335. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0039] Figure 1 A streak photograph of the DL-WSY01 yeast strain.

[0040] Figure 2 Microscopic (40×) image of *Zygosaccharomyces rouxii* DL-WSY01.

[0041] Figure 3 The pH tolerance curve of *Zygosaccharomyces rouxii* DL-WSY01 is shown.

[0042] Figure 4 Salt tolerance curves for *Zygosaccharomyces rouxii* DL-WSY01.

[0043] Figure 5 Ethanol tolerance curve of DL-WSY01 Zygomyces rouxii. Detailed Implementation

[0044] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0045] The culture medium used in this invention is prepared as follows: (1) YPD liquid culture medium: 20.0g peptone, 10.0g yeast powder, 20.0g glucose, distilled water to 1L, pH adjusted to 7.0, autoclave for 20min.

[0046] (2) YPD solid culture medium: 20.0g peptone, 10.0g yeast powder, 20.0g glucose, 15g agar, distilled water to 1L, pH adjusted to 7.0, autoclaved for 20min, and then poured into plates.

[0047] (3) TTC solid medium: lower layer medium: YPD solid medium; upper layer medium: glucose 5.0g, agar powder 15.0g, TTC 0.5g, distilled water to 1L, pH adjusted to 7.0, autoclaved for 20min, and then poured into plates.

[0048] Zygosacchariformis CGMCC 2.178 and CGMCC 2.1017 were purchased from the China General Microbiological Culture Collection Center. *Aspergillus oryzae* strain 3.042 was purchased from Angel Yeast Co., Ltd. *Staphylococcus aureus* ATCC 25923 was purchased from the American Type Culture Collection. Example 1: Isolation and Identification of Zygosacchariformis DL-WSY01 1. Isolation and purification of Zygosaccharomyces rouxii DL-WSY01 (1) Sample: Fermented broad bean paste samples collected from Pixian County, Sichuan Province.

[0049] (2) The separation and screening method adopted is the enrichment-screening culture method, as follows: Take 1 g of fermented Sichuan Pixian broad bean paste sample, add it to 10 mL of YPD liquid medium, transfer it to a homogenizing bag, agitate for 30 min, centrifuge at 500 g for 5 min to remove the residue, and aseptically transfer the turbid liquid containing bacteria to a 50 mL centrifuge tube. Add YPD medium to 10 mL and incubate at 28℃ and 200 rpm for 3 h. After appropriate dilution of the culture, spread it on the lower layer of TTC medium. After the liquid is completely absorbed, incubate upside down at 28℃ for 24-48 h. After the strain grows, cover it with the upper layer of TTC medium and react in the dark for 2 h. Select the strain with the bright red color and streak it onto YPD solid medium containing 18% NaCl to isolate single colonies. Purify for three generations, pick single colonies for microscopic examination, and after confirming that there is no contamination, freeze the strain and name it DL-WSY01. The DL-WSY01 strain was first cultured in 10 mL of YPD medium containing 18% NaCl for 24 h, and then transferred at a 1% (v / v) inoculation rate to 50 mL of YPD medium (250 mL Erlenmeyer flask) containing 18% NaCl. The culture was then continued for 5 days with shaking at 200-250 rpm and 28℃. The supernatant was then collected after centrifugation at 8000 rpm for 10 min and analyzed as follows.

[0050] (3) Ethanol production analysis. The culture supernatant of the strain DL-WSY01 initially screened in (2) above was analyzed for ethanol production using a biosensor. It was found that the ethanol production of the DL-WSY01 supernatant after 5 days of culture in YPD liquid containing 18% NaCl was 6.77±0.32 g / L, indicating that the DL-WSY01 strain has the ability to produce ethanol under high salt concentration.

[0051] 2. Identification of *Zygosaccharomyces rouxii* DL-WSY01: (1) Strain DL-WSY01 grew well on YPD solid plates, and after culturing at 30℃ for 24-48 h, as... Figure 1 As shown, it forms moist, round, raised, smooth, milky-white colonies; microscopic images are as follows. Figure 2 As shown, the bacterial cells were found to be oval in shape.

[0052] (2) The genome of strain DL-WSY01 was extracted for 26S rRNA PCR identification. The genome extraction method was carried out according to the glass bead method in the "Concise Guide to Molecular Biology Experiments".

[0053] The PCR conditions are as follows: The amplification system consisted of: 25 µL of 2×Taq Master Mix, 2 µL of primer D1, 2 µL of primer D2, 19 µL of sterile water, and 2 µL of template. The PCR reaction conditions were: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s; 50 °C annealing for 15 s; 72 °C extension for 1 min; 72 °C for 15 min; 30 cycles.

[0054] After PCR, agarose gel electrophoresis (1.0%) was performed to detect the PCR products of the yeast samples. Bright bands indicated successful PCR amplification of the genome, which could then be sent for sequencing. Primer sequences: D1: GCATATCAATAAGCGGAGGAAAAG, D2: GGTCCGTGTTTCAAGACGG.

[0055] The 26S rRNA sequence of the strain DL-WSY01 is as follows: .

[0056] Blastn analysis of the sequencing results revealed that this bacterium is related to... Zygosaccharomyces rouxii The homology was highest, reaching 99.83%. Morphological and 26S rRNA identification confirmed that strain DL-WSY01 is... Zygosaccharomyces rouxii It was named *Zygosaccharomyces rouxii* ( Zygosaccharomyces rouxii DL-WSY01.

[0057] Based on morphological and 26S rRNA identification, this strain DL-WSY01 is... Zygosaccharomyces rouxii It was deposited on July 18, 2022, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 25335. The depository address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, China, 100101, China.

[0058] Example 2: Tolerance test of *Zygosacchariformis* DL-WSY01 to salt, acid, and alcohol. 1. Acid resistance test of *Zygosaccharomyces rouxii* strain DL-WSY01: The number of live bacteria was 3×10 8 CFU / mL of *Zygosaccharomyces rouxii* DL-WSY01 suspension was inoculated at a ratio of 3% (v / v) into YPD liquid medium at pH 1.0, 2.0, 3.0, 4.0, and 5.0, and incubated at 28°C. OD values ​​of the samples were measured every 2 hours using an automated growth curve analyzer. 600nm Value determination. Results are as follows: Figure 3 As shown, the strain still exhibits a significant growth trend at pH 2.0. This indicates that *Zygosaccharomyces rouxii* DL-WSY01 has good tolerance to acidic environments.

[0059] 2. Salt tolerance test of *Zygosaccharomyces rouxii* DL-WSY01: The number of live bacteria was 3×10 8 CFU / mL of *Zygosaccharomyces rouxii* DL-WSY01 suspension was inoculated at 3% (v / v) in YPD liquid medium with sodium chloride contents of 10%, 15%, 20%, 25%, and 30%, respectively, and incubated at 28°C. OD values ​​of the samples were measured every 2 hours using an automated growth curve analyzer. 600nm Value determination. Results are as follows: Figure 4 As shown, the strain stopped growing at a sodium chloride concentration of 30%, grew well at 25%, and its growth was somewhat inhibited at 30%. This indicates that *Zygosacchariformis* DL-WSY01 has a certain tolerance to a salt concentration of 25%.

[0060] 3. Ethanol tolerance test of *Zygosaccharomyces rouxii* DL-WSY01: The number of live bacteria was 3×10 8 CFU / mL of *Zygosaccharomyces rouxii* DL-WSY01 suspension was inoculated at 3% (v / v) in YPD liquid medium with ethanol contents of 0%, 3%, 6%, and 9%, respectively, and incubated at 28°C. OD values ​​of the samples were measured every 2 hours using an automated growth curve analyzer. 600nm Value determination. Results are as follows: Figure 5 As shown, the strain still exhibits some growth when the ethanol content is 9%. This indicates that *Zygosaccharomyces rouxii* DL-WSY01 has a certain tolerance to ethanol content of 9%.

[0061] Example 3: Safety assessment of *Zygosaccharomyces rouxii* DL-WSY01 1. Antibiotic susceptibility test of *Zygosacchariformis* DL-WSY01: The antibiotic susceptibility profile of *Zygosaccharomyces rouxii* DL-WSY01 was characterized using the disk diffusion method. Activated cells were prepared into 1×10⁻⁶ cells. 8 A CFU / mL bacterial suspension was prepared, and 200 μL of the suspension was spread onto YPD plates. Six antibiotic susceptibility testing discs (voriconazole (1 μg), itraconazole (10 μg), miconazole (10 μg), ketoconazole (15 μg), fluconazole (25 μg), and nystatin (50 μg)) were carefully placed on the discs, with varying spacing between each disc. After incubation at 28℃ for 48 h, the diameter of the inhibition zone was measured and counted. Resistance (R), mid-term I, or susceptibility (S) were analyzed, with three replicates performed. The results showed that *Zygosacchariformis* DL-WSY01 was sensitive to all six antibiotics, exhibiting no resistance to any of them, indicating good strain safety.

[0062] Table 1. Antibiotic susceptibility of strains

[0063] 2. Hemolysis experiment of *Zygosaccharomyces rouxii* DL-WSY01 Culture medium preparation: Columbia agar + 5% defibrinated sheep plasma. Isolate bacterial suspension (approximately 1 × 10⁻⁶). 8 (CFU / mL) *Zygosaccharomyces rouxii* DL-WSY01 was streaked onto a Columbia agar plate containing 5% defibrinated sheep blood and incubated at 28 °C for 48 h. The presence of a clear zone was then observed. *Staphylococcus aureus* ATCC 25923 was used as a positive control.

[0064] The results showed that the Staphylococcus aureus ATCC 25923 positive control strain exhibited a wide (6-8 mm), well-defined, and completely transparent hemolytic zone around its colony, typical of β-hemolysis. In contrast, the *Zygosaccharomyces rouxii* DL-WSY01 colony provided by this invention showed no hemolysis around its colony, indicating good strain safety.

[0065] Example 4: Evaluation of the prebiotic properties of the *Zygosaccharomyces rouxii* strain DL-WSY01 1. Simulated gastric acid tolerance test of *Zygosacchariformis* DL-WSY01: The number of live bacteria was 3×10 8 A suspension of *Zygosaccharomyces rouxii* DL-WSY01 cells (CFU / mL) was collected by centrifugation and resuspended in simulated gastric fluid at pH 3.0. The suspension was incubated at 37°C, and plate counts were performed at 0 h and 2 h to calculate the viability of the strains. The results showed that after 2 h of incubation in simulated gastric fluid at pH 3.0, the viable count of *Zygosaccharomyces rouxii* DL-WSY01 cells increased from 10... 8 CFU / mL decreased to 10 7 The CFU / mL concentration achieved a survival rate of 90%, indicating that *Zygosacchariformis* DL-WSY01 exhibits good tolerance to simulated gastric acid environment.

[0066] 2. Bile salt tolerance test of *Zygosaccharomyces rouxii* DL-WSY01: In a simulated gastric acid tolerance experiment (pH 3.0), *Zygosaccharomyces rouxii* DL-WSY01 reached the intestine via the stomach after 2 hours, with the viable count decreasing to 3 × 10⁻⁶. 7 CFU / mL. Therefore, the starting viable count for the bile salt tolerance test was adjusted to 3 × 10⁻⁶ CFU / mL. 7 CFU / mL. The activated *Zygosacchariformis* DL-WSY01 cells were collected by centrifugation, washed twice with YPD medium, and resuspended in YPD medium containing 0.3% (w / v) sodium taurocholate, adjusting the viable cell concentration to 3 × 10⁻⁶. 7 CFU / mL, incubated at 37℃, samples were collected at 0 h and 3 h for colony counting to calculate the survival rate of the strain. The results showed that the viable count of *Zygosaccharomyces rouxii* DL-WSY01 decreased under 0.3% (w / v) bile salt conditions, but remained above 10 after 3 h. 6 The CFU / mL level is above the critical value for live bacteria to exert their functional characteristics, indicating that *Zygosacchariformis* DL-WSY01 has good tolerance to the small intestinal environment.

[0067] 3. Antioxidant experiment of *Zygosacchariformis* DL-WSY01 (1) DPPH free radical scavenging rate test: 0.2 mmol / L DPPH: 0.0078 g DPPH, dissolved in anhydrous ethanol, diluted to 100 mL, stored in the dark, and used immediately. 8 CFU / mL of *Zygosaccharomyces rouxii* DL-WSY01 culture was mixed with 0.2 mM DPPH solution at a volume ratio of 1:1 and incubated in the dark at 25°C for 30 min. Using 10 [units of a specific concentration] alone... 8CFU / mL of *Zygosaccharomyces rouxii* DL-WSY01 culture and ethanol were used as blanks, while PBS and 0.2 mmol / L DPPH were used as controls. The supernatant was collected after centrifugation at 2330×g (4120 rpm) for 10 minutes. The absorbance was measured in triplicate at 517 nm.

[0068] Calculation of DPPH free radical scavenging rate: ; Ai is the absorbance of 1 mL of the bacterial culture to be tested plus 1 mL of DPPH ethanol solution; Aj is the absorbance of 1 mL of the bacterial solution to be tested plus 1 mL of anhydrous ethanol; Ac is the absorbance of 1 mL PBS plus 1 mL DPPH ethanol solution.

[0069] (2) ABTS free radical scavenging rate test: ABTS (14 mM) and potassium persulfate (5 mM) were dissolved in 0.1 M potassium phosphate buffer (pH 7.4), mixed in a 1:1 ratio, and reacted at 25°C for 12–16 h to obtain the ABTS working solution. 100 μL of *Saccharomyces rouxii* DL-WSY01 (10 8 Add CFU / mL to 900 μL of ABTS working solution and incubate in the dark at 25°C for 15 min. After centrifugation (14000 g, 1 min), measure the absorbance of the supernatant at 734 nm.

[0070] Calculation of ABTS radical scavenging rate:

[0071] As is the absorbance of 100 μL of the bacterial culture to be tested plus 900 μL of ABTS working solution; Ac is 1 mL of ABTS working solution; The results showed that the DPPH scavenging activity of Zygomyces rouxii DL-WSY01 was 85.05% and the ABTS scavenging activity was 72.28%, indicating that strain DL-WSY01 has certain antioxidant activity.

[0072] Example 5: Preparation of *Zygosaccharomyces rouxii* DL-WSY01 bacterial culture: 1) Dispensing of YPD medium: Sterile YPD medium is aseptically dispensed into 50 mL centrifuge tubes (10 mL), 250 mL Erlenmeyer flasks (50 mL), and 5 L Erlenmeyer flasks (1000 mL).

[0073] 2) Remove the glycerol tube containing the *Zygosaccharomyces rouxii* strain DL-WSY01 from the -80℃ freezer. Transfer one loopful of the bacterial ice residue to 10 mL of YPD medium and incubate at 200-250 rpm and 28℃ with shaking for 24 h. Then, transfer the culture at a 1% (v / v) inoculation rate to a 250 mL Erlenmeyer flask containing 50 mL of YPD medium and continue incubating at 200-250 rpm and 28℃ with shaking for 24 h. Finally, transfer the culture at a 1% (v / v) inoculation rate to a 3 L Erlenmeyer flask containing 750 mL of YPD medium and incubate at 200-250 rpm and 28℃ with shaking for 24 h. Centrifuge the resulting bacterial culture at 8000 rpm for 10 min and collect the cells. Dilute the *Zygosaccharomyces rouxii* cells with a 0.9% sodium chloride aqueous solution to prepare 10... 9 CFU / mL bacterial suspension. For later use.

[0074] Example 6: Preparation of *Zygosaccharomyces rouxii* DL-WSY01 starter culture powder: The *Zygosacchariformis* DL-WSY01 was inoculated into YPD medium, cultured at 28°C for 48 h, and then centrifuged to prepare 10⁻⁶ cells. 8 A bacterial suspension of CFU / mL (dissolved in 1×PBS solution) was mixed with an equal mass of lyophilization protectant (containing 3g inulin, 2g maltodextrin, and 2g resistant dextrin per 100 mL of 10% skim milk). The mixture was pre-frozen at -20°C and then vacuum-dried in a freeze dryer (cold trap temperature -45°C, vacuum degree 10-20 Pa) for 22-24 hours. Drying was stopped when the moisture content of the bacterial powder decreased to 2.5%-3%, yielding a dry powder bacterial agent. The viable cell content of *Zygosacchariformis* DL-WSY01 in the bacterial agent was 10... 12 CFU / g.

[0075] Another method involves inoculating *Zygosacchariformis* DL-WSY01 into YPD medium, culturing at 28°C for 48 h, and then centrifuging to prepare 10⁻⁶ cells. 8 A bacterial suspension of CFU / mL was mixed with an equal mass of spray drying protectant (containing 2g glycerol and 3g sucrose per 100 mL of 10% skim milk) and spray-dried at 35°C to obtain a dry powder form of bacterial agent. The viable cell content of *Zygosaccharomyces rouxii* DL-WSY01 in the bacterial agent was 10. 11 CFU / g.

[0076] Example 7: Application of Zygosaccharomyces rouxii strain DL-WSY01 in soy sauce fermentation According to SB / T 10312-1999, the brewing process for high-salt, dilute-state fermented soy sauce, soy sauce fermentation was carried out. The raw materials, soybean meal and wheat bran, were mixed in a ratio of 7:3. The mixture underwent wetting, steaming, cooling, and inoculation treatments, followed by inoculation for 10 days. 8 CFU / mL of Aspergillus oryzae was added to the Shanghai-brewed koji, and then 10 was added during 24 hours of koji preparation. 9 The DL-WSY01 strain of Zygosacchariformis was inoculated at a ratio of CFU / mL (g), and the mixture was kept at 30℃ for 42 h to form koji. The mixture was then loosened, weighed, and salt and water were added (final salinity 14%). Fermentation was carried out at 30℃ for 6 months. The finished soy sauce was obtained through pressing, sterilization, filtration, and packaging. The flavor substance content, biogenic amine content, and Escherichia coli content of the finished product were determined.

[0077] Example 8: Application of Zygosaccharomyces rouxii strain DL-WSY01 in fermentation of fermented soybean paste. According to GB / T 20560-2006, the standard for geographical indication product Pixian Doubanjiang (Pixian broad bean paste), Pixian Doubanjiang fermentation is carried out. During the sweet bean stage, when the Doubanjiang starter is placed in the fermentation container, the salt content is controlled at 3-5% and the water content at 15-25%, according to a 10... 7 Inoculate with *Zygosaccharomyces rouxii* DL-WSY01 at a CFU / mL ratio and ferment for 30 days; after mixing pepper embryos and sweet pepper petals, control the salinity at 12% and ferment at a ratio of 10... 7 The *Zygosacchariformis* DL-WSY01 inoculum was inoculated again at a CFU / mL ratio, and subsequent fermentation was continued. Fermentation was terminated when the amino acid nitrogen (as nitrogen) / (g / 100 g) ratio in both the experimental and control groups was greater than 0.18. Flavor compound content, biogenic amine content, and *E. coli* levels were then determined. Example 9: Application of Zygosaccharomyces rouxii DL-WSY01 strain in soybean paste fermentation Fermentation of soybean paste is carried out according to GB / T 24399-2009. Process flow: Soaking soybeans → Steaming → Cooling → Draining → Crushing → Inoculation (10) 8 CFU / mL Aspergillus oryzae (Shanghai-style brewing) 3.042 → Making sauce blocks → Making koji → Making koji → Washing sauce blocks → Cutting into small pieces → Adding salt to a final concentration of 10% → Stirring and skimming off foam → Press 10 8 The viable cell count was inoculated into *Zygosacchariformis* DL-WSY01 starter culture at a concentration of CFU / mL. The process involved fermentation, packaging, sterilization, and final product. After fermentation, the product was tested for flavor compounds, biogenic amines, and *E. coli*.

[0078] Example 10: Application of Zygosaccharomyces rouxii strain DL-WSY01 in fermented bean curd. Referring to the SB / T 10170-2007 standard for fermented bean curd, the fermentation process is as follows: Soaking soybeans → Grinding → Soy milk → Boiling → Filtering → Adding coagulant → Pressing → Tofu → Cutting into blocks → Raw bean curd → Steaming → Pickling → Pickled bean curd → Inoculation → Initial fermentation → Raw bean curd → Pressing at 10 6 Inoculate with *Zygosaccharomyces rouxii* strain DL-WSY01 at a ratio of CFU / mL (g) → pack into fermentation tanks → late-stage fermentation → fermented bean curd. After fermentation, the flavor compound content, biogenic amine content, and *E. coli* content of the finished product are determined.

[0079] Example 11 Application of Zygosaccharomyces rouxii DL-WSY01 strain in fish sauce fermentation Referring to GB / T 45810-2025, the technical specification for fish sauce processing, the process flow for fish sauce fermentation is as follows: receiving raw fish → pretreatment, adding 10%–20% edible salt by weight of the fish to maintain raw material quality → salting (increasing the edible salt content to 35%) → (according to 10...) 9 (Inoculate with *Zygosaccharomyces rouxii* DL-WSY01 starter culture at a viable count of CFU / mL (g)) → Ferment naturally for 6 months → Take the clear juice as "first oil" (preservative oil), add low-amino acid nitrogen fish sauce or saturated brine to the residue, at a ratio of 10... 8 Inoculate with *Zygosacchariformis* DL-WSY01 at a viable count of CFU / mL (g), and ferment again for 8 months. Collect the clear liquid as "second oil," and add low-amino acid nitrogen fish sauce or saturated brine to the second residue at a ratio of 10:1. 6 Inoculate *Zygosacchariformis* strain DL-WSY01 at a ratio of CFU / mL (g), and ferment again for 6 months. Collect the clear juice as "three oils." Mix the first, second, and third oils. Filter through a membrane for sterilization. Clarify the product and store it. After fermentation, determine the content of flavor compounds and biogenic amines, as well as detect *E. coli* in the finished product.

[0080] Example 12 Application of Zygosaccharomyces rouxii strain DL-WSY01 in shrimp paste fermentation Referring to DB44 / T 947—2011 Shrimp Paste Processing Technical Specification, the shrimp paste fermentation process is as follows: Raw material shrimp receiving → Pre-treatment, frozen raw materials are first thawed at room temperature below 15℃ → Salting (the amount of edible salt added is 30% of the weight of the raw materials) → (according to 10...) 6 Inoculate with *Zygosacchariformis* DL-WSY01 at a ratio of CFU / mL (g) → natural fermentation for 30 days → color turns slightly red → fermentation ends → ripening → homogenization → filling → pasteurization. The finished product is then tested for flavor compounds, biogenic amines, and *E. coli*.

[0081] Example 13 Application of Zygosaccharomyces rouxii strain DL-WSY01 in fermented soybeans Referring to DB 43 / T 3009—2024 Technical Specification for Fermented Black Beans, the fermentation process for fermented black beans is as follows: Soybean selection and cleaning → soaking and rehydration → steaming at 121℃ for 20 min → draining → cooling to 30℃ → inoculation with Aspergillus oryzae (Hu Niang 3.042) → koji making → incubation at 28℃ for 5 days → breaking up the soybean curds and mixing in 12% salt (by dry weight of soybeans) and 2% white wine (by dry weight of soybeans), at a ratio of 10... 7 Inoculate *Zygosacchariformis* DL-WSY01 at a ratio of CFU / mL (g), stir well, seal and ferment at room temperature for 30 days until maturity. The finished product is then tested for flavor compounds, biogenic amines, and *E. coli*.

[0082] Comparative Example 1 Similar to Example 7, soy sauce fermentation was carried out, but the DL-WSY01 strain of Zygosaccharomyces rouxae used in Example 7 was replaced with the control strain Zygosaccharomyces rouxae CGMCC 2.178 for fermentation.

[0083] Comparative Example 2 Similar to Example 7, soy sauce fermentation was carried out, but the DL-WSY01 strain of Zygosacchari leuciscus used in Example 7 was replaced with the control strain Zygosacchari leuciscus CGMCC 2.1017 for fermentation.

[0084] Comparative Example 3 Similar to Example 8, fermentation of fermented soybean paste was carried out, but the yeast strain DL-WSY01 used in Example 8 was replaced with the control strain Yeast strain CGMCC 2.178 for fermentation.

[0085] Comparative Example 4 Similar to Example 8, fermentation of fermented soybean paste was carried out, but the yeast strain DL-WSY01 used in Example 8 was replaced with the control strain Yeast strain CGMCC 2.1017 for fermentation.

[0086] Comparative Example 5 Similar to Example 9, fermentation of soybean paste was carried out, but the yeast strain DL-WSY01 used in Example 9 was replaced with the control strain Yeast strain CGMCC 2.178 for fermentation.

[0087] Comparative Example 6 Similar to Example 9, fermentation of soybean paste was carried out, but the yeast strain DL-WSY01 used in Example 9 was replaced with the control strain Yeast strain CGMCC 2.1017 for fermentation.

[0088] Comparative Example 7 Similar to Example 10, fermentation of soybean paste was carried out, but the yeast strain DL-WSY01 used in Example 10 was replaced with the control strain Yeast strain CGMCC 2.178 for fermentation.

[0089] Comparative Example 8 Similar to Example 10, fermentation of soybean paste was carried out, but the yeast strain DL-WSY01 used in Example 10 was replaced with the control strain Yeast strain CGMCC 2.1017 for fermentation.

[0090] Comparative Example 9 Similar to Example 11, fermentation of soybean paste was carried out, but the yeast strain DL-WSY01 used in Example 11 was replaced with the control strain Yeast strain CGMCC 2.178 for fermentation.

[0091] Comparative Example 10 Similar to Example 11, fermentation of soybean paste was carried out, but the yeast strain DL-WSY01 used in Example 11 was replaced with the control strain Yeast strain CGMCC 2.1017 for fermentation.

[0092] Comparative Example 11 Similar to Example 12, fermentation of soybean paste was carried out, but the yeast strain DL-WSY01 used in Example 12 was replaced with the control strain Yeast strain CGMCC 2.178 for fermentation.

[0093] Comparative Example 12 Similar to Example 12, fermentation of soybean paste was carried out, but the yeast strain DL-WSY01 used in Example 12 was replaced with the control strain Yeast strain CGMCC 2.1017 for fermentation.

[0094] Comparative Example 13 Similar to Example 13, fermentation of soybean paste was carried out, but the yeast strain DL-WSY01 used in Example 13 was replaced with the control strain Yeast strain CGMCC 2.178 for fermentation.

[0095] Comparative Example 14 Similar to Example 13, fermentation of soybean paste was carried out, but the yeast strain DL-WSY01 used in Example 13 was replaced with the control strain Yeast strain CGMCC 2.1017 for fermentation.

[0096] Test Example 1: Determination of Ester and Alcohol Content Ethanol content was determined using a biosensor, while other flavor compounds were determined using gas chromatography-mass spectrometry (GC-MS) (chromatographic conditions: Agilent 5977B MSD, capillary column HP-5MS (30 m × 0.25 mm × 0.25 µm). The oven temperature gradient was: 35°C for 5 min, then at 3°C / min to 50°C for 3 min; at 4°C / min to 150°C; and at 20°C / min to 250°C, then held for 5 min). Results showed that the flavor compound content of fermented food samples inoculated with *Zygosacchariformis* DL-WSY01 was increased compared to those inoculated with the control strain, indicating that *Zygosacchariformis* DL-WSY01 can increase the ethanol and other flavor compound content in soybean paste, broad bean paste, fermented bean curd, soy sauce, fish sauce, shrimp paste, and fermented black beans during fermentation (Table 2).

[0097] Table 2. Analysis of esters and alcohols in fermented foods (unit: μg / mL or μg / g)

[0098] Note: - indicates below the detection limit; * indicates ethanol is in g / L; # indicates phenylethanol is in mg / L. Test Example 2: Detection of biogenic amine content and Escherichia coli content The biogenic amine content was determined using high-performance liquid chromatography (HPLC), referring to GB 5009.208-2016, National Food Safety Standard for the Determination of Biogenic Amines in Food. Escherichia coli was detected using real-time PCR.

[0099] Table 3 shows that the biogenic amine content of fermentation samples inoculated with *Zygosaccharomyces rouxii* DL-XSY01 was significantly lower than that of fermentation samples inoculated with the control strain, with a reduction of 60%-68%. Regardless of whether *Zygosaccharomyces rouxii* DL-WSY01 was added, the biogenic amine content in all groups under the experimental conditions was below the limit for biogenic amines. This indicates that *Zygosaccharomyces rouxii* DL-WSY01 can significantly reduce the biogenic amine content in fermented foods such as soybean paste, broad bean paste, fermented bean curd, soy sauce, fish sauce, shrimp paste, and fermented black beans during fermentation.

[0100] Furthermore, the fermentation samples inoculated with Zygomyces rouxii DL-WSY01 and the comparative Zygomyces rouxii samples showed no E. coli contamination.

[0101] Table 3. Analysis of biogenic amines in fermented foods (unit: mg / 100g)

[0102] Note: - indicates below the detection limit.

[0103] In summary, *Zygosaccharomyces rouxii* DL-WSY01 produces ethanol and more aroma compounds during fermentation, effectively reduces biogenic amine content, and does not contain any pathogenic bacteria such as *Escherichia coli* or *Staphylococcus aureus*. It also exhibits excellent salt, acid, and ethanol tolerance, thus effectively preserving the flavor and quality of fermented products. Furthermore, *Zygosaccharomyces rouxii* DL-WSY01 is tolerant of the gastrointestinal environment and possesses excellent probiotic properties. As a starter culture, this strain can ensure the safety and flavor quality of fermented foods, shorten the fermentation cycle, and significantly improve the nutritional value of fermented soy products.

[0104] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A strain of Zygosaccharomyces rouxii (Z. rouxii) DL-WSY01, characterized in that, Zygosaccharomyces rouxii ) DL-WSY01, characterized in that, It was deposited on July 18, 2022, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 25335.

2. A microbial preparation, characterized in that, The microbial preparation contains the *Zygosaccharomyces rouxii* DL-WSY01 as described in claim 1.

3. The microbial preparation according to claim 2, characterized in that, The concentration of the Rhizopus sp. DL-WSY01 in the microbial preparation is not less than 1 x 10 6 CFU / mL or 1 x 10 6 CFU / mg.

4. A leavening agent characterized in that, The fermentation agent contains the *Zygosaccharomyces rouxii* DL-WSY01 as described in claim 1 or the microbial preparation as described in any one of claims 2 to 3.

5. Use of the Zygosaccharomyces rouxii DL-WSYOl of claim 1, the microbial preparation of any one of claims 2 to 3, or the starter culture of claim 4 for the preparation of a fermented food product, characterized in that, The fermented food is preferably a fermented condiment; the fermented condiment includes fermented soybean paste, broad bean paste, fermented bean curd, soy sauce, fish sauce, shrimp paste, and fermented black beans.

6. The application of the *Zygosacchariformis* DL-WSY01 as described in claim 1, the microbial preparation as described in any one of claims 2-3, or the starter culture as described in claim 4 in increasing the content of aroma substances in fermented foods.

7. Use according to claim 6, characterized in that, The flavoring substances in fermented foods include one or more of the following: ethanol, phenylethanol, ethyl acetate, ethyl isovalerate, butyl acetate, ethyl palmitate, and ethyl linoleate.

8. The use of the *Zygosaccharomyces rouxii* DL-WSY01 as described in claim 1, the microbial preparation as described in any one of claims 2-3, or the starter culture as described in claim 4 in reducing the content of biogenic amines in fermented foods.

9. Use according to claim 8, characterized in that, Reduced biogenic amines in fermented foods include one or more of tryptophan, β-phenylethylamine, putrescine, cadaverine, histamine, tyramine, spermidine, and spermine.

10. A method of preparing a fermented food product, characterized by, The method involves adding the *Zygosacchariformis* DL-WSY01 as described in claim 1, the microbial preparation as described in any one of claims 2-3, or the fermenting agent as described in claim 4 during the food fermentation process.

Images